Overview
Comprehensive Description
Biology
Inhabits clear shallow waters over rocky bottoms in the vicinity of coral reefs, less frequently in sandy or seagrass areas. Often forms large aggregations during the day. Feeds at night mainly on small fish, shrimps, crabs and cephalopods (Ref. 78464).
-
Allen, G.R. 1985 FAO Species Catalogue. Vol. 6. Snappers of the world. An annotated and illustrated catalogue of lutjanid species known to date. FAO Fish. Synop. 125(6):208 p. Rome: FAO. (Ref. 55)
http://www.fishbase.org/references/FBRefSummary.php?id=55&speccode=81
Trusted
Distribution
Western Atlantic: North Carolina, USA to northeastern Brazil (Ref. 57756), including the Gulf of Mexico (Ref. 9626). Common around the Caribbean.
-
Allen, G.R. 1985 FAO Species Catalogue. Vol. 6. Snappers of the world. An annotated and illustrated catalogue of lutjanid species known to date. FAO Fish. Synop. 125(6):208 p. Rome: FAO. (Ref. 55)
http://www.fishbase.org/references/FBRefSummary.php?id=55&speccode=81
Trusted
Western Atlantic: North Carolina, USA to Venezuela, including the Gulf of Mexico
-
North-West Atlantic Ocean species (NWARMS)
http://www.marinespecies.org/aphia.php?p=sourcedetails&id=2901
Trusted
Gulf of Mexico, North West Atlantic
-
North-West Atlantic Ocean species (NWARMS)
http://www.marinespecies.org/aphia.php?p=sourcedetails&id=2901
-
Felder, D.L. and D.K. Camp (eds.), Gulf of Mexico–Origins, Waters, and Biota. Biodiversity. Texas A&M Press, College Station, Texas.
http://www.marinespecies.org/porifera/porifera.php?p=sourcedetails&id=145245
Trusted
Physical Description
Morphology
Dorsal spines (total): 10; Dorsal soft rays (total): 11 - 12; Analspines: 3; Analsoft rays: 8
-
Allen, G.R. 1985 FAO Species Catalogue. Vol. 6. Snappers of the world. An annotated and illustrated catalogue of lutjanid species known to date. FAO Fish. Synop. 125(6):208 p. Rome: FAO. (Ref. 55)
http://www.fishbase.org/references/FBRefSummary.php?id=55&speccode=81
Trusted
Size
Max. size
48.0 cm TL (male/unsexed; (Ref. 55)); max. published weight: 1,300 g (Ref. 26340)
-
Allen, G.R. 1985 FAO Species Catalogue. Vol. 6. Snappers of the world. An annotated and illustrated catalogue of lutjanid species known to date. FAO Fish. Synop. 125(6):208 p. Rome: FAO. (Ref. 55)
http://www.fishbase.org/references/FBRefSummary.php?id=55&speccode=81
-
Claro, R. 1994 CaracterÃsticas generales de la ictiofauna. p. 55-70. In R. Claro (ed.) Ecología de los peces marinos de Cuba. Instituto de Oceanología Academia de Ciencias de Cuba and Centro de Investigaciones de Quintana Roo. (Ref. 26340)
http://www.fishbase.org/references/FBRefSummary.php?id=26340&speccode=14
Trusted
Diagnostic Description
Lower jaw projecting slightly beyond upper jaw; lower corner of preopercle greatly projecting and strongly serrated. Preorbital bone broad, maxilla extending nearly to mid-eye level. Preopercular notch and knob moderate. Scale rows on back rising obliquely above lateral line. Back and upper side gray to dark olive grading to silvery ventrally. Usually with a black spot, about eye size, on lateral line below the anterior soft dorsal-fin rays.
-
Allen, G.R. 1985 FAO Species Catalogue. Vol. 6. Snappers of the world. An annotated and illustrated catalogue of lutjanid species known to date. FAO Fish. Synop. 125(6):208 p. Rome: FAO. (Ref. 55)
http://www.fishbase.org/references/FBRefSummary.php?id=55&speccode=81
Trusted
Ecology
Habitat
Environment
reef-associated; marine; depth range 0 - 100 m (Ref. 36484)
-
Willoughby, S., J.D. Neilson and C. Taylor 1999 The depth distribution of exploited reef fish populations off the south and west coasts of Barbados. Proc. Gulf Caribb. Fish Inst. 45:57-68. (Ref. 36484)
http://www.fishbase.org/references/FBRefSummary.php?id=36484&speccode=1935
Trusted
benthic
-
North-West Atlantic Ocean species (NWARMS)
http://www.marinespecies.org/aphia.php?p=sourcedetails&id=2901
Trusted
Depth range based on 575 specimens in 1 taxon.
Water temperature and chemistry ranges based on 396 samples.
Environmental ranges
Depth range (m): 0.225 - 36.6
Temperature range (°C): 26.007 - 28.067
Nitrate (umol/L): 0.115 - 3.505
Salinity (PPS): 34.217 - 36.509
Oxygen (ml/l): 4.285 - 4.748
Phosphate (umol/l): 0.046 - 0.239
Silicate (umol/l): 0.805 - 5.080
Graphical representation
Depth range (m): 0.225 - 36.6
Temperature range (°C): 26.007 - 28.067
Nitrate (umol/L): 0.115 - 3.505
Salinity (PPS): 34.217 - 36.509
Oxygen (ml/l): 4.285 - 4.748
Phosphate (umol/l): 0.046 - 0.239
Silicate (umol/l): 0.805 - 5.080
Note: this information has not been validated. Check this *note*. Your feedback is most welcome.
Water temperature and chemistry ranges based on 396 samples.
Environmental ranges
Depth range (m): 0.225 - 36.6
Temperature range (°C): 26.007 - 28.067
Nitrate (umol/L): 0.115 - 3.505
Salinity (PPS): 34.217 - 36.509
Oxygen (ml/l): 4.285 - 4.748
Phosphate (umol/l): 0.046 - 0.239
Silicate (umol/l): 0.805 - 5.080
Graphical representation
Depth range (m): 0.225 - 36.6
Temperature range (°C): 26.007 - 28.067
Nitrate (umol/L): 0.115 - 3.505
Salinity (PPS): 34.217 - 36.509
Oxygen (ml/l): 4.285 - 4.748
Phosphate (umol/l): 0.046 - 0.239
Silicate (umol/l): 0.805 - 5.080
Note: this information has not been validated. Check this *note*. Your feedback is most welcome.
Trusted
Depth: 5 - 20m.
From 5 to 20 meters.
Habitat: reef-associated.
From 5 to 20 meters.
Habitat: reef-associated.
Trusted
Trophic Strategy
Inhabits clear shallow waters over rocky bottoms in the vicinity of coral reefs, less frequently in sandy or seagrass areas. Often forms large aggregations during the day. Feeds at night mainly on small fish, shrimps, crabs and cephalopods. Carnivore (Ref. 57616).
-
Allen, G.R. 1985 FAO Species Catalogue. Vol. 6. Snappers of the world. An annotated and illustrated catalogue of lutjanid species known to date. FAO Fish. Synop. 125(6):208 p. Rome: FAO. (Ref. 55)
http://www.fishbase.org/references/FBRefSummary.php?id=55&speccode=81
Trusted
Molecular Biology and Genetics
Molecular Biology
Barcode data: Lutjanus mahogoni
The following is a representative barcode sequence, the centroid of all available sequences for this species.

There are 21 barcode sequences available from BOLD and GenBank. Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species. See the BOLD taxonomy browser for more complete information about this specimen and other sequences.
Download FASTA File
There are 21 barcode sequences available from BOLD and GenBank. Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species. See the BOLD taxonomy browser for more complete information about this specimen and other sequences.
CCTTTATCTAGTATTTGGTGCCTGGGCCGGAATAGTAGGCACGGCCCTAAGCCTGCTCATTCGAGCAGAACTAAGCCAGCCAGGAGCTCTTCTTGGAGACGACCAGATTTATAATGTAATTGTTACGGCGCATGCGTTTGTAATAATTTTCTTTATAGTAATACCAATCATGATCGGAGGGTTCGGGAACTGACTGATCCCATTAATAATCGGAGCTCCTGATATGGCATTCCCTCGAATAAATAACATGAGCTTTTGACTCCTTCCACCATCATTCCTATTGCTACTCGCCTCTTCTGGAGTAGAAGCCGGTGCTGGAACTGGATGAACAGTTTACCCCCCTCTAGCAGGAAACCTGGCCCACGCGGGAGCATCTGTAGACCTGACTATTTTCTCCCTGCATTTAGCAGGTGTCTCTTCAATTCTAGGGGCCATCAACTTCATTACAACAATTGTTAACATGAAACCCCCTGCCATCTCCCAGTATCAAACACCCCTATTCGTTTGAGCCGTCCTAATTACTGCTGTTCTACTTCTTCTTTCCCTACCAGTTCTAGCGGCCGGAATTACAATACTTCTCACAGACCGAAACCTAAACACAACCTTCTTTGACCCAGCAGGAGGAGGAGACCCCATCCTTTACCAGCACCTGTTC
-- end --
-- end --
Download FASTA File
Trusted
Statistics of barcoding coverage: Lutjanus mahogoni
Barcode of Life Data Systems (BOLDS) Stats
Public Records: 23
Specimens with Barcodes: 28
Species With Barcodes: 1
Public Records: 23
Specimens with Barcodes: 28
Species With Barcodes: 1
Trusted
Genomic DNA is available from 2 specimens with morphological vouchers housed at Bermuda Aquarium, Museum and Zoo
Trusted
Conservation
Threats
Not Evaluated
-
IUCN 2006 2006 IUCN red list of threatened species. www.iucnredlist.org. Downloaded July 2006.
http://www.fishbase.org/references/FBRefSummary.php?id=57073
Trusted
Relevance to Humans and Ecosystems
Benefits
Importance
fisheries: commercial; gamefish: yes
-
Coppola, S.R., W. Fischer, L. Garibaldi, N. Scialabba and K.E. Carpenter 1994 SPECIESDAB: Global species database for fishery purposes. User's manual. FAO Computerized Information Series (Fisheries). No. 9. Rome, FAO. 103 p. (Ref. 171)
http://www.fishbase.org/references/FBRefSummary.php?id=171&speccode=2534
Trusted
Disclaimer
EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.
To request an improvement, please leave a comment on the page. Thank you!


