Overview

Comprehensive Description

Biology

Inhabits clear shallow waters over rocky bottoms in the vicinity of coral reefs, less frequently in sandy or seagrass areas. Often forms large aggregations during the day. Feeds at night mainly on small fish, shrimps, crabs and cephalopods (Ref. 78464).
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Distribution

Western Atlantic: North Carolina, USA to northeastern Brazil (Ref. 57756), including the Gulf of Mexico (Ref. 9626). Common around the Caribbean.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Western Atlantic: North Carolina, USA to Venezuela, including the Gulf of Mexico
Creative Commons Attribution 3.0 (CC BY 3.0)

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Gulf of Mexico, North West Atlantic
Creative Commons Attribution 3.0 (CC BY 3.0)

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Western Atlantic.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Physical Description

Morphology

Dorsal spines (total): 10; Dorsal soft rays (total): 11 - 12; Analspines: 3; Analsoft rays: 8
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Size

Maximum size: 480 mm TL
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Max. size

48.0 cm TL (male/unsexed; (Ref. 55)); max. published weight: 1,300 g (Ref. 26340)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Diagnostic Description

Lower jaw projecting slightly beyond upper jaw; lower corner of preopercle greatly projecting and strongly serrated. Preorbital bone broad, maxilla extending nearly to mid-eye level. Preopercular notch and knob moderate. Scale rows on back rising obliquely above lateral line. Back and upper side gray to dark olive grading to silvery ventrally. Usually with a black spot, about eye size, on lateral line below the anterior soft dorsal-fin rays.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Ecology

Habitat

Environment

reef-associated; marine; depth range 0 - 100 m (Ref. 36484)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

benthic
Creative Commons Attribution 3.0 (CC BY 3.0)

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Depth range based on 575 specimens in 1 taxon.
Water temperature and chemistry ranges based on 396 samples.

Environmental ranges
  Depth range (m): 0.225 - 36.6
  Temperature range (°C): 26.007 - 28.067
  Nitrate (umol/L): 0.115 - 3.505
  Salinity (PPS): 34.217 - 36.509
  Oxygen (ml/l): 4.285 - 4.748
  Phosphate (umol/l): 0.046 - 0.239
  Silicate (umol/l): 0.805 - 5.080

Graphical representation

Depth range (m): 0.225 - 36.6

Temperature range (°C): 26.007 - 28.067

Nitrate (umol/L): 0.115 - 3.505

Salinity (PPS): 34.217 - 36.509

Oxygen (ml/l): 4.285 - 4.748

Phosphate (umol/l): 0.046 - 0.239

Silicate (umol/l): 0.805 - 5.080
 
Note: this information has not been validated. Check this *note*. Your feedback is most welcome.
Public Domain

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Depth: 5 - 20m.
From 5 to 20 meters.

Habitat: reef-associated.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Trophic Strategy

Inhabits clear shallow waters over rocky bottoms in the vicinity of coral reefs, less frequently in sandy or seagrass areas. Often forms large aggregations during the day. Feeds at night mainly on small fish, shrimps, crabs and cephalopods. Carnivore (Ref. 57616).
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Lutjanus mahogoni

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 21 barcode sequences available from BOLD and GenBank.  Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

CCTTTATCTAGTATTTGGTGCCTGGGCCGGAATAGTAGGCACGGCCCTAAGCCTGCTCATTCGAGCAGAACTAAGCCAGCCAGGAGCTCTTCTTGGAGACGACCAGATTTATAATGTAATTGTTACGGCGCATGCGTTTGTAATAATTTTCTTTATAGTAATACCAATCATGATCGGAGGGTTCGGGAACTGACTGATCCCATTAATAATCGGAGCTCCTGATATGGCATTCCCTCGAATAAATAACATGAGCTTTTGACTCCTTCCACCATCATTCCTATTGCTACTCGCCTCTTCTGGAGTAGAAGCCGGTGCTGGAACTGGATGAACAGTTTACCCCCCTCTAGCAGGAAACCTGGCCCACGCGGGAGCATCTGTAGACCTGACTATTTTCTCCCTGCATTTAGCAGGTGTCTCTTCAATTCTAGGGGCCATCAACTTCATTACAACAATTGTTAACATGAAACCCCCTGCCATCTCCCAGTATCAAACACCCCTATTCGTTTGAGCCGTCCTAATTACTGCTGTTCTACTTCTTCTTTCCCTACCAGTTCTAGCGGCCGGAATTACAATACTTCTCACAGACCGAAACCTAAACACAACCTTCTTTGACCCAGCAGGAGGAGGAGACCCCATCCTTTACCAGCACCTGTTC
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Statistics of barcoding coverage: Lutjanus mahogoni

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 23
Specimens with Barcodes: 28
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Genomic DNA is available from 2 specimens with morphological vouchers housed at Bermuda Aquarium, Museum and Zoo
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© Ocean Genome Legacy

Source: Ocean Genome Resource

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Conservation

Threats

Not Evaluated
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Relevance to Humans and Ecosystems

Benefits

Importance

fisheries: commercial; gamefish: yes
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!