Articles on this page are available in 1 other language: Chinese (Simplified) (4) (learn more)

Overview

Comprehensive Description

Biology

One of the most common of the squirrelfishes that occurs in outer reef areas, also encountered in lagoons and drop-offs from less than 2 to 40 m; either solitary or in groups (Ref. 27370). Nocturnal, feeds mainly on benthic crabs and shrimps.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Distribution

Indo-Pacific: Red Sea and East Africa (south to the latitude of the Xora River, South Africa) to the Marshall Islands and French Polynesia, north to Japan, south to Australia.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Red Sea, Indo-West Pacific: East Africa, Transkei (South Africa), Seychelles, Madagascar and western Mascarenes east to Hawaiian Islands and Pitcairn Group, north to southern Japan and Minami Tori Shima, south to Western Australia at 17°30'S, Queensland (
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Physical Description

Morphology

Dorsal spines (total): 11; Dorsal soft rays (total): 13 - 15; Analspines: 4; Analsoft rays: 8 - 9
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Size

Maximum size: 250 mm TL
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Max. size

25.0 cm TL (male/unsexed; (Ref. 4201))
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Diagnostic Description

Description

Occurs in coral-rich areas of outer reef slopes and dropoffs from 6 to over 40 m. Nocturnal, feeds mainly on benthic crabs and shrimps.
  • Anon. (1996). FishBase 96 [CD-ROM]. ICLARM: Los Baños, Philippines. 1 cd-rom pp.
Creative Commons Attribution 3.0 (CC BY 3.0)

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Head and body red, edges of scales silver; silvery white spot anterodorsally on caudal peduncle (often disappears after death); spinous part of dorsal fin mottled light red, the outer part of the membranes bright red (Ref. 4201). 4-5 oblique rows of scales on cheek. Body depth 2.3-2.7 in SL; head length 2.3-2.8 in SL; snout length 3.6-4.0 in head length. Maxilla extending posteriorly from front of pupil to the center of eye; upper jaw length 2.7-2.95 in head length; premaxillary groove reaching about front edge of orbit; anterior end of nasal bone with 2 short diverging spines; spine at edge of premaxillary groove absent; anterior edge of nasal fossa with 1 (rarely 2) spinule; upper edge of first suborbital bone not serrated (Ref. 27370).
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Ecology

Habitat

Environment

reef-associated; marine; depth range 2 - 40 m (Ref. 27370)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Depth range based on 85 specimens in 1 taxon.
Water temperature and chemistry ranges based on 57 samples.

Environmental ranges
  Depth range (m): 0.5 - 878
  Temperature range (°C): 25.275 - 29.282
  Nitrate (umol/L): 0.019 - 1.118
  Salinity (PPS): 33.821 - 40.307
  Oxygen (ml/l): 4.314 - 4.806
  Phosphate (umol/l): 0.087 - 0.277
  Silicate (umol/l): 0.810 - 4.752

Graphical representation

Depth range (m): 0.5 - 878

Temperature range (°C): 25.275 - 29.282

Nitrate (umol/L): 0.019 - 1.118

Salinity (PPS): 33.821 - 40.307

Oxygen (ml/l): 4.314 - 4.806

Phosphate (umol/l): 0.087 - 0.277

Silicate (umol/l): 0.810 - 4.752
 
Note: this information has not been validated. Check this *note*. Your feedback is most welcome.

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Depth: 2 - 40m.
From 2 to 40 meters.

Habitat: reef-associated. Tailspot squirrelfish.  (Ruppell, 1838)  
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Trophic Strategy

One of the most common of the squirrelfishes that occurs in outer reef areas, also encountered in lagoons and dropoffs from less than 2 to 40 m; either solitary or in groups. Nocturnal, feeds mainly on benthic crabs and shrimps. Also Ref. 9137, 58534.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Partner Web Site: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Sargocentron caudimaculatum

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 5 barcode sequences available from BOLD and GenBank.

Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.

See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

ACCCTTTATTTAGTATTCGGTGCCTGAGCTGGAATAGTTGGTACAGCCCTTAGCCTTCTTATTCGAGCTGAACTTAGCCAGCCTGGAGCTCTCCTGGGAGACGACCAGATTTATAATGTCATTGTTACAGCCCACGCATTTGTAATAATTTTCTTTATAGTAATGCCAATTATGATTGGAGGCTTTGGGAACTGACTAATCCCCCTAATGATTGGAGCCCCTGACATAGCATTCCCTCGGATAAATAACATAAGCTTTTGACTATTACCCCCATCATTCCTCCTTCTACTAGCCTCTTCCGGAGTAGAAGCTGGTGCCGGTACAGGATGAACAGTATACCCACCCCTTGCAGGTAATTTAGCCCACGCAGGGGCTTCTGTTGACCTTACTATTTTCTCACTCCATCTAGCAGGTATTTCTTCAATTCTTGGGGCCATTAATTTTATTACAACTATTATTAACATAAAACCCCCTGCCATTTCCCAATACCAAACTCCCCTATTTGTATGAGCCGTTCTCATCACAGCTGTCCTTCTACTTCTATCCCTACCCGTGCTCGCAGCAGGAATTACCATGCTACTAACAGACCGAAACCTAAACACAACATTCTTCGACCCAACACGGGGTGGAGACCCAATCCTTTACCAACACTTA
-- end --

Download FASTA File

Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Sargocentron caudimaculatum

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 6
Specimens with Barcodes: 21
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Conservation

Threats

Not Evaluated
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Relevance to Humans and Ecosystems

Benefits

Importance

fisheries: minor commercial; aquarium: commercial; price category: medium; price reliability: very questionable: based on ex-vessel price for species in this family
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!