You are viewing this Taxon as classified by:

Overview

Comprehensive Description

Biology

Occurs in lagoon and seaward reefs. Hides in crevices under rocks and coral formations during the day and hunts at night. Typically with head towards the safety of their hide-out or narrow passage (Ref. 48635). Feeds on shrimps and crabs. Venomous and capable of inflicting a painful sting. Minimum depth reported taken from Ref. 30874. Solitary or in groups, under ledges and holes (Ref. 37816).
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Distribution

Indo-Pacific: East Africa to Marquesan and Mangaréva islands, north to southern Japan, south to Queensland, Australia and Kermadec (Ref. 8879) and Austral islands.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Chagos, Kenya, Madagascar, Mauritius, Mozambique, New Zealand Exclusive Economic Zone, Reunion, Seychelles, South Africa (country)
Creative Commons Attribution 3.0 (CC BY 3.0)

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Red Sea, Indo-West Pacific: East and South Africa, Madagascar and Mascarenes east to Wake Atoll, northern Line Islands and Pitcairn Group, north to southern Japan, south to Western Australia at 32°09'S, Sydney (New South Wales), Kermadec Islands and Rapa.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Physical Description

Morphology

Dorsal spines (total): 13; Dorsal soft rays (total): 11 - 12; Analspines: 3; Analsoft rays: 6
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Size

Maximum size: 200 mm TL
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Max. size

20.0 cm TL (male/unsexed; (Ref. 4313))
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Diagnostic Description

Reddish to tan with many dark bars on body; median fins with scattered dark spots; tentacle above eye long and with dark bands (Ref. 4313). Adults with bluish black blotches near the base of the pectoral fins (Ref. 48635)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Description

Occurs in lagoon and seaward reefs to a depth of at least 50 m. Hides in crevices under rocks and coral formations during the day and hunts at night, feeding on shrimps and crabs. Venomous and capable of inflicting a painful sting.
Creative Commons Attribution 3.0 (CC BY 3.0)

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Ecology

Habitat

Environment

reef-associated; marine; depth range 2 - 50 m (Ref. 9710)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Depth range based on 112 specimens in 1 taxon.
Water temperature and chemistry ranges based on 58 samples.

Environmental ranges
  Depth range (m): 0.4575 - 449.265
  Temperature range (°C): 22.496 - 29.264
  Nitrate (umol/L): 0.050 - 3.804
  Salinity (PPS): 32.279 - 36.148
  Oxygen (ml/l): 3.916 - 5.079
  Phosphate (umol/l): 0.073 - 0.449
  Silicate (umol/l): 0.736 - 4.892

Graphical representation

Depth range (m): 0.4575 - 449.265

Temperature range (°C): 22.496 - 29.264

Nitrate (umol/L): 0.050 - 3.804

Salinity (PPS): 32.279 - 36.148

Oxygen (ml/l): 3.916 - 5.079

Phosphate (umol/l): 0.073 - 0.449

Silicate (umol/l): 0.736 - 4.892
 
Note: this information has not been validated. Check this *note*. Your feedback is most welcome.
Public Domain

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Depth: 2 - 50m.
From 2 to 50 meters.

Habitat: reef-associated. Broadbarred firefish.  (Bloch, 1787)  Attains about 20 cm. Tentacle above eye usually long with dark bands. Natal northwards and to central Pacific.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Trophic Strategy

Occurs in lagoon and seaward reefs. Hides in crevices under rocks and coral formations during the day and hunts at night, feeding on shrimps and crabs (Ref. 4313).
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Diseases and Parasites

Turbidity of the Skin (Marine fish). Parasitic infestations (protozoa, worms, etc.)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Pterois antennata

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 16 barcode sequences available from BOLD and GenBank.  Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

CACCCTGTATCTAGTATTTGGTGCCTGAGCCGGTATAGTAGGCACAGCCTTGAGCCTGCTTATTCGGGCAGAACTCAGTCAACCAGGCGCCCTATTAGGGGACGACCAAATCTATAACGTAATTGTTACAGCCCATGCGTTCGTAATAATTTTCTTTATAGTAATACCAATCATGATTGGGGGTTTTGGAAACTGACTTATCCCATTAATGATTGGGGCACCAGACATAGCATTTCCTCGTATGAACAACATAAGCTTTTGACTTCTTCCACCCTCTTTCCTGCTTCTCCTGGCCTCTTCCGGGGTTGAAGCAGGGGCTGGAACAGGTTGAACAGTCTACCCGCCCTTGGCGGGCAACCTTGCCCACGCGGGGGCATCTGTAGACCTAACAATTTTTTCCTTGCACTTAGCAGGTATTTCATCAATTCTAGGGGCCATTAACTTTATTACAACAATTATTAACATGAAGCCCCCAGCGATTTCTCAGTACCAAACTCCTTTATTTGTATGGGCTGTTTTAATTACGGCAGTTGTTCTACTTCTTTCACTACCAGTCCTTGCCGCCGGCATTACGATGCTACTCACTGATCGGAACCTTAACACCACCTTCTTTGACCCGGCGGGGGGAGGAGACCCGATTCTTTACCAACACCT
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Statistics of barcoding coverage: Pterois antennata

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 16
Specimens with Barcodes: 22
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Conservation

Threats

Not Evaluated
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Relevance to Humans and Ecosystems

Benefits

Importance

fisheries: subsistence fisheries; aquarium: commercial
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Wikipedia

Pterois antennata

Pterois antennata or Broadbarred firefish is a fish of the genus Pterois. Found in the tropical Indian Ocean and Western Pacific, it grows to a maximum of 20 centimetres (8 in) and packs a venomous sting. The typical habitat of a broadbarred firefish is in lagoons and reefs, where it hides during the day and hunts shrimp and crab during the night.

Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

 

Source: Wikipedia

Unreviewed

Article rating from 0 people

Average rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!