Articles on this page are available in 1 other language: Chinese (Simplified) (4) (learn more)

Overview

Comprehensive Description

Biology

Occurs in lagoon and seaward reefs. Hides in crevices under rocks and coral formations during the day and hunts at night. Typically with head towards the safety of their hide-out or narrow passage (Ref. 48635). Feeds on shrimps and crabs. Venomous and capable of inflicting a painful sting. Minimum depth reported taken from Ref. 30874. Solitary or in groups, under ledges and holes (Ref. 37816).
  • Eschmeyer, W.N. 1986 Scorpaenidae. p. 463-478. In M.M. Smith and P.C. Heemstra (eds.) Smiths' sea fishes. Springer-Verlag, Berlin. (Ref. 4313)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Distribution

Broadbarred firefish (Bloch, 1787) are found in the Indo-West Pacific region. This species ranges from east Africa to the Marquesan and Mangaréva islands and from northern Japan to Queensland, Australia, and can also be found in the waters surrounding the Kermadec and Austral islands.

Biogeographic Regions: indian ocean (Native ); pacific ocean (Native )

  • Fuller, P. 1999. "Nonindigenous Aquatic Species" (On-line). USCS. Accessed November 01, 2011 at http://nas.er.usgs.gov/fishes/accounts/scorpaen/pt_volit.html..
  • Lieske, E., R. Myers. 1994. Collins Pocket Guide Coral reef fishes Indo-Pacific & Caribbean including the Red Sea. London, UK: HarperCollins Publishers.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Indo-Pacific: East Africa to Marquesan and Mangaréva islands, north to southern Japan, south to Queensland, Australia and Kermadec (Ref. 8879) and Austral islands.
  • Eschmeyer, W.N. 1986 Scorpaenidae. p. 463-478. In M.M. Smith and P.C. Heemstra (eds.) Smiths' sea fishes. Springer-Verlag, Berlin. (Ref. 4313)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Red Sea, Indo-West Pacific: East and South Africa, Madagascar and Mascarenes east to Wake Atoll, northern Line Islands and Pitcairn Group, north to southern Japan, south to Western Australia at 32°09'S, Sydney (New South Wales), Kermadec Islands and Rapa.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Physical Description

Morphology

Broadbarred firefish show the typical morphology of members of the genus Pterois, with a laterally compressed, somewhat deep body and elaborate dorsal, pectoral, and pelvic fins. The first dorsal fin contains 12 to 13 spines, the second contains 11 to 12 soft rays, the anal fin is composed of 3 spines followed by 6 soft anal rays, and the pectoral fin contains 17 unbranched, soft rays. Teeth are numerous and very small, occurring on the upper and lower jaws in densely packed bilateral clusters and in a small patch on the anterior roof of the mouth. Coloration varies between individuals, but is typically reddish to tan with many dark vertical bars on the body, with the interradial membranes of the pectorial fins containing multiple scattered, dark-colored spots. Adults also have bluish black blotches near the bases of their pectoral fins. There is no difference in color pattern between sexes. Juveniles have structures called supraorbital tentacles located above their eyes (which may persist into adulthood) that show differences in shape and color between Pterois species. In broadbarred firefish, these tentacles are black, with brown bars.

Range length: 30 to 38.1 cm.

Other Physical Features: ectothermic ; heterothermic ; bilateral symmetry ; venomous

Sexual Dimorphism: sexes alike

  • Myers, R. 1999. Micronesian reef fishes: a comprehensive guide to the coral reef fishes of Micronesia, 3rd revised and expanded edition. Barrigada, Guam: Coral Graphics.
  • Paulin, C. 1982. Scorpionfishes of New Zealand (Pisces: Scorpaenidae). New Zealand Journal of Zoology, 9: 437-450.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Dorsal spines (total): 13; Dorsal soft rays (total): 11 - 12; Analspines: 3; Analsoft rays: 6
  • Myers, R.F. 1991 Micronesian reef fishes. Second Ed. Coral Graphics, Barrigada, Guam. 298 p. (Ref. 1602)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Size

Maximum size: 200 mm TL
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Max. size

20.0 cm TL (male/unsexed; (Ref. 4313))
  • Eschmeyer, W.N. 1986 Scorpaenidae. p. 463-478. In M.M. Smith and P.C. Heemstra (eds.) Smiths' sea fishes. Springer-Verlag, Berlin. (Ref. 4313)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Diagnostic Description

Reddish to tan with many dark bars on body; median fins with scattered dark spots; tentacle above eye long and with dark bands (Ref. 4313). Adults with bluish black blotches near the base of the pectoral fins (Ref. 48635)Description: Characterized by narrow and oblique brown to reddish-brown bars on caudal peduncle; three dark brown bars on head including one through eye that ends at large blackish or dark brown spot on subopercle; dorsal spines free of membrane except basally; enlarged and wing-like pectoral fins with rays free of membrane on outer one-half to three-fourths, all rays unbranched; body depth 2.5-2.7 in SL (Ref. 90102).
  • Myers, R.F. 1991 Micronesian reef fishes. Second Ed. Coral Graphics, Barrigada, Guam. 298 p. (Ref. 1602)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Description

Occurs in lagoon and seaward reefs to a depth of at least 50 m. Hides in crevices under rocks and coral formations during the day and hunts at night, feeding on shrimps and crabs. Venomous and capable of inflicting a painful sting.
  • Anon. (1996). FishBase 96 [CD-ROM]. ICLARM: Los Baños, Philippines. 1 cd-rom pp.
Creative Commons Attribution 3.0 (CC BY 3.0)

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Ecology

Habitat

Broadbarred firefish are inhabitants of near and offshore coral and rocky reefs to depths of 50 meters. This species displays an obvious preference for sheltering under ledges or in caves and crevices by day, coming out to hunt over the reef at night.

Range depth: 1 to 50 m.

Habitat Regions: tropical ; saltwater or marine

Aquatic Biomes: reef ; coastal

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Environment

reef-associated; marine; depth range 2 - 50 m (Ref. 9710)
  • Lieske, E. and R. Myers 1994 Collins Pocket Guide. Coral reef fishes. Indo-Pacific & Caribbean including the Red Sea. Haper Collins Publishers, 400 p. (Ref. 9710)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Depth range based on 112 specimens in 1 taxon.
Water temperature and chemistry ranges based on 58 samples.

Environmental ranges
  Depth range (m): 0.4575 - 449.265
  Temperature range (°C): 22.496 - 29.264
  Nitrate (umol/L): 0.050 - 3.804
  Salinity (PPS): 32.279 - 36.148
  Oxygen (ml/l): 3.916 - 5.079
  Phosphate (umol/l): 0.073 - 0.449
  Silicate (umol/l): 0.736 - 4.892

Graphical representation

Depth range (m): 0.4575 - 449.265

Temperature range (°C): 22.496 - 29.264

Nitrate (umol/L): 0.050 - 3.804

Salinity (PPS): 32.279 - 36.148

Oxygen (ml/l): 3.916 - 5.079

Phosphate (umol/l): 0.073 - 0.449

Silicate (umol/l): 0.736 - 4.892
 
Note: this information has not been validated. Check this *note*. Your feedback is most welcome.

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Depth: 2 - 50m.
From 2 to 50 meters.

Habitat: reef-associated. Broadbarred firefish.  (Bloch, 1787)  Attains about 20 cm. Tentacle above eye usually long with dark bands. Natal northwards and to central Pacific.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Trophic Strategy

Broadbarred firefish are important predators in many coral reef environments, feeding mostly on crustaceans, as well as other invertebrates, and small fishes, including juveniles of their own species. They are known to feed on juveniles of many commercially fished species, like Lutjanus campechanus (red snapper), Plectropomus laevis (coral trout), and Stenopus hispidus (banded coral shrimp). This species consumes an average of 8.2 times its body weight (up to 45 kg of prey) per year. As juveniles, they consume 5.5 to 13.5 g per day and 14.6 g per day as adults.

Broadbarred firefish are skilled hunters, using specialized bilateral swim bladder muscles to provide precise control of their position in the water column, allowing a fish to adjust its center of gravity to better attack its prey. When they stalk their prey, they raise their pectoral fins in a shielding fashion. This display, along with the body coloration of this species, decreases the visibility of the firefish to potential prey, blending its body outline into the irregular background patterns of coral branches, feather stars, and sea urchin spines. The firefish attacks with one swift gulping motion, sucking the prey into its mouth.

Animal Foods: fish; aquatic crustaceans; other marine invertebrates

Primary Diet: carnivore (Piscivore , Eats non-insect arthropods)

  • Albins, M., M. Hixon. 2008. Invasive Indo-Pacific lionfish Pterois volitans reduce recruitment of Atlantic coral-reef fishes. Marine Ecology Program, Series 367: 233-238.
  • Harmelin-Vivien, M., C. Bouchon. 1976. Feeding behavior of some carnivorous fishes (Serranidae and Scorpaenidae) from Tuléar (Madagascar). Marine Biology, 37: 329-340.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Occurs in lagoon and seaward reefs. Hides in crevices under rocks and coral formations during the day and hunts at night, feeding on shrimps and crabs (Ref. 4313).
  • Eschmeyer, W.N. 1986 Scorpaenidae. p. 463-478. In M.M. Smith and P.C. Heemstra (eds.) Smiths' sea fishes. Springer-Verlag, Berlin. (Ref. 4313)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Partner Web Site: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Associations

Pterois species are important secondary and tertiary consumers in coral reef ecosystems.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Anti-predator adaptations of broadbarred firefish include aposematic coloration, motionless/still behavior during daylight hours, and venomous glandular tissue that produces painful toxins sheathing the dorsal, pelvic, and anal spines.

Known Predators:

Anti-predator Adaptations: aposematic

  • Church, J., W. Hodgson. 2001. The pharmacological activity of fish venoms. Toxicon, Volume: 40, Issue: 8: 1083-1093.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Diseases and Parasites

Turbidity of the Skin (Marine fish). Parasitic infestations (protozoa, worms, etc.)
  • Bassleer, G. 2000 Diseases in marine aquarium fish: causes, development, symptoms, treatment. Bassleer Biofish, Westmeerbeek, Belgium, 96 p. Second edition. (Ref. 41806)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Life History and Behavior

Behavior

Communication appears to occur mainly via visual cues. If a male encounters another male during foraging, the more aggressive male will turn a darker color and point its venomous, spiny dorsal fins at the other individual. The less dominant lionfish will usually fold down its pectoral fins and swim away.

Like other bony fish, lionfish possess sensory structures to perceive vibrations and pressure (the lateral line), chemicals (nares), and eyes that may distinguish polarized light.

Communication Channels: visual ; tactile

Other Communication Modes: vibrations

Perception Channels: visual ; polarized light ; tactile ; acoustic ; vibrations ; chemical

  • Fishelson, L. 1997. Experiments and observations on food consumption growth and starvation in Dendrochirus brachypterus and Pterois volitans (Pteroinae, Scorpaenidae). Environmental Biology of Fishes, 50: 391-403.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Life Cycle

In Pterois species, early embryo formation is evident approximately twelve hours after fertilization. The head and eyes become moderately developed about 18 hours post-fertilization. Eventually, invading microbes deteriorate the mucus wall of the egg capsule, and 36 hours after fertilization, the larvae hatch. Broadbarred firefish larvae, like those of many reef fishes, are planktonic and invest most of their energy in growth early in life. Four days after egg fertilization, the larvae are already good swimmers and are able to feed on small ciliates. Larvae settle out of the water column after approximately 25 to 40 days, at a length of 10-12 mm.

  • Fishelson, L. 1975. Ethology and reproduction of the pteroid fishes found in the Gulf of Aqaba (Red Sea) especially Dendrochirus brachypterus (Cuvier) Pteroidae (Teleostei). Pubblicazioni della Stazione zoologica di Napoli, 39: 635-656..
  • Stearns, S., R. Crandall. 1984. Plasticity for age and size at sexual maturity: a life-history response to unavoidable stress. Fish Reproduction: Strategies and Tactics, Academic Press, London: 13-33.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Life Expectancy

Information regarding the lifespan of broadbarred firefish in the wild and in captivity is currently unavailable.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Reproduction

Information regarding specifics of the mating system of broadbarred firefish is currently unavailable. Pterois species are generally solitary, but form spawning aggregations. When preparing to spawn, males become darker and more uniformly colored, as their stripes become less apparent. Females with ripening eggs become paler and their belly, pharyngeal region, and mouth become silvery white. As a result, the females are easier for the males to detect visually. Courtship behavior begins at dusk and is always initiated by the males. After a male selects a mate by visual indicators, he circles the female. After circling several times, the male then ascends to the water surface followed by the female. The two may descend and ascend several times before they spawn. On the final ascent, the male and female will swim around just beneath the surface of the water while the female releases her egg masses. Mating is promiscuous, with one male usually spawning with several females.

Breeding Pterois males are particularly aggressive, especially when a competitor invades the territory of a male courting his female. The aggressive male will approach the intruder and spread his pectoral fins, swimming back and forth in front of the intruder with his head pointed down, pointing the venomous dorsal spines forward. If this display does not deter the challenging male, the aggressive male shakes its head prior to charging the intruder in an attempt to bite the intruder's head. This may result in the intruder having parts of its mouth torn off, and the aggressor may become impaled on the spines of the intruder.

Mating System: polygynous ; polygynandrous (promiscuous)

Although information regarding specific reproductive behaviors in broadbarred firefish is not available, general reproductive behaviors have been found to be fairly similar between other Pterois species. Spawning appears to occur year-round. Fertilization is external, with the female releasing egg masses containing up to 15,000 individual eggs. These masses are comprised of two hollow mucus tubes, which float just below the surface. Within 15 minutes, the tubes absorb seawater and become oval balls 2-5 cm in diameter. As the female spawns, the male releases sperm, which penetrates the mucus balls and fertilizes the eggs within. Fertilized eggs usually hatch within 36 hours.

Breeding interval: Breeding may occur monthly.

Breeding season: Breeding can occur year round.

Range number of offspring: 2,000 to 15,000.

Average gestation period: 36 hours.

Key Reproductive Features: iteroparous ; year-round breeding ; gonochoric/gonochoristic/dioecious (sexes separate); sexual ; fertilization (External ); oviparous

As broadcast spawners, broadbarred firefish provide no parental investment beyond the nutrients that females provide via the yolks of their eggs.

Parental Investment: no parental involvement; pre-hatching/birth (Provisioning: Female)

  • Beckel, T. 2010. "Lionfish (Genus Pterois)" (On-line). Accessed November 01, 2011 at http://www.lionfishhunters.org/Lionfish.html.
  • Fishelson, L. 1975. Ethology and reproduction of the pteroid fishes found in the Gulf of Aqaba (Red Sea) especially Dendrochirus brachypterus (Cuvier) Pteroidae (Teleostei). Pubblicazioni della Stazione zoologica di Napoli, 39: 635-656..
  • Lieske, E., R. Myers. 1994. Collins Pocket Guide Coral reef fishes Indo-Pacific & Caribbean including the Red Sea. London, UK: HarperCollins Publishers.
  • Myers, R. 1999. Micronesian reef fishes: a comprehensive guide to the coral reef fishes of Micronesia, 3rd revised and expanded edition. Barrigada, Guam: Coral Graphics.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Pterois antennata

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 16 barcode sequences available from BOLD and GenBank.

Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.

See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

CACCCTGTATCTAGTATTTGGTGCCTGAGCCGGTATAGTAGGCACAGCCTTGAGCCTGCTTATTCGGGCAGAACTCAGTCAACCAGGCGCCCTATTAGGGGACGACCAAATCTATAACGTAATTGTTACAGCCCATGCGTTCGTAATAATTTTCTTTATAGTAATACCAATCATGATTGGGGGTTTTGGAAACTGACTTATCCCATTAATGATTGGGGCACCAGACATAGCATTTCCTCGTATGAACAACATAAGCTTTTGACTTCTTCCACCCTCTTTCCTGCTTCTCCTGGCCTCTTCCGGGGTTGAAGCAGGGGCTGGAACAGGTTGAACAGTCTACCCGCCCTTGGCGGGCAACCTTGCCCACGCGGGGGCATCTGTAGACCTAACAATTTTTTCCTTGCACTTAGCAGGTATTTCATCAATTCTAGGGGCCATTAACTTTATTACAACAATTATTAACATGAAGCCCCCAGCGATTTCTCAGTACCAAACTCCTTTATTTGTATGGGCTGTTTTAATTACGGCAGTTGTTCTACTTCTTTCACTACCAGTCCTTGCCGCCGGCATTACGATGCTACTCACTGATCGGAACCTTAACACCACCTTCTTTGACCCGGCGGGGGGAGGAGACCCGATTCTTTACCAACACCT
-- end --

Download FASTA File

Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Pterois antennata

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 17
Specimens with Barcodes: 27
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Conservation

Conservation Status

Broadbarred firefish are not currently listed as threatened or endangered. However, continued degradation of coral reefs is expected to reduce populations of many of the fish and crustaceans that they feed on. If they are unable to exploit alternate food sources, their populations may also decrease. Although broadbarred firefish are widely distributed, the status of their various populations should be monitored. Additional genetic research may reveal that this widely distributed species is in fact a species complex awaiting further scientific description.

US Federal List: no special status

CITES: no special status

State of Michigan List: no special status

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Threats

Not Evaluated
  • IUCN 2006 2006 IUCN red list of threatened species. www.iucnredlist.org. Downloaded July 2006.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Relevance to Humans and Ecosystems

Benefits

Two of the 15 currently recognized Pterois species (Pterois miles and Pterois miles) have established themselves as significant invasive species. Although eradication of these exotic species is desired, the fact that members of this genus are able to reproduce monthly throughout the entire year means that in order to successfully remove the species, monthly control efforts must be undertaken to ensure population control. Research suggests that invasive lionfish are already having substantial negative impacts on Atlantic coral reefs, causing significant reductions in the recruitment of native fishes. Furthermore, these species are aggressive towards humans and should be treated with caution at all times. Worldwide, scorpionfishes (a taxonomic order that includes Pterois species) rank second only to stingrays in total number of human envenomations by fish species. Puncture wounds from Pterois species' spines can cause extreme pain, potentially lasting for days, accompanied by sweating and respiratory depression. Experimental evidence suggests that stonefish (Synanceia verrucosa) antivenom has some detoxifying effect on lionfish venom.

Negative Impacts: injures humans (bites or stings, venomous )

  • Shiomi, K., M. Hosaka, S. Fujita, H. Yamanaka, T. Kikuchi. 1989. Venoms from six species of marine fish lethal and hemolytic activities and their neutralization by commercial stonefish antivenom. Marine Biology, 103 Edition 3: 285-290.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Although broadbarred firefish are valued as food in many parts of its native range, its economic benefit to humans as a staple of the trade in aquarium fishes far exceeds its value as table fare. This species also plays a role in tourism, as recreational divers in areas where broadbarred firefish are found count this species among the many attractions of diving over a tropical coral reef.

Positive Impacts: pet trade ; food ; ecotourism

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Importance

fisheries: subsistence fisheries; aquarium: commercial
  • Edwards, A.J. and A.D. Shepherd 1992 Environmental implications of aquarium-fish collection in the Maldives, with proposals for regulation. Environ. Conserv. 19:61-72. (Ref. 4907)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Wikipedia

Pterois antennata

The spotfin lionfish[1] or broadbarred firefish, Pterois antennata, is a fish found in the tropical Indian and Western Pacific Oceans; it grows to a maximum of 20 cm (8 in) and packs a venomous sting. Its typical habitat is in lagoons and reefs, where it hides during the day and hunts shrimp and crab at night.

References[edit]

  1. ^ Froese, Rainer, and Daniel Pauly, eds. (2012). Species of Pterois in FishBase. December 2012 version.
Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

Source: Wikipedia

Unreviewed

Article rating from 0 people

Default rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!