Overview

Comprehensive Description

Biology

Inhabits reefs, mangrove estuaries, and offshore trawling grounds (Ref. 3132). Found over muddy bottoms in shallow estuaries and along coasts. Marketed fresh (Ref. 12693).
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Distribution

Indo-West Pacific.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Indo-West Pacific: northwestern Australia, the Arafura Sea (Ref. 9819), Thailand, Indonesia and Papua New Guinea. Known from the Mekong delta (Ref. 12693).
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Physical Description

Size

Maximum size: 300 mm TL
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Max. size

30.0 cm TL (male/unsexed; (Ref. 3132))
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Ecology

Habitat

Environment

reef-associated; brackish; marine
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Depth range based on 11 specimens in 1 taxon.
Water temperature and chemistry ranges based on 4 samples.

Environmental ranges
  Depth range (m): 0.5 - 68.6915
  Temperature range (°C): 24.491 - 24.872
  Nitrate (umol/L): 0.395 - 1.001
  Salinity (PPS): 35.339 - 35.443
  Oxygen (ml/l): 4.619 - 4.793
  Phosphate (umol/l): 0.112 - 0.144
  Silicate (umol/l): 0.406 - 1.141

Graphical representation

Depth range (m): 0.5 - 68.6915

Temperature range (°C): 24.491 - 24.872

Nitrate (umol/L): 0.395 - 1.001

Salinity (PPS): 35.339 - 35.443

Oxygen (ml/l): 4.619 - 4.793

Phosphate (umol/l): 0.112 - 0.144

Silicate (umol/l): 0.406 - 1.141
 
Note: this information has not been validated. Check this *note*. Your feedback is most welcome.

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Trophic Strategy

Occurs in inshore waters (Ref. 75154).
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Batrachomoeus trispinosus

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There is 1 barcode sequence available from BOLD and GenBank.   Below is the sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen.  Other sequences that do not yet meet barcode criteria may also be available.

ACACGTTGACTATACTCAACAAACCACAAAGACATTGGAACCTTATACCTTGTATTCGGTACATGAGCCGCAATAGTTGGTGCCGCACTCAGCCTCTTACTACGCACAGAACTTTCACAACCTGGCCCCTTTCTTGGAAAT---GACCAAATCTATAACGTTATTGTTACAGCCCACGCCTTCGTAATAATCTTCTTCATGGTCATACCCATTATAATTGGTGGCTTCGGAAACTGACTCATTCCCCTAATAATTGGTGCTCCGGACATAGCATTCCCACGAATAAATAATATAAGCTTCTGACTTCTCCCACCATCATTCTTCCTTCTCCTAGCTTCATCAACAGTAGAAGCAGAAGCAGGAACTGGGTGAACTATTTATCCCCCACTAGCTAATAACATTGCACATGCAGGTGCCTCCGTAGACCTGACAATCTTTTCACTTCACCTAGCTGGTGTCTCATCAATCCTCGGCGCTATTAACTTCATCACAACAATTATTAACATAAAACCAAAAGCCTCCACACAATACCAAACCCCTCTTTTTATCTGAGCACTAATAATCACAGCAGTCCTTCTGCTTCTATCTTTACCAGTCCTTGCCGCTGGAATCACAATACTTCTAACAGACCGTAACCTAAATACAACATTCTTTGACCCTGGAGGAGGAGGAGACCCCATCCTATTTCAACACCTCTTTTGATTCTTTGGCCACCCTGAAGTTTATATTTTAATTCTCCCAGGATTCGGTATGATCTCACACATTGTCGCCTTTTATTCAGGAAAAAAAGAACCCTTTGGCTACATAGGCATGGTCTGAGCTATAATAACCATCGGTCTCCTAGGCTTCATTGTTTGAGCCCACCACATATTTACAGTCGGAATAGATGTTGATACTCGTG
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Statistics of barcoding coverage: Batrachomoeus trispinosus

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 1
Specimens with Barcodes: 8
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Conservation

Threats

Not Evaluated
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Relevance to Humans and Ecosystems

Benefits

Importance

fisheries: commercial
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!