Overview

Comprehensive Description

Biology

Inhabits reefs, mangrove estuaries, and offshore trawling grounds (Ref. 3132). Found over muddy bottoms in shallow estuaries and along coasts. Marketed fresh (Ref. 12693).
  • Allen, G.R. and R. Swainston 1988 The marine fishes of north-western Australia: a field guide for anglers and divers. Western Australian Museum, Perth. 201 p. (Ref. 3132)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Distribution

Indo-West Pacific.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Indo-West Pacific: northwestern Australia, the Arafura Sea (Ref. 9819), Thailand, Indonesia and Papua New Guinea. Known from the Mekong delta (Ref. 12693).
  • Allen, G.R. and R. Swainston 1988 The marine fishes of north-western Australia: a field guide for anglers and divers. Western Australian Museum, Perth. 201 p. (Ref. 3132)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Physical Description

Morphology

Dorsal spines (total): 3; Dorsal soft rays (total): 21 - 23; Analsoft rays: 17 - 20; Vertebrae: 28 - 29
  • Allen, G.R. and M.V. Erdmann 2012 Reef fishes of the East Indies. Perth, Australia: Universitiy of Hawai'i Press, Volumes I-III. Tropical Reef Research. (Ref. 90102)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Size

Max. size

31.0 cm TL (male/unsexed; (Ref. 90102))
  • Allen, G.R. and M.V. Erdmann 2012 Reef fishes of the East Indies. Perth, Australia: Universitiy of Hawai'i Press, Volumes I-III. Tropical Reef Research. (Ref. 90102)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Maximum size: 300 mm TL
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Diagnostic Description

Description: Characterized by an elongate laterally compressed body; brown and dark edged pale blotches irregularly alternating on side and adjacent dorsal and anal fins; well contrasted bars and blotches on dorsal surface of head; caudal and pectoral fins with distinct brown bands; head depth 3.9-5.4 in SL; upper part of pectoral fin axil with small pore; gill opening extending across entire pectoral fin base; operculum with three spines; gill opening extending over five-sixths of base of pectoral fin; strong conical teeth in jaws, mainly in single series; orbital tentacles not equal in size, middle one usually smaller (Ref 90102).
  • Allen, G.R. and M.V. Erdmann 2012 Reef fishes of the East Indies. Perth, Australia: Universitiy of Hawai'i Press, Volumes I-III. Tropical Reef Research. (Ref. 90102)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Ecology

Habitat

Environment

reef-associated; brackish; marine; depth range 0 - 36 m (Ref. 90102)
  • Allen, G.R. and M.V. Erdmann 2012 Reef fishes of the East Indies. Perth, Australia: Universitiy of Hawai'i Press, Volumes I-III. Tropical Reef Research. (Ref. 90102)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Depth range based on 11 specimens in 1 taxon.
Water temperature and chemistry ranges based on 4 samples.

Environmental ranges
  Depth range (m): 0.5 - 68.6915
  Temperature range (°C): 24.491 - 24.872
  Nitrate (umol/L): 0.395 - 1.001
  Salinity (PPS): 35.339 - 35.443
  Oxygen (ml/l): 4.619 - 4.793
  Phosphate (umol/l): 0.112 - 0.144
  Silicate (umol/l): 0.406 - 1.141

Graphical representation

Depth range (m): 0.5 - 68.6915

Temperature range (°C): 24.491 - 24.872

Nitrate (umol/L): 0.395 - 1.001

Salinity (PPS): 35.339 - 35.443

Oxygen (ml/l): 4.619 - 4.793

Phosphate (umol/l): 0.112 - 0.144

Silicate (umol/l): 0.406 - 1.141
 
Note: this information has not been validated. Check this *note*. Your feedback is most welcome.

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Trophic Strategy

Occurs in inshore waters (Ref. 75154).
  • Rainboth, W.J. 1996 Fishes of the Cambodian Mekong. FAO Species Identification Field Guide for Fishery Purposes. FAO, Rome, 265 p. (Ref. 12693)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Partner Web Site: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Batrachomoeus trispinosus

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There is 1 barcode sequence available from BOLD and GenBank.

Below is the sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.

See the BOLD taxonomy browser for more complete information about this specimen.

Other sequences that do not yet meet barcode criteria may also be available.

ACACGTTGACTATACTCAACAAACCACAAAGACATTGGAACCTTATACCTTGTATTCGGTACATGAGCCGCAATAGTTGGTGCCGCACTCAGCCTCTTACTACGCACAGAACTTTCACAACCTGGCCCCTTTCTTGGAAAT---GACCAAATCTATAACGTTATTGTTACAGCCCACGCCTTCGTAATAATCTTCTTCATGGTCATACCCATTATAATTGGTGGCTTCGGAAACTGACTCATTCCCCTAATAATTGGTGCTCCGGACATAGCATTCCCACGAATAAATAATATAAGCTTCTGACTTCTCCCACCATCATTCTTCCTTCTCCTAGCTTCATCAACAGTAGAAGCAGAAGCAGGAACTGGGTGAACTATTTATCCCCCACTAGCTAATAACATTGCACATGCAGGTGCCTCCGTAGACCTGACAATCTTTTCACTTCACCTAGCTGGTGTCTCATCAATCCTCGGCGCTATTAACTTCATCACAACAATTATTAACATAAAACCAAAAGCCTCCACACAATACCAAACCCCTCTTTTTATCTGAGCACTAATAATCACAGCAGTCCTTCTGCTTCTATCTTTACCAGTCCTTGCCGCTGGAATCACAATACTTCTAACAGACCGTAACCTAAATACAACATTCTTTGACCCTGGAGGAGGAGGAGACCCCATCCTATTTCAACACCTCTTTTGATTCTTTGGCCACCCTGAAGTTTATATTTTAATTCTCCCAGGATTCGGTATGATCTCACACATTGTCGCCTTTTATTCAGGAAAAAAAGAACCCTTTGGCTACATAGGCATGGTCTGAGCTATAATAACCATCGGTCTCCTAGGCTTCATTGTTTGAGCCCACCACATATTTACAGTCGGAATAGATGTTGATACTCGTG
-- end --

Download FASTA File

Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Batrachomoeus trispinosus

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 1
Specimens with Barcodes: 8
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Conservation

Threats

Not Evaluated
  • IUCN 2006 2006 IUCN red list of threatened species. www.iucnredlist.org. Downloaded July 2006.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Relevance to Humans and Ecosystems

Benefits

Importance

fisheries: commercial
  • Rainboth, W.J. 1996 Fishes of the Cambodian Mekong. FAO Species Identification Field Guide for Fishery Purposes. FAO, Rome, 265 p. (Ref. 12693)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!