Overview

Brief Summary

In the early 20th century, coelacanths were well known from the fossil record, the group having been common and diverse during the Permian and Triassic periods (290-208 million years ago), but they were thought to have gone extinct by 70 million years ago—until a live one was collected off South Africa in December of 1938, causing a splash among biologists around the world. Over the years, subsequent work in the Comoro Islands (located between the African continent and the northern end of Madagascar) turned up a couple of hundred additional L. chalumnae specimens caught with hook and line between 35 and 600 m (the species was known to local fishermen but had no value as a food fish and was not sold in local markets). In the decades since the remarkable discovery of living coelacanths, submersible-based field work has revealed a great deal about Latimeria. They are lethargic, nocturnal creatures that spend most of the day resting in caves in groups of 2 to 16. Typical habitat appears to be barren rocky slopes providing caves at depths of 100 to 300 m. On nightly forays for food (mainly other fishes), they may travel as much as 8 km before retreating to a cave at the end of the night. Coelacanths reproduce by internal fertilization and the young develop inside the mother. The huge eggs are 9 cm in diameter and over 325 g (the largest known eggs of any fish). Gestation period has been estimated to be around 13 months. The young are born at 35 to 38 cm. (Heemstra and Heemstra 2004)

In the 1990s, additional coelacanths were collected off the southwest coast of Madagascar and off the island of Sulawesi in Indonesia (DNA data have resulted in the recognition of Indonesian specimens as a distinct coelacanth species, L. menadoensis). Subsequently, a coelacanth was collected off the coast of Kenya and a population of coelacanths was discovered in Sodwana Bay off the coast of South Africa. Much remains to be learned about these mysterious fish. (Heemstra and Heemstra 2004)

Tetrapods, coelacanths, and lungfishes have long been recognized as closest relatives to each other, but the topology of the relationship among these three groups has been exceptionally difficult to resolve (Takezaki et al. 2004; Modisakeng et al. 2006 and references therein).

Latimeria chalumnae is listed as endangered with extinction (category Appendix I) under the international CITES treaty. IUCN lists Latimeria chalumnae as critically endangered.

The remarkable story of the discovery of these “living fossils” is recounted in the book A Fish Caught in Time: The Search for the Coelacanth (Weinberg 1999).
  • Heemstra, P.C. and E. Heemstra. 2004. Coastal Fishes of Southern Africa. South African Institute for Aquatic Biodiversity and National Inquiry Service Centre, Grahamstown, South Africa.
  • Modisakeng K.W., Amemiya C.T., Dorrington R.A.,and G.L. Blatch. 2006. Molecular biology studies on the coelacanth:a review . South African Journal of Science 102: 479-485.
  • Takezaki, N., Figueroa, F., Zaleska-Rutczynska, Z., Takahata, N., and J. Klein. 2004. The Phylogenetic Relationship of Tetrapod, Coelacanth, and Lungfish Revealed by the Sequences of Forty-Four Nuclear Genes. Molecular Biology and Evolution 21(8): 1512-1524.
  • Weinberg, S. 1999. A Fish Caught in Time: The Search for the Coelacanth. 1999. Fouth Estate, London.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

 

Supplier: Leo Shapiro

Trusted

Article rating from 1 person

Average rating: 5.0 of 5

Biology

Due to the depth of their oceanic habitat, little is known about the natural ecology of this species. The young develop inside their mother (ovovivipary) and are attached to the outside of a yolk-filled egg of about 100 millimetres in diameter. The developing fish have this sac connected to their fore-belly region and as the yolk volume decreases and the embryo develops, the sac diminishes in size until it disappears completely. Shortly before birth the scar where the yolk was attached closes and heals completely (9). The mother then gives birth to as many as 26 live pups (3). These fish are very long-lived and some scientists believe them to live as long as 80 years (3). They appear to be most active at night, spending the day hovering in submarine caves and foraging along the coast at night (3). Individuals observed in the wild appear to occasionally swim with their heads down in a 'headstand' posture, but this is possibly a result of the light or electromagnetic field produced by the submarine (9). They are opportunistic drift-feeders, preying mainly on fish, including lantern and cardinal fish, eels, skates and many more (2).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Comprehensive Description

Description

The coelacanth is a 'living fossil' previously believed to have gone extinct at the time of the dinosaurs until the first scientifically noted rediscovery in 1938 (3). This amazing specimen was dubbed the 'most important zoological find of the century', and the species is a member of an ancient lineage that has been around for over 360 million years (4). Unlike any other living animal, coelacanths have a hinged joint in the skull, which allows the front part of the head to be lifted whilst feeding (4). They also have limb-like, lobed pectoral and pelvic fins and a unique tail consisting of three distinct lobes (5). Adding to the excitement surrounding the species is the ongoing controversy as to whether coelacanths or lungfish represent the closest living relatives to the first creature to walk on land (3). The scaly body is dark blue or brown in colour with white speckles, the pattern of which is unique to each individual and provides good camouflage against cave walls (3). A further unique feature is a receptor in the rostral organ of the head which can detect electric fields and may be used to locate prey or monitor its surroundings (5).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 1 person

Average rating: 4.0 of 5

Biology

Known as the living fossil. Inhabits steep rocky shores, sheltering in caves during the day (Ref. 38425), with as much as 14 individuals in a single cave (Ref. 38426). Foraging singly over open substrate at night (Ref. 38426), it drifts passively with the current or swims slowly with its paired fins and its second dorsal and anal fins (Ref. 38427). May travel as much as 8 km at night searching for food and retreats to the nearest cave before dawn (Ref. 38426). Preys on fishes and squid (Ref. 26162). Beryx, Polymixia, Symphysanodon, apogonids, a skate, an eel and a swell shark have been known to be eaten (Ref. 11228). Its main enemies are likely to be large sharks (Ref. 26162). Ovoviviparous, with as much as 5-29 young (Ref. 11228, 37171). Gestation period estimated at 3 years, which would be the longest known in vertebrates (Ref. 30865). A small relative gill area (Ref. 38428) restricts coelacanths to a life 'in the slow lane', drift-feeding at night in cold waters and resting in slightly warmer caves for food consumption during day time (Ref. 38429). Recently, Prof Hans Fricke and associates have succeeded in observing and filming Latimeria in their natural habitat. Using a two-man submersible, Fricke found several coelacanths in depths of 120-400 m on the barren lava slopes off Grand Comoro. Coelacanths have distinctive white markings, and this allowed recognition of individuals and tracking of their movements. During the day, Latimeria retreat to caves, with as many as 13 fish crowded together in a single cave. Several individuals occupy overlapping home ranges, and Fricke never saw any aggressive encounters between coelacanths. By resting in caves (were there are no strong currents) the coelacanths save energy and avoid encounters with large predators (deep-water sharks). After sunset, the coelacanths leave their caves and drift slowly across the substrate, presumably looking for food, within 1-3 meters of the bottom. On these nightly hunting forays, the coelacanth may travel as much as 8 km; and before dawn they shelter in the nearest cave. While searching for prey, or moving from one cave to another, Latimeria appears to move in slow motion, either drifting passively with the current and using its flexible pectoral and pelvic fins to adjust its position, or slowly swimming by a synchronous sculling movement of the second dorsal and anal fins. In slow forward swimming, the left pectoral and right pelvic fins move forward, while the right pectoral and left pelvic fins are pulled backward. This tandem movement of alternate paired fins resembles the movement of the forelimbs and hindlimbs of a tetrapod walking on land. Latimeria does not use its lobed fins for walking on the bottom, and even when they are resting in caves they usually do not touch the substrate. Like most slow moving fishes, the coelacanth can make a sudden lunge or fast start by means of a quick flip of its massive caudal fin. During its nightly foraging swims, Latimeria was often seen to perform head-stands, in which it rotates its body into a vertical position, with its head near the bottom and its caudal fin curved perpendicular to its body. It then held this position for two or three minutes at a time. This curious behavior may be used when it is scanning the bottom with its putative electoreceptive rostral organ, or it may be a reaction to the bright lights of Prof. Fricke's submersible (Ref. 38228).
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© WorldFish Center - FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Distribution

Range Description

Known as the "living fossil", this species occurs in the Indo-West Pacific in the vicinity of the Grand Comoro and Anjouan islands, the coast of South Africa, Madagascar, and Mozambique.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Geographic Range

Off the coast of South Africa from Madagascar southward.

Biogeographic Regions: indian ocean (Native )

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Distribution

Comores, Madagascar, Mozambique, South Africa (country)
Creative Commons Attribution 3.0 (CC BY 3.0)

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Range

Fossil coelacanths have been found in all continents with the exception of Antarctica (6), but the distribution of this particular species is unclear. The first living specimen was discovered in 1938 off the coast of South Africa but until recently the only known population was located in the Comoro Islands, a small archipelago in the Mozambique Channel (3). Since then however, coelacanths have been observed off the northeast coast of South Africa in Sodwana Bay, as well as off Madagascar, Kenya and Tanzania (3). Individuals caught in Indonesian waters are currently considered a distinct species (Latimeria menadoensis) and are brown in colour.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Indian Ocean: well known population off the islands of Grand Comoro and Anjouan in the Comoros. Other populations in South Africa (Ref. 11228, 38218), Madagascar (Ref. 26162), and Mozambique (Ref. 27415). Likely to occur as strays at islands like Astove and Cosmoledo (Ref. 1623). International trade banned (CITES I, since 18.1.1990).
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© WorldFish Center - FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Physical Description

Morphology

Physical Description

Latimeria has a single, large, elongated, pseudo-lung filled with fat, a vertually linear heart, shark-like intestines with a spiral valve, and an axial skeleton composed only of a hollow tube of cartilage called a notocord. They possess hinges in their skulls that allow then to consume large prey. Latimeria also has a special electroreceptive device called a rosteral organ in the front of the skull . Their color ranges from brown to dark blue, but it is believed that no two fish have exactly the same pattern. They are particularly mucilaginous; not only do the scales exude mucus, but their bodies continually ooze a large quantity of oil.

Average mass: 80 kg.

Average mass: 52250 g.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Dorsal spines (total): 8; Dorsal soft rays (total): 30 - 31; Analspines: 0; Analsoft rays: 27 - 31
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© WorldFish Center - FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Size

Maximum size: 1600 mm TL
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Max. size

168 cm TL (male/unsexed; (Ref. 30865)); 200 cm TL (female); max. published weight: 95.0 kg (Ref. 26162); max. reported age: 48 years (Ref. 30865)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© WorldFish Center - FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Diagnostic Description

Description

Living fossil, see family description.
Creative Commons Attribution 3.0 (CC BY 3.0)

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

D VIII+30-31; A 27-31; P 29-32; V 29-33; C 20-25/35-38/21-22; LL 94-104; gills 4; gill rakers replaced by spiny tooth-plates. Head naked, the opercular bones exposed; gill cover expanded posteriorly and ventrally as a thick flap of skin; lower jaw with two large, overlapping gular plates; teeth conical, set on bony plates attached to palatines, ectopterygoids, and dentaries; maxilla absent (the structure at the side of the upper jaw that appears to be a maxillary bone is a thick fold of skin connecting the upper jaw to the rear of the lower jaw).Swim bladder elongate, filled with fat; intestine with spiral valve; osmoregulation involves retention of urea and trimethylamine oxide in the blood, but urea is not resorbed by the kidneys and excess salts are excreted by the rectal gland. In adults the brain is incredibly small, occupying only about 1% of the cranial cavity; but in the smallest juveniles, the brain completely fills the cranial cavity.Color in life: dark metallic blue, the head and body covered with irregular white or pale bluish spots. After death, the bluish color fades to dark brownish black.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© WorldFish Center - FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Type Information

Type for Latimeria chalumnae
Collection: Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Fishes
Collector(s): Native
Year Collected: 1952
Locality: Indian Ocean: Comoros Archipelago, Domoni, Anjouan Island, Anjouan Island, Comoros, Comoro Islands, Indian
  • Type: Smith, J. L. 1953. Nature. 171 (4342): 99.
Creative Commons Attribution 3.0 (CC BY 3.0)

© Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Fishes

Source: National Museum of Natural History Image Collection

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Type for Latimeria chalumnae
Collection: Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Fishes
Collector(s): C. Goosen
Year Collected: 1938
Locality: So. Africa: Near Mouth of Chalumna R., S.W. of East London, South Africa, Indian
  • Type:
Creative Commons Attribution 3.0 (CC BY 3.0)

© Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Fishes

Source: National Museum of Natural History Image Collection

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Ecology

Habitat

Habitat and Ecology

Habitat and Ecology
L. chalumnae is a nocturnal hunter, sheltering within caves throughout the day and foraging at night on squid and other fish species.

Systems
  • Marine
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Habitat

Latimeria live in deep (apprx. 400m), cool(15-17 degrees centigrade), marine water. They generally inhabit lava beds.

Aquatic Biomes: oceanic vent ; coastal

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Depth range based on 3 specimens in 1 taxon.
Water temperature and chemistry ranges based on 2 samples.

Environmental ranges
  Depth range (m): 42 - 390
  Temperature range (°C): 10.939 - 17.429
  Nitrate (umol/L): 13.495 - 18.260
  Salinity (PPS): 34.974 - 35.255
  Oxygen (ml/l): 3.370 - 4.113
  Phosphate (umol/l): 1.009 - 1.382
  Silicate (umol/l): 13.701 - 18.522

Graphical representation

Depth range (m): 42 - 390

Temperature range (°C): 10.939 - 17.429

Nitrate (umol/L): 13.495 - 18.260

Salinity (PPS): 34.974 - 35.255

Oxygen (ml/l): 3.370 - 4.113

Phosphate (umol/l): 1.009 - 1.382

Silicate (umol/l): 13.701 - 18.522
 
Note: this information has not been validated. Check this *note*. Your feedback is most welcome.
Public Domain

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Depth: 17 - 600m.
From 17 to 600 meters.

Habitat: demersal. Known as the living fossil. Found in caves during the day, with as much as 13 individuals in a single cave (Ref. 11228). A slow moving species, it drifts passively with the current or swims slowly with its second dorsal and anal fins (Ref. 11228). May travel as much as 8 km at night searching for food and retreats to the nearest cave before dawn (Ref. 11228). @Beryx@, @Polymixa@, @Symphysanodon@, apogonids, a skate, an eel and a swell shark have been known to be eaten (Ref. 11228). Ovoviviparous, with as much as 5 young (Ref. 11228).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Habitat

Inhabits ocean waters ranging from 150 to 700 metres deep, where there are submarine caverns (2), deep reefs and volcanic slopes (3), but the coelacanth has also been tracked at depths of just 17 metres (9).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Environment

demersal; non-migratory; marine; depth range 150 - 700 m (Ref. 38430), usually 180 - 250 m (Ref. 27564)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© WorldFish Center - FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Trophic Strategy

Food Habits

All that is known about the food habits of Latimeria is that they are carnivorous, feeding primarily on fish and squid. They have a rosteral organ in the front of their skulls that emits electromagnetic waves, used to detect prey.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Observations support the idea that this fish drifts and executes a sudden, deliberate bite within a short distance using its powerful jaws when prey moves within reach. Based on stomach contents, it is deduced that this fish feeds at least in part on the ocean floor. The headstanding, drift feeding orientation may offer supportive evidence for an electroreceptive function of the rostral organ (Ref. 28021).
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© WorldFish Center - FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Life History and Behavior

Life Cycle

Despite the lack of an obvious copulatory organ, the reproduction of Latimeria is of the type called "ovoviviparous", which means that it has internal fertilisation, and the fetuses are retained within the mother until they have grown large enough (36-38 cm) to fend for themselves. The eggs are enormous (9 cm in diameter and over 325 g in weight), and the huge yolk supplies all of the nutrients necessary for the growth of the embryo. In 1975, a large female coelacanth in the American Museum of Natural History was found to contain 5 young in individual compartments of the oviduct (uterus). They ranged in length from 301 to 327 mm and had well-developed teeth, fins and scales. Each fetus had a large, flaccid yolk sac attached to its chest. Dr Peter Forey of The Natural History Museum in London recently dissected one of these fetuses and found a 2 mm wide duct that leads directly from the yolk sac into the anterior part of the intestine. This yolk duct serves to move yolk from the yolk sac into the intestine where it is digested by the fetus. The same type of yolk transport into the gut via the yolk duct occurs in pups of ovoviviparous sharks. In some recent publications (Balon et al., 1988; Wourms et al., 1988; Bruton, 1989; Balon, 1991; Wourms et al., 1991) it was suggested (or even stated as a fact) that the reproduction of Latimeria involves "oophagy" or "embryonic cannibalism" (i.e., that the unborn pups feed on eggs or other siblings while in the uterus). According to Heemstra and Compagno (1989), there was no evidence to support this "oophagy" hypothesis, and Dr Forey's examination of a pup (from the original litter of 5 in the American Museum) found that its intestine was full of yolk (which is what one would expect with a direct connection between yolk sac and intestine) and contained "no trace of muscle fibres or anything else that might suggest that it had eaten a sib". Despite the misgivings of Heemstra and Compagno (1989), Wourms et al. (1991) again suggested that "Oophagy, the ingestion of supernumerary eggs by developing young, may well be the major source of supplemental nutrients for coelacanth pups." Speculating from a female that contained 19 ovulated eggs, they calculated that "19 embryos would occupy 7.0 meters of uterine space in a 2.0 meter fish" [the implication being that this is physically impossible]. They then concluded that "At the very most, such a fish could accommodate seven or eight developing embryos, and 11 or 12 eggs would then be superfluous-eggs ... [which] serve as nutrients for the embryos that survive to term". Then, in August 1991 a large pregnant female coelacanth, 179 cm long and weighing 98 kg, was caught by a trawler off Pebane on the northern coast of Mozambique (Bruton et al., 1992). This specimen was given to the natural history museum in Maputo, where it was dissected by the Director, Dr Augusto Cabral, who found that it contained 26 near-term pups, 31-36 cm in length. Thanks to the discovery and preservation of this Mozambique female, we now know that it is indeed possible for a coelacanth to have at least 26 pups in a litter, and the "superfluous-eggs" hypothesis of "oophagy" for the coelacanth is itself superfluous. Two pups from the Mozambique specimen were dissected by Heemstra and Greenwood (1992) and found to contain an internal yolk sac, which is the remnant of the large external yolk sac seen on the younger pups from the American Museum specimen. In the later stages of development, as the yolk supply dwindles, the external yolk sac apparently shrinks and is withdrawn into the body cavity. Some of the Mozambique pups had a small external yolk sac, and in others there was only a flat scar along the ventral midline to show where the yolk sac had been. In view of the large size (31-36 cm) and advanced development of the pups from the Mozambique female, the size at birth for Latimeria is probably about 35-38 cm (Ref. 38228). Juveniles are born after 13 months (Refs. 26162, 38222) or 3 years (Ref. 30865) of gestation period. Thus, females may give birth only every second or every third year.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© WorldFish Center - FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Life Expectancy

Lifespan/Longevity

Average lifespan

Status: captivity:
48 years.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Reproduction

Reproduction

Latimeria are ovoviparous; adults locate eachother for breeding with their electro-receptive rosteral organs.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Latimeria chalumnae

The following is a representative barcode sequence, the centroid of all available sequences for this species. 

 
There are 4 barcode sequences available from BOLD and GenBank.  Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen and other sequences.
 
GBGC1496-06|NC_001804|Latimeria chalumnae| ACTCGTTGACTATTCTCAACCAACCATAAAGACATTGGTACCCTATACATGATCTTCGGTGCCTGAGCTGGAATAGTTGGAACCGCCCTA---AGCCTGCTTATTCGAGCTGAACTCAGCCAACCTGGGGCTCTCCTGGGCGAT---GACCAAATTTATAATGTAGTCGTTACAGCACATGCATTCGTGATAATCTTCTTTATAGTAATACCGATCATAATCGGCGGGTTTGGCAACTGATTAATTCCCCTGATG---ATTGGGGCACCCGACATAGCATTTCCACGTATAAACAACATAAGCTTCTGACTACTACCACCCTCACTCCTACTCCTACTAGCATCTTCTGGAGTAGAAGCAGGAGCAGGCACAGGATGGACAGTATACCCTCCACTAGCGGGCAACCTCGCCCATGCAGGAGCATCCGTAGATTTA---ACAATTTTCTCCTTACATCTAGCCGGTGTATCCTCAATCTTAGGGGCCATCAACTTCATCACAACAGTAATCAACATAAAACCCCCAACAATAACACAGTATCAGACACCACTATTTATCTGATCAGTCTTAGTGACCGCCGTACTACTCCTACTCTCGCTACCGGTGCTAGCTGCC---GGAATTACCATACTACTGACAGATCGAAATCTAAACACAACATTCTTTGACCCTGCTGGAGGAGGAGACCCTATTCTATACCAACACCTATTCTGATTCTTCGGCCATCCTGAAGTATACATCCTAATTTTACCAGGATTTGGTATAATCTCACACATTGTGGCCTACTACTCTGGAAAGAAA---GAACCATTCGGGTATATAGGTATAGTATGAGCTATAATGGCAATTGGACTTCTAGGCTTCATCGTATGAGCCCATCATATATTTACCGTAGGAATGG 
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Statistics of barcoding coverage: Latimeria chalumnae

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 4
Species: 4
Species With Barcodes: 1

Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Conservation

Conservation Status

IUCN Red List Assessment


Red List Category
CR
Critically Endangered

Red List Criteria
A2cd, C2b

Version
2.3

Year Assessed
2000

Assessor/s
Musick, J.A.

Reviewer/s

Contributor/s

History
  • 1996
    Endangered
  • 1994
    Vulnerable
    (Groombridge 1994)
  • 1990
    Vulnerable
    (IUCN 1990)
  • 1988
    Insufficiently Known
    (IUCN Conservation Monitoring Centre 1988)
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Conservation Status

We have no real estimate on the Latimeria population; enough of them have been caughtto suggest that there may be undiscovered populations in other locations in the Indian Ocean and perhaps elswhere.

IUCN Red List of Threatened Species: critically endangered

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Status

Classified as Critically Endangered (CR) on the IUCN Red List 2007 (1), and listed on Appendix I of CITES (7).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Population

Population Trend
Unknown
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Threats

Threats

Population numbers are particularly difficult to assess given the deep habitats of this species but the Comoros population was believed to show a dramatic decline in the 1990s (6). These fish are accidentally caught on lines whilst local fisherman search the deep waters for other species (6). Due to the likely slow reproduction rate and small number of offspring of coelacanths, the species is possibly particularly vulnerable to the removal of pregnant females from the population (6).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Critically Endangered (CR) (A2cd, C2b)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© WorldFish Center - FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Management

Conservation Actions

Conservation Actions
It is listed on CITES Appendix I
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Conservation

The coelacanth is protected from international trade by its listing on Appendix I of the Convention on International Trade in Endangered Species (CITES) (1). Fishermen of the Grand Comoro Island have also imposed a voluntary ban on fishing in areas where coelacanths (or 'gombessa' as they are known locally) exist (5), in a vital effort to save their country's most unique fauna. The Coelacanth Rescue Mission is also distributing Deep Release Kits to local fishermen, which provide an effective method of returning accidentally caught fish to their deep habitat (3). There have recently been encouraging signs that the Comoros population is now stable (5), although careful monitoring will be needed to ensure this living fossil survives into the next millennium.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Relevance to Humans and Ecosystems

Benefits

Importance

fisheries: of no interest
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© WorldFish Center - FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Wikipedia

Latimeria chalumnae

West Indian Ocean coelacanth (Latimeria chalumnae) is a species of coelacanth, known for its vivid blue pigment. It is the better known of the two extant species.

Contents

Biological characteristics

Latimeria chalumnae specimen, Zoologisk Museum, Copenhagen

The average weight of the living West Indian Ocean coelacanth, Latimeria chalumnae, is 80 kg (176 lb), and they can reach up to 2 m (6.5 ft) in length. Adult females are slightly larger than males. L. chalumnae is widely but very sparsely distributed around the rim of the western Indian Ocean, from South Africa northward along the east African coast to Kenya, the Comoros and Madagascar, seemingly occurring in small colonies.

Population and conservation

In accordance with the Convention on International Trade of Endangered Species treaty, the coelacanth was added to Appendix I (threatened with extinction) in 1989. The treaty forbids international trade for commercial purposes and regulates all trade, including sending specimens to museums, through a system of permits. In 1998, the total population of the West Indian Ocean coelacanth was estimated to have been 500 or fewer, a number that would threaten the survival of the species.[1] L. chalumniae is listed as critically endangered and L. menadoensis is listed as vulnerable by IUCN.[2][3]

First find in South Africa

Preserved specimen of Latimeria chalumnae in the Natural History Museum, Vienna, Austria (length: 170 cm - weight: 60 kg). This specimen was caught on 18 October 1974, next to Salimani/Selimani (Grand Comoro, Comoro Islands) 11°48′40.7″S 43°16′3.3″E / 11.811306°S 43.267583°E / -11.811306; 43.267583.

On December 23, 1938, Hendrik Goosen, the captain of the trawler Nerine, returned to the harbour at East London, South Africa, after a trawl between the Chalumna and Ncera Rivers. As he frequently did, he telephoned his friend, Marjorie Courtenay-Latimer, curator at East London's small museum, to see if she wanted to look over the contents of the catch for anything interesting, and told her of the strange fish he had set aside for her. Correspondence in the archives of the South African Institute for Aquatic Biodiversity (SAIAB, formerly the JLB Smith Institute of Ichthyology) show that Goosen went to great lengths to avoid any damage to this fish and ordered his crew to set it aside for the East London Museum. Goosen later told how the fish was steely blue when first seen but by the time the Nerine entered East London harbour many hours later the fish had become dark grey.

Failing to find a description of the creature in any of her books, she attempted to contact her friend, Professor James Leonard Brierley Smith, but he was away for Christmas. Unable to preserve the fish, she reluctantly sent it to a taxidermist. When Smith returned, he immediately recognized it as a coelacanth, known only from fossils. Smith named the fish Latimeria chalumnae in honor of Marjorie Courtenay-Latimer and the waters in which it was found. The two discoverers received immediate recognition, and the fish became known as a "living fossil". The 1938 coelacanth is still on display in the East London, South Africa, museum.

However, as the specimen had been stuffed, the gills and skeleton were not available for examination, and some doubt therefore remained as to whether it was truly the same species. Smith began a hunt for a second specimen that would take more than a decade.

The second specimen, Malania anjouanae

A second specimen with a missing dorsal fin and deformed tail fin was captured in 1952 off the coast of Anjouan. At the time it was believed to be a new species and placed in a new genus as well, Malania, named in honour of the Prime Minister of South Africa at the time, Daniel François Malan, without whose help the specimen would not have been preserved with its muscles and internal organs more or less intact.[4]

References

  1. ^ Jewett, Susan L., "On the Trail of the Coelacanth, a Living Fossil", The Washington Post, 1998-11-11, Retrieved on 2007-06-19.
  2. ^ "IUCN Redlist--L. chalumnae". http://www.iucnredlist.org/apps/redlist/details/11375/0/full. Retrieved 2009-02-28. 
  3. ^ "IUCN Redlist--L. menadoensis". http://www.iucnredlist.org/apps/redlist/details/135484/0/full. Retrieved 2009-02-28. 
  4. ^ pages 63-82, Weinberg, Samantha. 2006. A Fish Caught in Time: the Search for the Coelacanth. HarperCollins Publishers, New York, NY.
Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

 

Source: Wikipedia

Unreviewed

Article rating from 0 people

Average rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!