Overview

Comprehensive Description

Description

  Common names: flounder (English), sandab (English), lenguado (Espanol)
 
Citharichthys sordidus (Girard, 1856)


Pacific sandab,     Mottled flounder


Body elongate; head < 30% of SL; eyes large, lower eye slightly before upper eye, its diameter greater than snout length; sharp bony ridge over lower eye; mouth medium length, ends under center of lower eye; blind side jaws not arched; teeth ~ equally developed on both sides of jaws, in 1 series of immovable teeth on each jaw, no canines but front teeth a little enlarged; gill rakers slender, short, 12-16 lower rakers; 86-102 dorsal rays; 67-81 anal rays; eye side pectoral shorter than head, reaches about middle of eye when folded forward; base of eye side pelvic on midline of body; urinary papilla on blind side, immediately behind anus; eye-side lateral line ~ straight, from edge of opercle to tail base; scales rough,  61-70 lateral line scales.

Eye-side dull brown, mottled with brown and black, sometimes with yellow and orange spots; blind-side dull white to tan.

Size: 41 cm.

Habitat: sandy and mud bottoms.

Depth: 9-549 m.

The Bering Sea to southern Baja.


   
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© Shorefishes of the tropical eastern Pacific online information system. www.stri.org/sftep

Source: Shorefishes of the Tropical Eastern Pacific Online Information System

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Biology

Found on sand bottoms (Ref. 2850). Young may occur at depth less than 9 m (Ref. 2850).
  • Eschmeyer, W.N., E.S. Herald and H. Hammann 1983 A field guide to Pacific coast fishes of North America. Houghton Mifflin Company, Boston, U.S.A. 336 p. (Ref. 2850)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Distribution

National Distribution

Canada

Origin: Native

Regularity: Regularly occurring

Currently: Present

Confidence: Confident

Type of Residency: Year-round

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Zoogeography

See Map (including site records) of Distribution in the Tropical Eastern Pacific 
 
Global Endemism: All species, East Pacific endemic, TEP non-endemic

Regional Endemism: All species, Tropical Eastern Pacific (TEP) non-endemic, Temperate Eastern Pacific, primarily, California province, primarily, Continent, Continent only

Residency: Vagrant

Climate Zone: North Temperate (Californian Province &/or Northern Gulf of California), Northern Subtropical (Cortez Province + Sinaloan Gap)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© Shorefishes of the tropical eastern Pacific online information system. www.stri.org/sftep

Source: Shorefishes of the Tropical Eastern Pacific Online Information System

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Eastern Pacific: Bering Sea coast of Alaska to Cabo San Lucas, southern Baja California, Mexico. Occurrence in Nicaragua (Ref. 13613) needs validation.
  • Lamb, A. and P. Edgell 1986 Coastal fishes of the Pacific northwest. Harbour Publishing Co. Ltd., B.C., Canada. 224 p. (Ref. 27436)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

North Pacific: Bering Sea to Mexico.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Depth

Depth Range (m): 9 (S) - 549 (S)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© Shorefishes of the tropical eastern Pacific online information system. www.stri.org/sftep

Source: Shorefishes of the Tropical Eastern Pacific Online Information System

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Physical Description

Morphology

Dorsal spines (total): 0; Dorsal soft rays (total): 86 - 102; Analspines: 0; Analsoft rays: 67 - 81; Vertebrae: 38 - 40
  • Hart, J.L. 1973 Pacific fishes of Canada. Bull. Fish. Res. Board Can. 180:740 p. (Ref. 6885)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Size

Length max (cm): 41.0 (S)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© Shorefishes of the tropical eastern Pacific online information system. www.stri.org/sftep

Source: Shorefishes of the Tropical Eastern Pacific Online Information System

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Size

Maximum size: 410 mm TL
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Max. size

41.0 cm TL (male/unsexed; (Ref. 2850)); max. reported age: 9 years (Ref. 72462)
  • Altman, P.L. and D.S. Dittmer 1962 Growth, including reproduction and morphological development. Federation of American Societies for Experimental Biology. (Ref. 72462)
  • Eschmeyer, W.N., E.S. Herald and H. Hammann 1983 A field guide to Pacific coast fishes of North America. Houghton Mifflin Company, Boston, U.S.A. 336 p. (Ref. 2850)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Diagnostic Description

Caudal rounded; pectorals rather large and pointed (Ref. 6885). Eyed side dull brown or tan irregularly mottled with dark; Dorsal, anal, caudal and anal fins black; blind side white to pale brown (Ref. 6885). Freshly caught males with dull orange spots and blotches (Ref. 6885). Young light olive green on eyed side, finely and sparsely speckled with brown, black, and orange, especially on fins (Ref. 6885).
  • Hart, J.L. 1973 Pacific fishes of Canada. Bull. Fish. Res. Board Can. 180:740 p. (Ref. 6885)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Ecology

Habitat

Habitat Type: Marine

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Environment

demersal; marine; depth range 0 - 549 m (Ref. 6793), usually 15 - ? m (Ref. 27436)
  • Allen, M.J. and G.B. Smith 1988 Atlas and zoogeography of common fishes in the Bering Sea and northeastern Pacific. NOAA Tech. Rep. NMFS 66, 151 p. (Ref. 6793)
  • Lamb, A. and P. Edgell 1986 Coastal fishes of the Pacific northwest. Harbour Publishing Co. Ltd., B.C., Canada. 224 p. (Ref. 27436)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Depth range based on 1303 specimens in 1 taxon.
Water temperature and chemistry ranges based on 774 samples.

Environmental ranges
  Depth range (m): 4 - 216.5
  Temperature range (°C): 6.630 - 8.705
  Nitrate (umol/L): 13.007 - 30.351
  Salinity (PPS): 32.340 - 33.906
  Oxygen (ml/l): 2.565 - 5.506
  Phosphate (umol/l): 1.398 - 2.545
  Silicate (umol/l): 21.984 - 46.900

Graphical representation

Depth range (m): 4 - 216.5

Temperature range (°C): 6.630 - 8.705

Nitrate (umol/L): 13.007 - 30.351

Salinity (PPS): 32.340 - 33.906

Oxygen (ml/l): 2.565 - 5.506

Phosphate (umol/l): 1.398 - 2.545

Silicate (umol/l): 21.984 - 46.900
 
Note: this information has not been validated. Check this *note*. Your feedback is most welcome.

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Depth: 0 - 549m.
Recorded at 549 meters.

Habitat: demersal.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Salinity: Marine, Marine Only

Inshore/Offshore: Inshore, Inshore Only

Water Column Position: Bottom, Bottom only

Habitat: Soft bottom (mud, sand,gravel, beach, estuary & mangrove), Soft bottom only, Sand & gravel

FishBase Habitat: Demersal
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© Shorefishes of the tropical eastern Pacific online information system. www.stri.org/sftep

Source: Shorefishes of the Tropical Eastern Pacific Online Information System

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Migration

Non-Migrant: No. All populations of this species make significant seasonal migrations.

Locally Migrant: No. No populations of this species make local extended movements (generally less than 200 km) at particular times of the year (e.g., to breeding or wintering grounds, to hibernation sites).

Locally Migrant: No. No populations of this species make annual migrations of over 200 km.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Trophic Strategy

Feeding

Feeding Group: Carnivore

Diet: mobile benthic crustacea (shrimps/crabs), bony fishes
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© Shorefishes of the tropical eastern Pacific online information system. www.stri.org/sftep

Source: Shorefishes of the Tropical Eastern Pacific Online Information System

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Associations

Known prey organisms

Citharichthys sordidus (Pacific sand dab) preys on:
Crustacea

Based on studies in:
USA: California, Southern California (Marine, Sublittoral)

This list may not be complete but is based on published studies.
  • T. A. Clark, A. O. Flechsig, R. W. Grigg, Ecological studies during Project Sealab II, Science 157(3795):1381-1389, from p. 1384 (1967).
Creative Commons Attribution 3.0 (CC BY 3.0)

© SPIRE project

Source: SPIRE

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Life History and Behavior

Reproduction

Egg Type: Pelagic, Pelagic larva
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© Shorefishes of the tropical eastern Pacific online information system. www.stri.org/sftep

Source: Shorefishes of the Tropical Eastern Pacific Online Information System

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Citharichthys sordidus

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 33 barcode sequences available from BOLD and GenBank.

Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.

See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

TTGGCACCCTATATCTTGTATTTGGTGCCTGAGCCGGCATGGTCGGAACGGCCTTGAGTTTACTCATCCGAGCCGAACTAAGCCAACCAGGAGCCCTCCTGGGAGACGACCAAATTTACAACGTCATTGTTACGGCACACGCCTTCGTAATAATTTTCTTTATAGTAATGCCCATCATGATTGGAGGCTTTGGAAACTGATTAATCCCCCTAATGATTGGGGCCCCCGATATGGCATTCCCACGAATAAACAACATGAGCTTTTGACTCCTTCCCCCATCTTTCCTTCTCTTGTTAGCCTCTTCAGGTGTAGAAGCTGGGGCAGGTACAGGATGAACAGTCTACCCACCACTAGCAGGTAATTTAGCCCACGCTGGAGCATCTGTAGACCTTACTATTTTCTCCCTTCATCTTGCAGGTATTTCTTCTATTCTAGGGGCCATTAACTTTATTACAACTATTATTAATATGAAACCTAACTCTGTGACAATGTACCAAATCCCACTATTTGTATGAGCAGTACTAATTACTGCCGTACTTCTATTACTCTCACTACCCGTTCTCGCTGCCGGTATTACAATGCTGCTAACCGACCGAAATTTAAACACAACCTTCTTTGACCCCACAGGAGGTGGAGACCCCATCTTATACCAACACCTATTCTGATTCTTCGG
-- end --

Download FASTA File

Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Citharichthys sordidus

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 52
Specimens with Barcodes: 57
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Conservation

Conservation Status

National NatureServe Conservation Status

Canada

Rounded National Status Rank: NNR - Unranked

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

NatureServe Conservation Status

Rounded Global Status Rank: GNR - Not Yet Ranked

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

IUCN Red List: Not evaluated / Listed

CITES: Not listed
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© Shorefishes of the tropical eastern Pacific online information system. www.stri.org/sftep

Source: Shorefishes of the Tropical Eastern Pacific Online Information System

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Threats

Not Evaluated
  • IUCN 2006 2006 IUCN red list of threatened species. www.iucnredlist.org. Downloaded July 2006.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Relevance to Humans and Ecosystems

Benefits

Importance

fisheries: commercial; gamefish: yes
  • Lamb, A. and P. Edgell 1986 Coastal fishes of the Pacific northwest. Harbour Publishing Co. Ltd., B.C., Canada. 224 p. (Ref. 27436)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Wikipedia

Pacific sanddab

The Pacific sanddab (Citharichthys sordidus) is a species of flatfish. It is by far the most common sanddab, and it shares its habitat with the longfin sanddab (C. xanthostigma) and the speckled sanddab (C. stigmaeus). It is a medium-sized flatfish, with a light brown color mottled brown or black, occasionally with white or orange spots.

The Pacific sanddab is endemic to the northern Pacific Ocean, from the Sea of Japan to the coast of California. They are most commonly found at depths of 50 to 150 m (160 to 490 ft), though the young inhabit shallower waters, occasionally moving into tide pools.

It is an opportunistic predator, feeding on a variety of crustaceans, as well as smaller fish, squid, and octopuses.

It is a popular game fish in northern California, found on menus in the Monterey Bay and San Francisco area, though more difficult to find in southern California restaurants and markets. Usually sold frozen, some regard it as a delicacy, but it is very affordable and quite delicious. It is also popular in Oregon and Washington, where it can be found more readily.

References[edit]

Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

Source: Wikipedia

Unreviewed

Article rating from 0 people

Default rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!