Articles on this page are available in 3 other languages: Spanish (1), Dutch (1), Chinese (Simplified) (4) (learn more)

Overview

Brief Summary

Basking sharks are the second largest living fish. Only whale sharks are larger. Despite their size, they are not dangerous for humans. Basking sharks don't have any teeth. They catch their food with the help of a filter in their mouth. With this filter, they can sieve the water and remove all kinds of small food particles. The filter is replaced every year.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© Copyright Ecomare

Source: Ecomare

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Biology

Very little information is known about the natural ecology and behaviour of the basking shark. It receives its common name from its feeding behaviour, when individuals appear to be 'basking' on the water's surface, swimming very slowly with their entire dorsal fin out of the water (2). These sharks feed passively (unlike the also plankton-feeding whale shark and megamouth shark (Megachasma pelagios) which can use its head muscles to suck water into the mouth), merely by swimming through the water with their mouths gaping (2). As water passes over the gills, plankton are retained; a fairly large shark can filter roughly 1,500 cubic metres of water an hour (6). These giant fish have occasionally been observed leaping out of the water (2), which is probably related to social behaviour (12). Basking sharks are usually solitary, although pairs and groups of up to 100 individuals have been seen (2). This species mysteriously disappears from coastal waters in the winter months and it was recently suggested that they 'hibernate' in the deep water. It is also thought that during this time of low food availability basking sharks shed and then replace the gill rakers (11). This suggestion has been refuted by scientific satellite tracking of sharks, revealing extensive migrations throughout all seasons (13). The only pregnant female ever caught gave birth to six live young; the prevailing view is that that these sharks are ovoviviparous (8), and it is likely that they only give birth every two to four years (9).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Description

The basking shark is the second largest fish in the seas, after the whale shark (Rhincodon typus); its maximum size is thought to be at least 10 metres long (6). This creature is a gentle giant however, filter-feeding on plankton through the five massive gill slits that almost encircle the head (2). Thousands of fine, bristle-like 'gill rakers' adorn each of the gill arches within the slits (7). The basking shark has an extremely distinctive body shape with its conical, almost pointed snout and large dorsal and pectoral fins that can reach as long as two metres each (8), and a crescent-moon shaped tail (2). The body is a greyish brown colour, either all over or with a paler shade underneath, and is covered with a layer of mucus (9). The large mouth, which may gape one metre across (8), contains many small hooked teeth (2); more than any other shark (9). This species has a particularly large liver that can weigh up to 25 percent of the body weight and provides buoyancy for its oceanic life (2). Juveniles have a distinctive hook-like snout, which changes shape during the first year of life (2).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Comprehensive Description

Description

  Common names: shark (English), tiburón (Espanol)
 
Cetorhinus maximus (Gunnerus, 1765)


Basking shark

Stout body; pointed snout; huge mouth; 5 very long gill slits that extend onto the top and bottom of the body, all before the pectoral; long, hair like gill rakers; teeth numerous, minute, hooked; 2 dorsal fins, the first midway between the pectorals and pelvics;  tail nearly symmetrical and half-moon shaped; tail base depressed, with long, strong keel.

Back blackish to grey-brown or blue-grey; belly a little paler.

Size: > 1000 cm.

Habitat: near shore pelagic.

Depth: 0-570 m.

Circumglobal in temperate waters; enters the fringes of our region - to central and possibly southern Baja, possibly the northern Gulf of California; the Galapagos, Ecuador and Peru.
   
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© Shorefishes of the tropical eastern Pacific online information system. www.stri.org/sftep

Source: Shorefishes of the Tropical Eastern Pacific Online Information System

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Biology

The second largest shark, reportedly reaching 1,220-1,520 cm TL (Ref. 247). Thought to live up to 50 years (Ref. 9030, 89083). Semi-oceanic or oceanic species, highly migratory (Ref. 43278). Found on continental and insular shelves, offshore and often close to land, just off the surf zone; enters enclosed bays (Ref. 247). Coastal-pelagic at 1 meter to unknown depths, probably epipelagic (Ref. 58302). Occurs singly, in pairs or groups of 3 or more, or in huge schools (group of up to 100 individuals has been reported) (Ref. 6871, 43278). Prefers water temperature between 8-16 °C (Ref. 88171). Makes extensive horizontal and vertical movements along the continental shelf and shelf edge to utilize productive feeding areas (Ref. 50200). During the summer months, it is found near the surface of boreal to warm-temperate areas (Ref. 43278) feeding on zooplankton by filtering (Ref. 88781). Found in deeper waters during winter (Ref. 6871, 50200, 58302). Undertakes long transoceanic migrations (e.g. from the British Isles to Newfoundland, Canada (Ref. 88824)) and moves between the northern and southern hemisphere in tropical mesopelagic water (Ref. 88825). These migrations have been found to cover distances of over 9,000 km. May form segregations by size or sex (Ref. 88171). Ovoviviparous (Ref. 50449). Regarded as ordinarily harmless and inoffensive but potentially dangerous if attacked (particularly when harpooned) (Ref. 247). In Bay of Fundy, Canada parasitic lampreys have been found attached to the back of basking sharks and sucking their blood (Ref. 83375). Utilized fresh, frozen and dried, or salted (Ref. 9987). Also valued for its liver for oil, fins for soup, hide for leather and carcass for fishmeal (Ref. 247). May be a potential source of anti-carcinoma drugs (Ref. 6034, 6035). Used in Chinese medicine (Ref. 12166). Threatened due to bycatch fisheries (Ref. 83294).
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Description

 The basking shark is the largest fish in British waters growing up to 9.8m long, its size being the most obvious distinguishing feature. Smaller specimens can be identified by the stout body, moon-shaped tail and the 5 long gill slits that run from the back behind the head to round under the throat. The gill arches carry a large number of gill rakers that act as a filter to catch the plankton upon which the shark feeds. The basking shark is slate grey to black dorsally, lighter ventrally, with pale patches under the snout and on the belly.  Filtered water is expelled through the greatly enlarged gill slits. Basking sharks generally live in open waters but migrate towards the shore in summer, when they can be seen 'basking' , i.e., swimming slowly at the surface with the mouth wide open with the snout and dorsal fin visible above water.Cetorhinus maximus are solitarily but can gather in aggregations of sometimes hundreds of individuals, to feed or mate.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

©  The Marine Biological Association of the United Kingdom

Source: Marine Life Information Network

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Description

The basking shark is the largest fish that occurs in the waters around Britain and Ireland and the second largest fish in the world (the largest being the whale shark). It is easily recognised by its great size (usually around 7.5m but may be up to 11m), and five very large gill slits. It normally swims along close to the surface with its first dorsal fin, snout and tail fin breaking the surface. It feeds by filtering huge quantities of seawater through its gills and trapping planktonic organisms on its gill rakers. The coloration is greyish-brown to black with lighter mottling, the gills are bright red. None.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© National Museums Northern Ireland and its licensors

Source: Encyclopedia of Marine Life of Britain and Ireland

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Distribution

National Distribution

Canada

Origin: Native

Regularity: Regularly occurring

Currently: Present

Confidence: Confident

Type of Residency: Year-round

United States

Origin: Native

Regularity: Regularly occurring

Currently: Present

Confidence: Confident

Type of Residency: Year-round

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

White Bay and Notre Dame Bay Newfoundland, to the Gulf of St. Lawrence, on the Scotian Shelf, along the Nova Scotia coastline, in the Bay of Fundy and south to North Carolina, straying to Florida
  • North-West Atlantic Ocean species (NWARMS)
Creative Commons Attribution 3.0 (CC BY 3.0)

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Range Description

Basking Sharks occur in temperate and boreal oceans. In the North Atlantic, the species occurs from the transition between Atlantic and Arctic waters (including the Gulf of Maine, south and west of Iceland and off the North Cape of Norway and Russia) to the Mediterranean, and occasionally as far south as Senegal and Florida. In the North Pacific, around Japan and off the Chinese coast, and from California north to British Columbia. In the southern hemisphere, recorded from South Africa, Brazil to Ecuador in South America, southern Australia and New Zealand (Compagno 1984a). Most records are from surface waters during spring and summer, with some reports from deep water in winter (Francis and Duffy 2002, Sims et al. 2003). A seasonal migration may occur, either from deep to shallow water or from lower to higher latitudes in warmer weather (the latter is not supported by recent UK observations (Sims et al. 2003)). Most records occur within a narrow range of water temperatures: 8°?14°C in the UK, Japan and Newfoundland, but up to 24°C in New England, USA. Records in warmer waters are generally of moribund or stranded specimens. At least some populations are migratory (Sims et al. 2003) and possibly seasonally segregated by sex; the winter distribution of most populations and locations used by pregnant females are unknown, although it seems likely that wintering sharks occur mainly in deep shelf water (Francis and Duffy 2002, Sims et al. 2003). The different morphological characteristics of basking sharks in the Pacific and the North and South Atlantic oceans are not thought to indicate separate species (Compagno 1984a), but geographically isolated populations.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Zoogeography

See Map (including site records) of Distribution in the Tropical Eastern Pacific 
 
Global Endemism: All species, TEP non-endemic, Circumtropical ( Indian + Pacific + Atlantic Oceans), "Transpacific" (East + Central &/or West Pacific), West + East Pacific (but not Central), East Pacific + Atlantic (East +/or West), East Pacific + all Atlantic (East+West)

Regional Endemism: All species, Eastern Pacific non-endemic, Tropical Eastern Pacific (TEP) non-endemic, Temperate Eastern Pacific, primarily, California + Peruvian provinces, primarily, Continent, Continent only

Residency: Vagrant

Climate Zone: North Temperate (Californian Province &/or Northern Gulf of California), Northern Subtropical (Cortez Province + Sinaloan Gap), Equatorial (Costa Rica to Ecuador + Galapagos, Clipperton, Cocos, Malpelo), South Temperate (Peruvian Province ), Antitropical (North and South temperate)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© Shorefishes of the tropical eastern Pacific online information system. www.stri.org/sftep

Source: Shorefishes of the Tropical Eastern Pacific Online Information System

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Cosmopolitan. Western Atlantic: Newfoundland, Canada to Florida, USA; southern Brazil to Argentina. Eastern Atlantic: Iceland, Norway and western Barents Sea to the North Sea, Mediterranean and Senegal; also western Cape Province, South Africa. Western Pacific: Japan to New Zealand. Eastern Pacific: Gulf of Alaska to Chile; possibly the Galapagos Islands. Highly migratory species, Annex I of the 1982 Convention on the Law of the Sea (Ref. 26139). At risk of extinction by overfishing because of low to very low productivity (Ref. 36717). Appendix II (Mediterranean) of the Bern Convention (2002). Appendix I and II of the Bonn Convention (2009). International trade restricted (CITES Appendix II, since 28.5.2003).
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Geographic Range

North and South Atlantic and Pacific Oceans.

Biogeographic Regions: oceanic islands (Native ); atlantic ocean (Native ); pacific ocean (Native )

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Cosmopolitan but antitropical (including Mediterranean Sea, Baltic Sea, North Sea, Hawaiian Islands).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

The basking shark has been recorded from all around the coasts of Britain and Ireland.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© National Museums Northern Ireland and its licensors

Source: Encyclopedia of Marine Life of Britain and Ireland

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Depth

Depth Range (m): 0 (S) - 570 (S)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© Shorefishes of the tropical eastern Pacific online information system. www.stri.org/sftep

Source: Shorefishes of the Tropical Eastern Pacific Online Information System

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Range

The basking shark is found throughout the world mainly in cool and temperate waters (7), although some sharks have recently been tagged, and found in tropical waters (10), although it was probably never very abundant (1). There has been some suggestion that the geographically isolated northern and southern hemisphere populations represent distinct species but this remains unclear (6).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Physical Description

Morphology

Dorsal spines (total): 0; Dorsal soft rays (total): 0; Analspines: 0; Analsoft rays: 0
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Physical Description

The basking shark has a conical snout, enormous gills, dark bristle-like gill rakers, and a crescent-shaped tail. Teeth are small and numerous(about one hundred per row) with a single conical cusp usually curved backwards, and similar in both jaws. Color is grayish brown to black above, often with blotches of a lighter color, and pale with blotches on the belly. Average size of this shark ranges from 7-9 m.

Average mass: 3900 kg.

Average mass: 2.2e+06 g.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Size

Length max (cm): 1000.0 (S)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© Shorefishes of the tropical eastern Pacific online information system. www.stri.org/sftep

Source: Shorefishes of the Tropical Eastern Pacific Online Information System

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Size

Maximum size: 9000 mm TL
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Max. size

900 cm TL (male/unsexed; (Ref. 247)); 980 cm TL (female); max. published weight: 4,000.0 kg (Ref. 4645)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Diagnostic Description

Distinguished from all other sharks by the enormous gill slits practically encircling the head; dermal denticle gill rakers; pointed snout; huge, sub terminal mouth with minute hooked teeth; caudal peduncle with strong lateral keels, and lunate caudal fin. Body covered with placoid scales. Blackish to grey-brown, grey, or blue-grey, often with irregular white blotches under the head and abdomen (Ref. 43278). Also Ref. 309, 5983.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Ecology

Habitat

Habitat Type: Marine

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

nektonic
  • North-West Atlantic Ocean species (NWARMS)
Creative Commons Attribution 3.0 (CC BY 3.0)

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

coastal warm and cool temperature waters
  • North-West Atlantic Ocean species (NWARMS)
Creative Commons Attribution 3.0 (CC BY 3.0)

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Habitat and Ecology

Habitat and Ecology
This shark is named from its habit of ?basking? on the surface in good weather conditions, usually singly or in small groups, although it also carries out extensive vertical migrations between the surface and deep water on the continental shelf and shelf-edge (Sims et al. 2003). Basking sharks are often associated with surface aggregations of zooplankton (Kunzlik 1988, Earll and Turner 1993), particularly along tidal and shelf-break fronts (Sims et al. 1997, 2003, Sims and Quayle 1998, Speedie 1998), where they feed on small fish, fish eggs and zooplankton by swimming open-mouthed with gill rakers erect and extended across the gaps between the gill arches to form a sieve (Stendall 1933, Matthews and Parker 1950, Van Deinse and Adriani 1953).

The large liver and high squalene levels (Burandeen and Richards-Rajadurai 1986) are characteristic of deepwater sharks. Deepwater pelagic shrimps (from >100 m) found in the stomach of a basking shark in Japan first indicated mesopelagic food sources (Mutoh and Omori 1978). Few sharks are recorded from coastal and surface waters in winter, indicating a migration into warmer regions or deep water, although there are surface records from Monterey Bay in winter (Squire 1990, Baduini 1995). A few winter specimens from the northeast Atlantic had shed their gill rakers, indicating that they were not feeding during this period of low zooplankton abundance. It was suggested that Basking Sharks might rest in deep water in winter (Parker and Boeseman 1954), utilising food reserves in the large liver. Energetics and tagging studies, however, indicate that feeding still takes place at this time and that extensive horizontal and vertical migrations are undertaken throughout the winter, on and near the edge of the Northeast Atlantic continental shelf (Sims et al. 1998, 2003). A New Zealand winter hoki fishery, targeting fish aggregated in deep water for spawning, takes a bycatch of Basking Sharks that may be feeding on the energy-rich eggs (Francis and Duffy 2002), while Sims et al. (2003) suggest that deep-diving sharks may feed on over-wintering copepods.

The reproductive biology of Basking Sharks is considered to be similar to that of other lamnoid sharks (Kunzlik 1988). Pairing takes place in early summer, wounds caused by copulation having been recorded in British waters in May by Matthews (1950). A single functional ovary contains a very large number of small eggs. Ovoviviparity occurs: embryos hatch within the uterus. Other lamnoid sharks exhibit embryonic ovophagy, in which the mother continues to produce infertile eggs on which the embryos can feed; the Basking Shark probably has the same strategy. Estimates for gestation period range from 12?36 months (Parker and Stott 1965, Pauly 1978, 2002, Compagno 1984a). The only record of a pregnant female was made by a Norwegian fisherman, who caught a shark which gave birth to five live young and one still-born, estimated to be between 1.5 and 2 m in length (Sund 1943). This indicates birth at a larger size than any other known ovoviviparous or viviparous shark. The catch from commercial surface fisheries is almost entirely non-pregnant females (e.g. Watkins 1958). It is thought there is likely a resting period of at least a year between pregnancies, and therefore a 2?4 year interval between litters (Parker and Stott 1965, Pauly 1978, 2002, Compagno 1984a). Pregnant females must normally segregate to an area where no fishery takes place (probably in deep water). Lien and Fawcett (1986) recorded twice as many males as females in incidental catches in deeper water around Newfoundland, indicating segregation of the sexes.

The smallest free-swimming individuals recorded are about 1.7?1.8 m (Parker and Stott 1965). However, the young are very rarely encountered until they reach more than 3 m in length. Growth is about 40 cm annually (Pauly 1978, 2002, Watterson in litt.). Males become sexually mature at a length of 5?7 m, age unknown, but possibly 12?16 years. Females are mature at 8.1?9.8 m and perhaps 16?20 years (Compagno 1984a). Pauly (1978) suggested mean age at first maturity for females as 18 years and that a shark of 9.6 m was 31 years old. There are unconfirmed measurements of 12.76 m (a theoretical maximum from Parker and Stott 1965) and 13.72 m (Holden 1974). Theoretically, longevity is about 50 years, though much more work on the age, growth and demographics of this species is needed. It is estimated that the natural mortality is low (M~0.07 per year) (Pauly 2002).

Systems
  • Marine
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Environment

pelagic-oceanic; oceanodromous (Ref. 51243); marine; depth range 0 - 2000 m (Ref. 26346), usually 0 - ? m (Ref. 55197)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Basking sharks inhabit subpolar and temperate seas moving southward during the winter. They prefer surface waters of the open sea, straying inland only to breed in the summer.

Aquatic Biomes: coastal

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Depth range based on 720 specimens in 1 taxon.
Water temperature and chemistry ranges based on 498 samples.

Environmental ranges
  Depth range (m): 0 - 558
  Temperature range (°C): 1.185 - 25.997
  Nitrate (umol/L): 0.286 - 21.384
  Salinity (PPS): 31.601 - 36.148
  Oxygen (ml/l): 4.364 - 7.119
  Phosphate (umol/l): 0.088 - 1.326
  Silicate (umol/l): 0.868 - 12.246

Graphical representation

Depth range (m): 0 - 558

Temperature range (°C): 1.185 - 25.997

Nitrate (umol/L): 0.286 - 21.384

Salinity (PPS): 31.601 - 36.148

Oxygen (ml/l): 4.364 - 7.119

Phosphate (umol/l): 0.088 - 1.326

Silicate (umol/l): 0.868 - 12.246
 
Note: this information has not been validated. Check this *note*. Your feedback is most welcome.

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

 Pelagic and migratory. Often observed feeding along tidal fronts on the continental shelf and shelf edge.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

©  The Marine Biological Association of the United Kingdom

Source: Marine Life Information Network

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Depth: 0 - 570m.
Recorded at 570 meters.

Habitat: pelagic.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

The majority of sightings of basking sharks have been in the summer months and mainly on days when the sea is calm enough to distinguish the large fins and snout breaking the surface. Despite its enormous size it feeds on planktonic organisms such as tiny crustaceans, jelly-fish and comb-jellies.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© National Museums Northern Ireland and its licensors

Source: Encyclopedia of Marine Life of Britain and Ireland

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Salinity: Marine, Marine Only

Inshore/Offshore: Offshore Only, Offshore

Water Column Position: Surface, Near Surface, Mid Water, Water column only

Habitat: Water column

FishBase Habitat: Pelagic
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© Shorefishes of the tropical eastern Pacific online information system. www.stri.org/sftep

Source: Shorefishes of the Tropical Eastern Pacific Online Information System

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

These sharks are found at the surface of coastal waters during the summer to feed on seasonally abundant copepods which bloom in frontal areas during spring and summer, but it is thought they migrate further offshore or to deeper waters during winter (11).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Migration

Non-Migrant: No. All populations of this species make significant seasonal migrations.

Locally Migrant: No. No populations of this species make local extended movements (generally less than 200 km) at particular times of the year (e.g., to breeding or wintering grounds, to hibernation sites).

Locally Migrant: No. No populations of this species make annual migrations of over 200 km.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Oceanodromous. Migrating within oceans typically between spawning and different feeding areas, as tunas do. Migrations should be cyclical and predictable and cover more than 100 km.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Trophic Strategy

Selective filter feeder that orients itself towards the most productive zooplankton patches, preferring areas where zooplankton density is above 1 g/m3 (Ref. 88781). Occurrence and movements appear to be correlated to sea surface temperature, in particular to the thermal boundaries at tidal and shelf-break fronts (as these areas may have seasonally productive zooplankton patches which the shark locates and utilizes) (Ref. 50200, 88781, 88826). Often in close association with shoals of other fish such as Clupea harengus and Scomber scombrus in the Northern Atlantic (Ref. 310). During the summer months the basking shark is often seen swimming slowly near the surface with its large mouth held open for approximately 30 to 60 seconds. Water passively enters its mouth, possesses long bristly gill rakers on long gill arches to filter out the zooplankton. It periodically closes its mouth and forcefully constricts its gill arches, probably as a means to expel as much water from the buccal cavitiy (Ref. 33579). On average, about half a tonne of plankton may be found in an individual’s stomach (Ref. 43278). During the winter months found to inhabit the deeper waters of the shelf and shelf edges of the northeast Atlantic (Ref. 50200), the winter diving behaviour may be related to the search for discrete calanoid patches at deeper depths (Ref. 50200).
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Food Habits

To capture food, this shark swims with its mouth open widely, gillrakers straining plankton from the water. The absence of basking sharks in the winter has led to the belief that they hibernate in deep waters until the following summer and, since they lose their gill rakers in winter, possibly cease to feed during this time.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Feeding

Feeding Group: Planktivore

Diet: zooplankton, pelagic fish eggs, pelagic fish larvae
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© Shorefishes of the tropical eastern Pacific online information system. www.stri.org/sftep

Source: Shorefishes of the Tropical Eastern Pacific Online Information System

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Diseases and Parasites

Nemesis Infestation. Parasitic infestations (protozoa, worms, etc.)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Dinematura Infestation. Parasitic infestations (protozoa, worms, etc.)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Life History and Behavior

Behavior

Diet

Minute planktonic organisms; especially copepods, fish eggs and larvae
  • North-West Atlantic Ocean species (NWARMS)
Creative Commons Attribution 3.0 (CC BY 3.0)

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Life Cycle

Distinct pairing with embrace (Ref. 205). Exhibit ovoviparity (aplacental viviparity), with embryos feeding on other ova produced by the mother (oophagy) after the yolk sac is absorbed (Ref. 50449). Estimated gestation period 12-36 months (Ref. 247, 1765, 9030, 88829); TL at birth estimated between 150-200 cm; mating thought to take place during early summer; a female giving birth to young captured in August in Norwegian waters (Ref. 5983). Over a study period of 5 years, courtship-like behaviour was observed off southwest England between May and July, always in surface waters along thermal fronts; because actual mating was not observed, this may occur in deeper water (Ref. 88831). A one-year resting period between pregnancies is thought to occur, resulting in a 2-4 year interval between litters (Ref. 9030, 1765, 88829). Only one pregnant female has been observed giving birth to a litter of 6 pups (Ref. 88830).
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Life Expectancy

Lifespan/Longevity

Average lifespan

Status: captivity:
32 years.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Lifespan, longevity, and ageing

Maximum longevity: 32 years (wild)
Creative Commons Attribution 3.0 (CC BY 3.0)

© Joao Pedro de Magalhaes

Source: AnAge

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Reproduction

Basking sharks are believed to be ovoviviperous. Females mature at 4-5m. Embryos supposedly measure between 1.5-1.8m in length.

Average age at sexual or reproductive maturity (male)

Sex: male:
2920 days.

Average age at sexual or reproductive maturity (female)

Sex: female:
4197 days.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Egg Type: Live birth, No pelagic larva
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© Shorefishes of the tropical eastern Pacific online information system. www.stri.org/sftep

Source: Shorefishes of the Tropical Eastern Pacific Online Information System

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Evolution and Systematics

Functional Adaptations

Functional adaptation

Specialized gills filter plankton: basking shark
 

The gills of basking sharks filter plankton from seawater for nutrition via specialized filters called gill-rakers.

   
  "Torpor or hibernation in fish is rare, but the most remarkable case features the basking shark (Cetorhinus maximus). It swallows great quantities of plankton, straining it from the water via specialized filters called gill-rakers. A common sight drifting just beneath the sea surface during the plankton-rich summer months, these sharks are rarely seen during the winter, when plankton is scarce. This is because they descend to deeper waters where, scientists assumed, they spend the season in a torpid state. However, when scientists examined two basking sharks during winter they lacked gill-rakers and thus couldn't feed. This unexpected finding suggests that basking sharks hibernate, shedding their gill-rakers and regrowing them in spring." (Shuker 2001:108)
  Learn more about this functional adaptation.
  • Shuker, KPN. 2001. The Hidden Powers of Animals: Uncovering the Secrets of Nature. London: Marshall Editions Ltd. 240 p.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© The Biomimicry Institute

Source: AskNature

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Functional adaptation

Hibernator survives low food supply: basking shark
 

The metabolism of basking sharks allows survival of winter food limitations via torpor, a hibernation-like state.

   
  "Torpor or hibernation in fish is rare, but the most remarkable case features the basking shark (Cetorhinus maximus). It swallows great quantities of plankton, straining it from the water via specialized filters called gill-rakers. A common sight drifting just beneath the sea surface during the plankton-rich summer months, these sharks are rarely seen during the winter, when plankton is scarce. This is because they descend to deeper waters where, scientists assumed, they spend the season in a torpid state. However, when scientists examined two basking sharks during winter they lacked gill-rakers and thus couldn't feed. This unexpected finding suggests that basking sharks hibernate, shedding their gill-rakers and regrowing them in spring." (Shuker 2001:108)
  Learn more about this functional adaptation.
  • Shuker, KPN. 2001. The Hidden Powers of Animals: Uncovering the Secrets of Nature. London: Marshall Editions Ltd. 240 p.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© The Biomimicry Institute

Source: AskNature

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Cetorhinus maximus

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 48 barcode sequences available from BOLD and GenBank.  Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

CCTGTATTTAATCTTTGGTGCATGAGCAGGAATAGTAGGGACAGCCCTAAGCCTCCTAATTCGAGCCGAATTAGGCCAACCCGGATCACTTCTTGGTGATGATCAAATTTATAATGTTATTGTGACAGCTCATGCATTTGTAATAATCTTCTTCATGGTTATACCCGTAATAATTGGGGGTTTTGGGAACTGATTAGTACCATTAATAATTGGTGCGCCAGACATAGCCTTCCCACGAATAAATAATATAAGCTTTTGACTCCTCCCTCCTTCTTTTCTCTTACTCCTGGCCTCAGCCGGAGTTGAAGCTGGAGCCGGAACTGGCTGAACAGTATACCCTCCCCTAGCTGGCAATCTAGCACACGCTGGAGCATCCGTTGATTTAGCCATCTTTTCTCTCCATTTAGCAGGCATCTCATCAATTCTAGCTTCAATTAACTTTATTACAACCATTATTAATATGAAGCCACCAGCCATCTCCCAGTATCAAACACCATTATTCGTGTGATCAATTCTAGTCACAACCATCCTTCTTCTTTTAGCCCTCCCAGTACTTGCAGCCGGCATCACAATATTGCTTACCGATCGGAACCTAAACACAACATTCTTTGACCCAGCAGGGGGAGGGGACCCTATTCTCTACCAACACCTG
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Statistics of barcoding coverage: Cetorhinus maximus

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 49
Specimens with Barcodes: 58
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Conservation

Conservation Status

National NatureServe Conservation Status

Canada

Rounded National Status Rank: NNR - Unranked

United States

Rounded National Status Rank: NNR - Unranked

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

NatureServe Conservation Status

Rounded Global Status Rank: GNR - Not Yet Ranked

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

IUCN Red List Assessment


Red List Category
VU
Vulnerable

Red List Criteria
A2ad+3d

Version
3.1

Year Assessed
2005

Assessor/s
Fowler, S.L.

Reviewer/s
Musick, J.A. & Cavanagh, R.D. (Shark Red List Authority)

Contributor/s

Justification
This assessment is based on the information published in the 2005 shark status survey (Fowler et al. 2005).

The Basking Shark (Cetorhinus maximus) is a very large, filter-feeding cold-water pelagic species that is migratory and widely distributed, but only regularly seen in a few favoured coastal locations and probably never abundant. Most documented fisheries have been characterised by marked, long lasting declines in landings after the removal of hundreds to low thousands of individuals. Its fins are among the most valuable in international trade. Basking Sharks are legally protected in some territorial waters and listed in CITES Appendix II. Compagno (1984a) considers the species ?to be extremely vulnerable to overfishing, perhaps more so than most sharks, ? ascribed to its slow growth rate, lengthy maturation time, long gestation period, probably low fecundity and probable small size of existing populations (belied by the immense size of individuals in their small schools)?.

The global status of the Basking Shark is assessed as Vulnerable, with the North Pacific and Northeast Atlantic stocks, which have been subject to target fisheries, assessed as Endangered. These assessments are based primarily on past records of rapidly declining local populations of basking sharks as a result of short-term fisheries exploitation and very slow population recovery rates.

History
  • 2000
    Vulnerable
  • 1996
    Vulnerable
    (Baillie and Groombridge 1996)
  • 1996
    Vulnerable
  • 1994
    Insufficiently Known
    (Groombridge 1994)
  • 1990
    Insufficiently Known
    (IUCN 1990)
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

No special status.

IUCN Red List of Threatened Species: endangered

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

IUCN Red List: Listed, Vulnerable

CITES: Listed, Appendix II
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© Shorefishes of the tropical eastern Pacific online information system. www.stri.org/sftep

Source: Shorefishes of the Tropical Eastern Pacific Online Information System

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Status

Classified as Vulnerable (VU) on the IUCN Red List (1), and listed on Appendix II of CITES (4) and Appendices I and II of the Bonn Convention on Migratory Species (CMS) (5).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Population

Population Trend
Decreasing
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Threats

Major Threats
Anon. (2002c) describes historical and modern fisheries. The Basking Shark has been exploited for several centuries to supply liver oil for lighting and industrial use, skin for leather and flesh for food or fishmeal. Modern fisheries yield liver oil, fins, meat and cartilage (Rose 1996, Anon. 2002c). The large liver represents 17?25% of total weight and contains a high proportion of squalene oil (Buranudeen and Richards-Rajadurai 1986). The very large fins fetch extremely high prices in international trade to East Asia (Fleming and Papageorgiou 1996, Lum 1996, Fairfax 1998, Anon. 2002c). Targeted basking shark fisheries entangle them in nets or use non-explosive harpoon guns to take sharks on the surface. Incidental catches are utilised when there is a market for the products and there has been an unutilised ?eradication? fishery. Catches have been recorded from Norway, Ireland, Scotland, Spain, Iceland, Canada, California, Peru, Ecuador, China and Japan (Compagno 1984a, Anon. 1999). One fishery in the Northeast Atlantic continues to take small numbers (ICES data, see Anon. 2002c). Most Basking Shark fisheries appear to have collapsed after initial high yields, and this species is considered by Compagno (1984a) to be extremely vulnerable to overfishing ? perhaps more so than most other sharks. A small fishery off Monterey Bay, California (Northeast Pacific), produced fishmeal and shark liver oil between 1924?1937. It expanded from 1946 to early 1950s, taking about 200 sharks annually. A drop in market prices for shark liver reportedly made the operation uneconomic. R. Lea (pers. comm.) reports that basking shark sightingsoff central California over the past 20 years are less numerous than in the past. The population may not have recovered from a substantial depletion during the 1940s and 1950s fishery and could still be affected by bycatch. S. van Sommeran (pers. comm.) notes that finned carcasses are occasionally reported.

Basking Sharks are common in the traditional knowledge of indigenous peoples of Vancouver Island, Canadian Pacific. Salmon net fishermen in Barkley Sound, Vancouver Island, complained of damage through accidental basking shark catches in the 1940s. The Department of Fisheries and Oceans instigated a shark eradication programme in the 1950s. Clemens and Wilby (1961) state that Fisheries vessels killed ?several hundred? in Barkley Sound up to 1959, to reduce salmon net bycatch. Darling and Keogh (1994) state ?Basking sharks are rarely sighted in Barkley Sound today, suggesting that the majority of the population in that area were killed.? It seems that this stock of Basking Sharks was significantly depleted over a period of just a few years and has not yet recovered. A summer Basking Shark fishery started at Achill Island, western Ireland in 1947, using set nets to entangle sharks. It peaked in the early 1950s, when 1,000?1,808 sharks were taken each year. In the early 1970s only 29?85 sharks were taken annually, a decline of over 90% in 20? 25 years. Re-capitalisation of the fishery in 1973 failed to increase yields locally and it closed in 1975, despite high oil prices. Parker and Stott (1965) and Horsman (1987) attributed the decline and collapse of this fishery to the overfishing of a local stock. Berrow and Heardman (1994) noted that there were still very few observations of basking sharks along the whole west and north-west coast of Ireland in 1993, and Achill Island fishermen reported fewer than 10 sharks sighted annually (Earll pers. comm.). This fishery appears to have depleted the population to such an extent that it has still not recovered some 40 years later. A wide-ranging Norwegian fleet has undertaken the major basking shark fishery in the northeast Atlantic from April to September in most years. Catches were high (>1,000 and up to >4,000) from 1959?1980 (Kunzlik 1988, ICES data, in Anon. 2002c). The Norwegian quota in European Community waters was 800 t (liver weight) in 1982, 400 t (approximately 800?1,000 sharks) in 1985, subsequently reduced to 200 t, 100 t, and to zero in 2001. Because basking sharks are taken by fishing vessels targeting small whales, increased restrictions on whaling activities and ageing vessels have reduced fleet size. The decline in this fishery has also been attributed to the falling value of Basking Shark liver oil, as a result of the competition from deepwater shark fisheries. Landings rose slightly in the early 1990s, when the fishery was being sustained by high fin prices (ICES 1995), but have since declined to very low levels, despite steeply increasing fin values. The majority of fins landed by Norway have been exported to Japan (Anon. 2002c). Since the precise location from which the basking sharks were taken is only identified by ICES sea area, it is difficult to detect and evaluate trends in catches, effort, and hence population, but the declines appear to be related to population trends and driven by fisheries and trade demand (Anon. 2002c). An intensive targeted Japanese Basking Shark fishery, utilising liver oil, shark fin and meat, took place in spring off Nakiri, Shima Peninsula, in the 1960s and 1970s. An estimated 1,200 sharks were harpooned from 1967?1978, peaking in 1972 when more than 60 sharks were sold at market in one day. Catches declined from about 150 sharks in 1975, to 20 in 1976, nine in 1977 and six in 1978. The fishery closed a few years later. In the 1990s, only 0? 2 Basking Sharks were being sighted each year off Nakiri during migration (Yano 1976, 1979, Uchida 1995). Basking sharks are sometimes landed and sold after becoming entangled in set nets or pot lines, or caught in trawls, but bycatch (whether landed or discarded) is rarely reported. Exceptions are reports by Lien and Fawcett (1986) on an incidental fishery for basking sharks by salmon and cod set nets and deepwater trawls in Newfoundland, and Francis and Duffy (2002) on incidental capture in deepwater fisheries off New Zealand. Incidental shark catches in Newfoundland increased in 1981 when a market developed for the fins and liver. When there is no market for the sharks? fins and livers, salmon fishermen generally remove their gear from the water to prevent damage when basking sharks are known to be in the area. If there is a market, any sharks caught are killed and landed.

Berrow (1994) estimated that 77?120 sharks are taken annually in the bottom set gillnet fishery in the Celtic Sea. Fairfax (1998) reports that basking sharks are sometimes brought up from deepwater trawls near the Scottish west coast during winter. Bycatch in Isle of Man herring fishery is about 10?15 fish annually and a further 4?5 entangled in pot lines, (K. Watterson in litt.). Local fishermen estimate an unreported bycatch of up to 40 Basking Sharks per year in one large bay in south-west England (C. Speedie pers. comm.). In contrast to these relatively large coastal bycatches, observer data from oceanic gillnet fleets suggest that only about 50 Basking Sharks were among the several million sharks taken annually offshore in the Pacific Ocean (Bonfil 1994). Habitat loss or degradation is not considered to be a serious problem for this species.

Following notes added by Lucy Harrison (iucnshark@gmail.com) via Sarah Fowler May 17th 2010

Later in 2005, the species was listed in Appendix I and II of CMS. Appendix I means that Parties are required to provide strict protection.

In 2006 ICES issued this advice, which is still current:“No targeted fishing for basking shark should be permitted and additional measures should be taken to prevent bycatch of basking shark in fisheries targeting other species. A TAC should cover all areas where basking sharks are caught in the northeast Atlantic. This TAC should be set at zero.”
This advice was adopted in 2007 and the zero TAC covers all areas of the NE Atlantic where basking sharks may be caught.

Norway ALWAYS implements ICES advice (and indeed, unless they take out a reservation, also other MEA measures – unlike many other States). Their basking shark fishery was therefore closed in either 2006 or 2007, I forget which but probably the latter. They are presumably still landing bycatch, because Norway prohibits discards, but fishermen are not paid full market value for catches for which they do not have a license – only enough to cover the cost of bringing home the catch. This means that they will be avoiding basking sharks wherever possible.

Because of the CMS Appendix I listing, basking shark is also an EU prohibited species: “It shall be prohibited for Community vessels to fish for, to retain on board, to tranship and to land the following species in all Community and non-Community waters” Every year, however, we get reports of basking sharks being caught, landed and put on sale illegally in the EU. So, small scale bycatch and utilisation is definitely ongoing even in areas where the species is strictly protected.

Elsewhere: NZ is the only place where there is still a fairly large utilised basking shark bycatch (in trawls over hoki spawning grounds). The fins are exported under CITES license to East Asia. NZ allows finning.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Vulnerable (VU) (A2ad+3d)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

This species was traditionally hunted for its vast liver, which was sold as an aphrodisiac in Japan, and also used by fishermen for lighting in the UK, whilst the oil was used in the manufacture of cosmetics (2). Due to its long maturation time and slow reproductive rate this species is particularly vulnerable to over-fishing, and targeted populations are very slow to recover from targeted fisheries (1). Today the biggest threat comes from the demand for fins for shark fin soup in the Far East and from accidental by-catch in the fishing industry (14). Although exact population figures are difficult to assess, there has been a reported decline by as much as 80 percent since the 1950s (2).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Management

Conservation Actions

Conservation Actions
The Basking Shark is strictly protected under wildlife legislation within 12 nautical miles of the Isle of Man and Guernsey (United Kingdom dependent territories) and in British waters. It is protected in US Federal waters (including the Gulf of Mexico and Caribbean Sea) by a National Marine Fisheries Service rule for Atlantic shark fisheries, which prohibits directed commercial fishing, landing and sale of the species and in Florida State waters. The basking shark is one of several species partially protected through New Zealand?s Fisheries Act (1983). Commercial target fishing has been banned since 1991, but bycatch may be utilised. The liver and fins are landed and the fins almost certainly exported. The Basking Shark is listed on Annex II (Endangered or Threatened Species) of the Barcelona Convention for the Protection of the Mediterranean Sea (1976) Protocol Concerning Specially Protected Areas and Biological Diversity in the Mediterranean, but only Malta has legally protected the species. The Mediterranean population is also listed on Appendix I of the Bern Convention for the Conservation of European Wildlife and Habitats, subject to a European Commission reservation. A UK government proposal for an Appendix II listing on CITES was narrowly defeated in 2000, but was followed by an Appendix III listing in Europe later that year. Japan and Norway, the world's two main trading nations, took reservations on this listing. An Appendix II proposal, accepted by the 12th Conference of the Parties in 2002, came into effect at the end of February 2003 (www.cites.org). This requires international trade to be monitored and derived from sustainably managed fisheries.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Conservation

The basking shark is now protected in the territorial waters of some of the countries, including the UK, in which it occurs (2). In 2002, this species was accepted onto Appendix II of the Convention on International Trade in Endangered Species (CITES), thus reducing international trade in basking sharks (4). A three-year research programme in Britain is currently underway (9). The attraction of these large and appealing creatures for ecotourism may also benefit their conservation.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Relevance to Humans and Ecosystems

Benefits

Importance

fisheries: commercial
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Economic Importance for Humans: Negative

In some areas, this shark is considered to be a nuisance because it gets tangled in floating nets while basking on the surface. Occasionally, they have been known to ram small boats, presumably by accident.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Economic Importance for Humans: Positive

This fish was once used for its liver oil and was thus virtually endangered for some time. It is still used in lesser amounts for fish meal and animal feed.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Wikipedia

Basking shark

The basking shark (Cetorhinus maximus) is the second-largest living fish, after the whale shark, and one of three plankton-eating sharks besides the whale shark and megamouth shark. It is a cosmopolitan migratory species, found in all the world's temperate oceans. It is a slow-moving filter feeder and has anatomical adaptations to filter feeding, such as a greatly enlarged mouth and highly developed gill rakers. The shape of its snout is conical and the gill slits extend around the top and bottom of its head. The gill rakers, dark and bristle-like, are used to catch plankton as water filters through the mouth and over the gills. The basking shark is usually greyish-brown in color with mottled skin. The caudal (tail) fin has a strong lateral keel and a crescent shape. The teeth of the basking shark are very small and numerous, and often number one hundred per row. The teeth have a single conical cusp, are curved backwards, and are the same on both the upper and lower jaws. Adults typically reach 6-8 m in length.

Basking sharks are believed to overwinter in deep waters. They may be found in either small schools or alone. Small schools in the Bay of Fundy and the Hebrides have been seen swimming nose to tail in circles in what may be a form of mating behavior. Despite their large size and threatening appearance, basking sharks are not aggressive and are harmless to people.

It has long been a commercially important fish, as a source of food, shark fin, animal feed, and shark liver oil. Overexploitation has reduced its populations to the point where some have disappeared and others need protection.

Taxonomy[edit]

This shark is called the "basking" shark because it is most often observed when feeding at the surface and appears to be basking in the warmer water there. It is the only member of the family Cetorhinidae, part of the mackerel shark order Lamniformes. Gunnerus was the first to describe and name the species Cetorhinus maximus from a specimen found in Norway. The genus name Cetorhinus comes from the Greek, ketos which means marine monster or whale and rhinos meaning nose, the species name maximus is from Latin and means "greatest". The following centuries featured more attempts at naming: Squalus isodus, in 1819 by Macri; Squalus elephas, by Lesueur in 1822; Squalus rashleighanus, by Couch in 1838; Squalus cetaceus, by Gronow in 1854; Cetorhinus blainvillei by Capello in 1869; Selachus pennantii, by Cornish in 1885; Cetorhinus maximus infanuncula, by Deinse and Adriani in 1953; and finally Cetorhinus maximus normani, by Siccardi in 1961.[3] Other names include bone shark, elephant shark, hoe-mother (sometimes contracted to homer), sail-fish, and sun-fish.[4]

Range and habitat[edit]

The basking shark is a coastal-pelagic shark found worldwide in boreal to warm-temperate waters around the continental shelves. It prefers 8.0 to 14.5°C (46 to 58°F) temperatures, but recently has been confirmed to cross the much-warmer waters at the equator. [1] It is often seen close to land, including bays with narrow openings. The shark follows plankton concentrations in the water column, so is often visible at the surface. It characteristically migrates with the seasons.[5] The basking shark is found from the surface down to at least 910 m (2,990 ft).[6]

Anatomy and appearance[edit]

The largest accurately measured specimen was trapped in a herring net in the Bay of Fundy, Canada, in 1851.[7] Its total length was 12.27 m (40.3 ft), and it weighed an estimated 19 t (19 long tons; 21 short tons).[8] Dubious reports from Norway mention three basking sharks over 12 m (39 ft), the largest at 13.7 m (45 ft);[when?] these are dubious because few anywhere near that size have been caught in the area since. On average, the adult basking shark reaches a length of 6–8 m (20–26 ft) and weighs about 5.2 t (5.1 long tons; 5.7 short tons).[8] Some specimens still surpass 9–10 m (30–33 ft), but after years of large-scale fishing, specimens of this size have become rare.

Drawing of shark in profile, showing split tail, and five dark-colored bands that encircle the body between the head and pectoral bands
Male basking shark

They possess the typical shark lamniform body plan and have been mistaken for great white sharks.[9] The two species can be easily distinguished, however, by the basking shark's cavernous jaw, up to 1 m (3 ft 3 in) in width, longer and more obvious gill slits that nearly encircle the head and are accompanied by well-developed gill rakers, smaller eyes, and smaller average girth. Great whites possess large, dagger-like teeth; basking shark teeth are much smaller 5–6 mm (0.20–0.24 in) and hooked; only the first three or four rows of the upper jaw and six or seven rows of the lower jaw function. In behavior, they also differ; the great white is an active predator of large animals and not a filter feeder.

Other distinctive characteristics include a strongly keeled caudal peduncle, highly textured skin covered in placoid scales and a mucus layer, a pointed snout—distinctly hooked in younger specimens—and a lunate caudal fin.[10] In large individuals, the dorsal fin may flop to one side when above the surface. Coloration is highly variable (and likely dependent on observation conditions and the individual's condition): commonly, the coloring is dark brown to black or blue dorsally, fading to a dull white ventrally. The sharks are often noticeably scarred, possibly through encounters with lampreys or cookiecutter sharks. The basking shark's liver, which may account for 25% of its body weight, runs the entire length of the abdominal cavity and is thought to play a role in buoyancy regulation and long-term energy storage.

Life history[edit]

Shot of head in profile with partially opened mouth
Head of a basking shark

Basking sharks do not hibernate, instead are active year-round.[11] In winter, basking sharks move to depths of 900 m (3,000 ft) to feed on deep-water plankton.

Migration[edit]

Satellite tagging confirmed basking sharks move thousands of kilometres during the winter, seeking plankton blooms. They shed and renew their gill rakers in an ongoing process, rather than over one short period.[6]

A 2009 study tagged 25 sharks off the coast of Cape Cod, Massachusetts, and indicated at least some individuals migrate south in the winter. Remaining at depths between 200 and 1,000 metres (660 and 3,280 ft) for many weeks, the tagged sharks crossed the equator to reach Brazil. One individual spent a month near the mouth of the Amazon River. They may undertake this journey to aid reproduction.[6][12]

They are slow-moving sharks (feeding at about 2 kn (3.7 km/h; 2.3 mph)) and do not evade approaching boats (unlike great white sharks). They are not attracted to chum.

Though the basking shark is large and slow, it can breach, jumping entirely out of the water.[13] This behaviour could be an attempt to dislodge parasites or commensals.[5] Such interpretations are speculative, however, and difficult to verify; breaching in large marine animals such as whales and sharks might equally well be intraspecific threat displays of size and strength.

Interactions[edit]

A basking shark filter feeding

Basking sharks are social animals and form sex-segregated schools, usually in small numbers (three or four), but reportedly up to 100 individuals.[5] Their social behaviour is thought to follow visual cues. Although the basking shark's eyes are small, they are fully developed. They may visually inspect boats, possibly mistaking them for other basking sharks.[14] Females are thought to seek shallow water to give birth.

Predators[edit]

Basking sharks have few predators. White sharks have been reported to scavenge on the remains of these sharks. Killer whales have been observed feeding on basking sharks off California and New Zealand. Lampreys are often seen attached to them, although they are unlikely to be able to cut through the shark's thick skin.

Diet[edit]

Basking shark filter feeding
Basking shark filter feeding at Dursey Sound

The basking shark is a passive feeder, filtering zooplankton, small fish, and invertebrates from up to 2,000 short tons (1,800 t) of water per hour.[3] They feed at or close to the surface with their mouths wide open and gill rakers erect. Unlike the megamouth shark and whale shark, the basking shark does not appear to actively seek quarry, but it does possess large olfactory bulbs that may guide it. It relies only on the water it pushes through its gills by swimming; the megamouth shark and whale shark can suck or pump water through their gills.[3]

Reproduction[edit]

Basking sharks are ovoviviparous: the developing embryos first rely on a yolk sac, with no placental connection. Their seemingly useless teeth may play a role before birth in helping them feed on the mother's unfertilized ova (a behaviour known as oophagy).[15] In females, only the right ovary appears to function.

Gestation is thought to span over a year (perhaps two to three years), with a small, though unknown, number of young born fully developed at 1.5–2 m (4 ft 11 in–6 ft 7 in). Only one pregnant female is known to have been caught; she was carrying six unborn young.[16] Mating is thought to occur in early summer and birthing in late summer, following the female's movement into shallow waters.

The age of maturity is thought to be between the ages of six and 13 and at a length of 4.6–6 m (15–20 ft). Breeding frequency is thought to be two to four years.

The exact lifespan of the basking shark is unknown, but experts estimate to be about 50 years.[17] [18]

Importance to humans[edit]

Historically, the basking shark has been a staple of fisheries because of its slow swimming speed, unaggressive nature, and previously abundant numbers. Commercially, it was put to many uses: the flesh for food and fishmeal, the hide for leather, and its large liver (which has a high squalene content) for oil.[5] It is currently fished mainly for its fins (for shark fin soup). Parts (such as cartilage) are also used in traditional Chinese medicine and as an aphrodisiac in Japan, further adding to demand.

As a result of rapidly declining numbers, the basking shark has been protected in some territorial waters and trade in its products is restricted in many countries under CITES. It is fully protected in the UK, Malta, New Zealand,[19] Florida and USA Gulf, and since 2008, it is subject to a target fishing and landed bycatch ban within EU waters.[16] As of March 2010, it has also been listed under Annex I of the CMS Migratory Sharks Memorandum of Understanding.[20]

Once considered a nuisance along the Canadian Pacific coast, basking sharks were the target of a government eradication programme from 1945 to 1970. As of 2008, efforts are underway to determine whether any sharks still live in the area and monitor their potential recovery.[21]

It is tolerant of boats and divers approaching it, and may even circle divers, making it an important draw for dive tourism in areas where it is common.

Basking sharks and cryptozoology[edit]

The "wonderful fish" described in Harper's Weekly on October 24, 1868, was likely the remains of a basking shark.

On several occasions, "globster" corpses initially thought to be sea serpents or plesiosaurs have later been identified as likely to be the decomposing carcasses of basking sharks, as in the Stronsay beast and the Zuiyo-maru cases.[22]

See also[edit]

References[edit]

  1. ^ Sepkoski, Jack (2002). "A compendium of fossil marine animal genera (Chondrichthyes entry)". Bulletins of American Paleontology 364: 560. Retrieved 2008-01-09. 
  2. ^ Fowler (2005). "Cetorhinus maximus". IUCN Red List of Threatened Species. Version 2010.3. International Union for Conservation of Nature. Retrieved October 26, 2010. 
  3. ^ a b c C. Knickle, L. Billingsley & K. DiVittorio. "Biological Profiles basking shark". Florida Museum of Natural History. Archived from the original on 21 August 2006. Retrieved 2006-08-24. 
  4. ^ Yarrell, William. (1836). A History of British Fishes. Volume II. John Van Voorst, London. p. 397.
  5. ^ a b c d Leonard J. V. Compagno (1984). Sharks of the World: An annotated and illustrated catalogue of shark species known to date. Food and Agriculture Organization of the United Nations. 
  6. ^ a b c Skomal, Gregory B.; Zeeman, Stephen I.; Chisholm, John H.; Summers, Erin L.; Walsh, Harvey J.; McMahon, Kelton W.; Thorrold, Simon R. "Transequatorial Migrations by Basking Sharks in the Western Atlantic Ocean". Current Biology. 
  7. ^ http://new-brunswick.net/new-brunswick/sharks/baskingbeached.html
  8. ^ a b Wood, Gerald (1983). The Guinness Book of Animal Facts and Feats. p. 256. ISBN 978-0-85112-235-9. 
  9. ^ http://online.sfsu.edu/bholzman/courses/Fall%2003%20project/basking_shark.htm
  10. ^ http://www.redorbit.com/education/reference_library/animal_kingdom/fish/2578814/basking_shark/
  11. ^ Basking Shark
  12. ^ "Giant Shark Mystery Solved: Unexpected Hideout Found". News.nationalgeographic.com. 2010-10-28. Retrieved 2012-08-15. 
  13. ^ Pelagic Shark Research Foundation. "PSRF Shark Image Library". PSRF. Retrieved 2006-06-01. 
  14. ^ Martin, R. Aidan. "A Curious Basker". SHARK-L. Archived from the original on 2004-10-20. Retrieved 2006-08-03. 
  15. ^ "Martin, R. Aidan". "Biology of the Basking Shark(Cetorhinus maximus)". "ReefQuest Centre for Shark Research". Archived from the original on 28 May 2008. Retrieved 2008-06-08. 
  16. ^ a b The Shark Trust. "Basking Shark Factsheet". The Shark Trust. Retrieved 2006-07-07. 
  17. ^ Archipelagos Wildlife Library. "Basking Shark ( Cetorhinus maximus )". Archipelagos Wildlife Library. Retrieved 2013-04-30. 
  18. ^ Born Free Foundation. "Basking Shark Facts". Born Free Foundation. Retrieved 2013-04-30. 
  19. ^ "Fishing (Reporting) Regulations 2001, Schedule 3, Part 2C Protected Fish Species". NZ Government. 
  20. ^ "MEMORANDUM OF UNDERSTANDING ON THE CONSERVATION OF MIGRATORY SHARKS". 
  21. ^ Colonist, Times (2008-08-21). "B.C. scientists hunt for elusive shark". Canada.com. Retrieved 2012-08-15. 
  22. ^ Kuban, Glen. "Sea-monster or Shark?: An Analysis of a Supposed Plesiosaur Carcass Netted in 1977". 
General references
Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

Source: Wikipedia

Unreviewed

Article rating from 0 people

Average rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!