Articles on this page are available in 1 other language: Chinese (Simplified) (4) (learn more)

Overview

Comprehensive Description

Biology

In clear lagoon and seaward reefs, usually in shallow exposed areas. Found in small to large aggregations (Ref. 48637).
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Distribution

Range Description

Acanthurus japonicus is found from southern Japan and southwards to Sulawesi, Indonesia. It is rarely found in Palau.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Indo-West Pacific: Sulawesi (Indonesia) to Philippines and Ryukyu Islands.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Western Pacific.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Physical Description

Morphology

Dorsal spines (total): 9; Dorsal soft rays (total): 28 - 31; Analsoft rays: 26 - 29
  • Randall, J.E. 2001 Acanthuridae. Surgeonfishes (tangs, unicornfishes). p. 3653-3683. In K.E. Carpenter and V. Niem (eds.) FAO species identification guide for fishery purposes. The living marine resources of the Western Central Pacific. Vol. 6. Bony fishes part 4 (Labridae to Latimeriidae), estuarine crocodiles. FAO, Rome. (Ref. 9808)   http://www.fishbase.org/references/FBRefSummary.php?id=9808&speccode=12625 External link.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Size

Maximum size: 210 mm NG
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Max. size

21.0 cm TL (male/unsexed; (Ref. 9710))
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Diagnostic Description

A broad white band extending from lower edge of eye to upper lip. A bright orange band in outer part of soft portion of dorsal fin. Caudal peduncle yellow, shading to black a short distance anteriorly. Base of pectoral fins yellow (Ref 9808).
  • Randall, J.E. 2001 Acanthuridae. Surgeonfishes (tangs, unicornfishes). p. 3653-3683. In K.E. Carpenter and V. Niem (eds.) FAO species identification guide for fishery purposes. The living marine resources of the Western Central Pacific. Vol. 6. Bony fishes part 4 (Labridae to Latimeriidae), estuarine crocodiles. FAO, Rome. (Ref. 9808)   http://www.fishbase.org/references/FBRefSummary.php?id=9808&speccode=12625 External link.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Ecology

Habitat

Habitat and Ecology

Habitat and Ecology
Acanthurus japonicus is classified as a grazer (Choat and Bellwood pers. obs. in Green and Bellwood 2009). The sexes are separate among the acanthurids (Reeson 1983). Acanthurids do not display obvious sexual dimorphism, males assume courtship colours (J.H. Choat pers. comm. 2010).

Systems
  • Marine
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Environment

reef-associated; marine; depth range ? - 20 m (Ref. 48637), usually 5 - 15 m (Ref. 27115)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Diseases and Parasites

White spot Disease. Parasitic infestations (protozoa, worms, etc.)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Acanthurus japonicus

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 4 barcode sequences available from BOLD and GenBank.  Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

CCTTTATTTAGTATTTGGTGCTTGAGCTGGGATAGTAGGAACGGCCCTGAGCCTCCTAATCCGAGCAGAATTAAGCCAACCAGGCGCCCTCCTCGGGGATGACCAAATTTATAATGTAATTGTTACAGCACACGCATTCGTAATAATTTTCTTTATAGTAATACCAATTATGATTGGTGGATTTGGAAATTGATTAATTCCACTAATGATCGGAGCTCCCGACATAGCATTCCCACGAATAAATAATATGAGCTTTTGGCTCCTACCCCCATCCTTCCTGCTTCTACTAGCATCTTCTGCAGTAGAGTCTGGTGCTGGCACAGGGTGAACAGTATACCCTCCTCTAGCCGGCAATTTAGCACATGCAGGAGCATCTGTAGACCTAACCATTTTCTCCCTCCACCTCGCAGGTATTTCTTCAATTCTTGGAGCTATTAATTTTATTACAACAATTATTAATATGAAACCTCCTGCTATTTCTCAATATCAAACCCCCCTATTTGTATGAGCCGTACTAATTACTGCTGTCCTACTCCTTCTCTCACTTCCCGTTCTCGCCGCCGGAATTACAATGCTACTAACAGACCGTAATCTAAACACTACTTTCTTTGATCCGGCAGGGGGAGGAGACCCCATCCTATACCAACATTTA
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Statistics of barcoding coverage: Acanthurus japonicus

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 4
Specimens with Barcodes: 7
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Conservation

Conservation Status

IUCN Red List Assessment


Red List Category
LC
Least Concern

Red List Criteria

Version
3.1

Year Assessed
2012

Assessor/s
Abesamis, R., Clements, K.D., Choat, J.H., McIlwain, J., Myers, R., Nanola, C., Rocha, L.A., Russell, B. & Stockwell, B.

Reviewer/s
Davidson, L., Edgar, G. & Kulbicki, M.

Contributor/s

Justification
Acanthurus japonicus is common and abundant in most of its range. It is not specifically targeted in any fishery and is found in marine reserves in parts of its range. It is therefore listed as Least Concern.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Population

Population
Acanthurus japonicus was occasionally found in Calamianes Islands, Puerto Princesa, San Vicente and Taytay Philippines (Werner and Allen 2000, J. Pontillas pers. comm. 2010). It is common and abundant in the Philippines (R. Abesamis, C. Nanola and B. Stockwell pers. comm. 2010).

In the central Philippines, density and biomass of herbivorous fish in reserves had positive relationships with duration of reserve protection. Acanthuridae and Labridae (parrotfishes) were the major families that increased in biomass inside reserves with increased duration of reserve protection. Herbivore biomass inside reserves compared to fished sites was on average 1.4, 4.8 and 8.1 times higher at 0.5 to 4, 5 to 7 and 8 to 11 years of protection, respectively (Stockwell et al. 2009).

Population Trend
Unknown
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Threats

Major Threats
There are no major threats known for this species.

Surgeonfishes show varying degrees of habitat preference and utilization of coral reef habitats, with some species spending the majority of their life stages on coral reef while others primarily utilize seagrass beds, mangroves, algal beds, and /or rocky reefs. The majority of surgeonfishes are exclusively found on coral reef habitat, and of these, approximately 80% are experiencing a greater than 30% loss of coral reef area and degradation of coral reef habitat quality across their distributions. However, more research is needed to understand the long-term effects of coral reef habitat loss and degradation on these species' populations. Widespread coral reef loss and declining habitat conditions are particularly worrying for species that recruit into areas with live coral cover, especially as studies have shown that protection of pristine habitats facilitate the persistence of adult populations in species that have spatially separated adult and juvenile habitats (Comeros-Raynal et al. 2012).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Least Concern (LC)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Management

Conservation Actions

Conservation Actions
There are no species-specific conservation measures in place for this species. Its distribution overlaps several marine protected areas in parts of its range.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Relevance to Humans and Ecosystems

Benefits

Importance

aquarium: commercial
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Wikipedia

Acanthurus japonicus

Acanthurus japonicus is a Tang from the Indo-West Pacific. It occasionally makes its way into the aquarium trade. It grows to a size of 21 cm in length. It is also known as Japan Surgeonfish, White-faced Surgeonfish and White-nose Surgeonfish.

References

Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

Source: Wikipedia

Unreviewed

Article rating from 0 people

Average rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!