Overview
Comprehensive Description
Biology
Forms schools near the surface of inshore waters. Feeds on zooplankton.
-
Masuda, H., K. Amaoka, C. Araga, T. Uyeno and T. Yoshino 1984 The fishes of the Japanese Archipelago. Vol. 1. Tokai University Press, Tokyo, Japan. 437 p. (text). (Ref. 559)
http://www.fishbase.org/references/FBRefSummary.php?id=559&speccode=7
Trusted
Distribution
Northwest Pacific: southern Japan and the Korean Peninsula.
-
Masuda, H., K. Amaoka, C. Araga, T. Uyeno and T. Yoshino 1984 The fishes of the Japanese Archipelago. Vol. 1. Tokai University Press, Tokyo, Japan. 437 p. (text). (Ref. 559)
http://www.fishbase.org/references/FBRefSummary.php?id=559&speccode=7
Trusted
Physical Description
Morphology
Dorsal spines (total): 6 - 9; Dorsal soft rays (total): 8 - 11; Analspines: 1; Analsoft rays: 10 - 13
-
Masuda, H., K. Amaoka, C. Araga, T. Uyeno and T. Yoshino 1984 The fishes of the Japanese Archipelago. Vol. 1. Tokai University Press, Tokyo, Japan. 437 p. (text). (Ref. 559)
http://www.fishbase.org/references/FBRefSummary.php?id=559&speccode=7
Trusted
Size
Max. size
15.0 cm SL (male/unsexed; (Ref. 559))
-
Masuda, H., K. Amaoka, C. Araga, T. Uyeno and T. Yoshino 1984 The fishes of the Japanese Archipelago. Vol. 1. Tokai University Press, Tokyo, Japan. 437 p. (text). (Ref. 559)
http://www.fishbase.org/references/FBRefSummary.php?id=559&speccode=7
Trusted
Diagnostic Description
Anus set behind tips of pelvic fins. Lower jaw highly elevated posteriorly. Attains 15 cm SL.
-
Masuda, H., K. Amaoka, C. Araga, T. Uyeno and T. Yoshino 1984 The fishes of the Japanese Archipelago. Vol. 1. Tokai University Press, Tokyo, Japan. 437 p. (text). (Ref. 559)
http://www.fishbase.org/references/FBRefSummary.php?id=559&speccode=7
Trusted
Type Information
Paratype for Atherina tsurugae Jordan & Starks
Catalog Number: USNM 49816
Collection: Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Fishes
Preparation: Illustration
Collector(s): D. Jordan & J. Snyder
Year Collected: 1900
Locality: Nagasaki, Hizen, Kyushu, Nagasaki Prefecture, Japan, Pacific
Catalog Number: USNM 49816
Collection: Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Fishes
Preparation: Illustration
Collector(s): D. Jordan & J. Snyder
Year Collected: 1900
Locality: Nagasaki, Hizen, Kyushu, Nagasaki Prefecture, Japan, Pacific
- Paratype: Jordan, D. S. & Starks, E. C. 1901. Proceedings of the United States National Museum. 24 (1250): 202, fig. 2.
Trusted
Ecology
Habitat
Trophic Strategy
Forms schools near the surface of inshore waters. Feeds on zooplankton.
-
Masuda, H., K. Amaoka, C. Araga, T. Uyeno and T. Yoshino 1984 The fishes of the Japanese Archipelago. Vol. 1. Tokai University Press, Tokyo, Japan. 437 p. (text). (Ref. 559)
http://www.fishbase.org/references/FBRefSummary.php?id=559&speccode=7
Trusted
Molecular Biology and Genetics
Molecular Biology
Barcode data: Hypoatherina tsurugae
The following is a representative barcode sequence, the centroid of all available sequences for this species.

There are 2 barcode sequences available from BOLD and GenBank. Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species. See the BOLD taxonomy browser for more complete information about this specimen and other sequences.
Download FASTA File
There are 2 barcode sequences available from BOLD and GenBank. Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species. See the BOLD taxonomy browser for more complete information about this specimen and other sequences.
ACACGTTGATTCTTCTCGACCAATCACAAAGACATCGGCACCCTCTACCTAGTATTTGGTGCCTGAGCCGGAATAGTAGGCACTGCTCTGAGCCTTCTCATCCGGGCAGAACTGAGCCAACCCGGCTCTCTCCTAGGAGAC---GACCAAATTTATAATGTCATCGTTACAGCACACGCCTTTGTAATAATTTTCTTTATAGTAATACCAATTATGATTGGAGGCTTTGGAAATTGACTTATTCCCCTTATGATTGGAGCCCCTGACATGGCCTTCCCTCGAATAAACAATATGAGCTTCTGACTTCTTCCTCCCTCTTTCCTTCTCCTTCTTACATCATCTGGAGTAGAAGCGGGAGCCGGGACAGGTTGAACAGTCTACCCTCCACTGGCTGGAAACTTAGCCCACGCAGGTGCATCCGTTGATCTAACTATTTTCTCCCTTCACTTAGCAGGCGTTTCATCAATTCTTGGAGCCATCAACTTTATCACAACCATTATTAATATGAAACCCCCTGCAATTTCCCAATACCAGACACCCCTATTTGTCTGAGCGGTCCTAATCACTGCAGTCCTCCTTCTTCTTTCTCTCCCTGTTTTAGCCGCTGGCATCACCATGCTACTGACAGACCGAAACCTGAATACCACCTTCTTTGATCCTGCCGGGGGAGGAGACCCAATCCTTTACCAACACCTCTTTTGATTCTTTGGGCACCCTGAAGTCTACATTCTTATTCTTCCCGGCTTCGGAATAATTTCCCACATCGTCGCCTACTATTCCGGTAAAAAAGAACCATTTGGCTACATGGGCATGGTATGAGCCATGATAGCCATCGGACTTCTGGGGTTCATCGTTTGAGCCCATCACATGTTTACTGTCGGAATGGATGTAGACACTCGAG
-- end --
-- end --
Download FASTA File
Trusted
Statistics of barcoding coverage: Hypoatherina tsurugae
Barcode of Life Data Systems (BOLDS) Stats
Public Records: 2
Specimens with Barcodes: 2
Species With Barcodes: 1
Public Records: 2
Specimens with Barcodes: 2
Species With Barcodes: 1
Trusted
Conservation
Threats
Not Evaluated
-
IUCN 2006 2006 IUCN red list of threatened species. www.iucnredlist.org. Downloaded July 2006.
http://www.fishbase.org/references/FBRefSummary.php?id=57073
Trusted
Disclaimer
EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.
To request an improvement, please leave a comment on the page. Thank you!


