Overview

Comprehensive Description

Biology

Forms schools near the surface of inshore waters. Feeds on zooplankton.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Distribution

Western North Atlantic.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Northwest Pacific: southern Japan and the Korean Peninsula.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Physical Description

Morphology

Dorsal spines (total): 6 - 9; Dorsal soft rays (total): 8 - 11; Analspines: 1; Analsoft rays: 10 - 13
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Size

Maximum size: 150 mm SL
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Max. size

15.0 cm SL (male/unsexed; (Ref. 559))
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Diagnostic Description

Anus set behind tips of pelvic fins. Lower jaw highly elevated posteriorly. Attains 15 cm SL.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Type Information

Paratype for Atherina tsurugae Jordan & Starks
Catalog Number: USNM 49816
Collection: Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Fishes
Preparation: Illustration
Collector(s): D. Jordan & J. Snyder
Year Collected: 1900
Locality: Nagasaki, Hizen, Kyushu, Nagasaki Prefecture, Japan, Pacific
  • Paratype: Jordan, D. S. & Starks, E. C. 1901. Proceedings of the United States National Museum. 24 (1250): 202, fig. 2.
Creative Commons Attribution 3.0 (CC BY 3.0)

© Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Fishes

Source: National Museum of Natural History Image Collection

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Ecology

Habitat

Environment

pelagic-neritic; marine
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Trophic Strategy

Forms schools near the surface of inshore waters. Feeds on zooplankton.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Hypoatherina tsurugae

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 2 barcode sequences available from BOLD and GenBank.  Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

ACACGTTGATTCTTCTCGACCAATCACAAAGACATCGGCACCCTCTACCTAGTATTTGGTGCCTGAGCCGGAATAGTAGGCACTGCTCTGAGCCTTCTCATCCGGGCAGAACTGAGCCAACCCGGCTCTCTCCTAGGAGAC---GACCAAATTTATAATGTCATCGTTACAGCACACGCCTTTGTAATAATTTTCTTTATAGTAATACCAATTATGATTGGAGGCTTTGGAAATTGACTTATTCCCCTTATGATTGGAGCCCCTGACATGGCCTTCCCTCGAATAAACAATATGAGCTTCTGACTTCTTCCTCCCTCTTTCCTTCTCCTTCTTACATCATCTGGAGTAGAAGCGGGAGCCGGGACAGGTTGAACAGTCTACCCTCCACTGGCTGGAAACTTAGCCCACGCAGGTGCATCCGTTGATCTAACTATTTTCTCCCTTCACTTAGCAGGCGTTTCATCAATTCTTGGAGCCATCAACTTTATCACAACCATTATTAATATGAAACCCCCTGCAATTTCCCAATACCAGACACCCCTATTTGTCTGAGCGGTCCTAATCACTGCAGTCCTCCTTCTTCTTTCTCTCCCTGTTTTAGCCGCTGGCATCACCATGCTACTGACAGACCGAAACCTGAATACCACCTTCTTTGATCCTGCCGGGGGAGGAGACCCAATCCTTTACCAACACCTCTTTTGATTCTTTGGGCACCCTGAAGTCTACATTCTTATTCTTCCCGGCTTCGGAATAATTTCCCACATCGTCGCCTACTATTCCGGTAAAAAAGAACCATTTGGCTACATGGGCATGGTATGAGCCATGATAGCCATCGGACTTCTGGGGTTCATCGTTTGAGCCCATCACATGTTTACTGTCGGAATGGATGTAGACACTCGAG
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Statistics of barcoding coverage: Hypoatherina tsurugae

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 2
Specimens with Barcodes: 2
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Conservation

Threats

Not Evaluated
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!