Overview
Comprehensive Description
Biology
Inhabits weedy or sandy bottoms of shallow inshore waters (Ref. 9710). Ovoviviparous (Ref. 205). The male carries the eggs in a brood pouch which is found under the tail (Ref. 205).
-
Randall, J.E. 1996 Caribbean reef fishes. Third edition - revised and enlarged. T.F.H. Publications, Inc. Ltd., Hong Kong. 3nd ed. 368 p. (Ref. 13442)
http://www.fishbase.org/references/FBRefSummary.php?id=13442&speccode=942
Trusted
Distribution
Western Atlantic: Belize to Suriname; also from the Greater and Lesser Antilles.
-
Lieske, E. and R. Myers 1994 Collins Pocket Guide. Coral reef fishes. Indo-Pacific & Caribbean including the Red Sea. Haper Collins Publishers, 400 p. (Ref. 9710)
http://www.fishbase.org/references/FBRefSummary.php?id=9710&speccode=13770
Trusted
Physical Description
Morphology
Dorsal soft rays (total): 2732
-
Uyeno, T., K. Matsuura and E. Fujii (eds.) 1983 Fishes trawled off Suriname and French Guiana. Japan Marine Fishery Resource Research Center, Tokyo, Japan. 519 p. (Ref. 13608)
http://www.fishbase.org/references/FBRefSummary.php?id=13608&speccode=14336
Trusted
Size
Max. size
22.5 cm TL (male/unsexed; (Ref. 9710))
-
Lieske, E. and R. Myers 1994 Collins Pocket Guide. Coral reef fishes. Indo-Pacific & Caribbean including the Red Sea. Haper Collins Publishers, 400 p. (Ref. 9710)
http://www.fishbase.org/references/FBRefSummary.php?id=9710&speccode=13770
Trusted
Type Information
Paratype for Syngnathus caribbaeus Dawson
Catalog Number: USNM 79697
Collection: Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Fishes
Collector(s): S. Meek & S. Hildebrand
Year Collected: 1912
Locality: Fox Bay, Colon, Panama, Panama, Caribbean Sea, Atlantic
Catalog Number: USNM 79697
Collection: Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Fishes
Collector(s): S. Meek & S. Hildebrand
Year Collected: 1912
Locality: Fox Bay, Colon, Panama, Panama, Caribbean Sea, Atlantic
- Paratype: Dawson, C. E. 1979. Proceedings of the Biological Society of Washington. 92 (4): 672.
Trusted
Holotype for Syngnathus caribbaeus Dawson
Catalog Number: USNM 79703
Collection: Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Fishes
Collector(s): S. Meek & S. Hildebrand
Year Collected: 1911
Locality: Fox Bay, Colon, Panama, Colon Province, Panama, Fox Bay, Caribbean Sea, Atlantic
Catalog Number: USNM 79703
Collection: Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Fishes
Collector(s): S. Meek & S. Hildebrand
Year Collected: 1911
Locality: Fox Bay, Colon, Panama, Colon Province, Panama, Fox Bay, Caribbean Sea, Atlantic
- Holotype: Dawson, C. E. 1979. Proceedings of the Biological Society of Washington. 92 (4): 672.
Trusted
Paratype for Syngnathus caribbaeus Dawson
Catalog Number: USNM 79701
Collection: Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Fishes
Collector(s): S. Meek & S. Hildebrand
Year Collected: 1911
Locality: Fox Bay, Colon, Panama, Colon Province, Panama, Caribbean Sea, Atlantic
Catalog Number: USNM 79701
Collection: Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Fishes
Collector(s): S. Meek & S. Hildebrand
Year Collected: 1911
Locality: Fox Bay, Colon, Panama, Colon Province, Panama, Caribbean Sea, Atlantic
- Paratype: Dawson, C. E. 1979. Proceedings of the Biological Society of Washington. 92 (4): 672.
Trusted
Ecology
Habitat
Depth range based on 6 specimens in 1 taxon.
Environmental ranges
Depth range (m): 1 - 3
Graphical representation
Depth range (m): 1 - 3
Note: this information has not been validated. Check this *note*. Your feedback is most welcome.
Environmental ranges
Depth range (m): 1 - 3
Graphical representation
Depth range (m): 1 - 3
Note: this information has not been validated. Check this *note*. Your feedback is most welcome.
Trusted
Life History and Behavior
Life Cycle
Male carries the eggs in a brood pouch (Ref. 205).
-
Breder, C.M. and D.E. Rosen 1966 Modes of reproduction in fishes. T.F.H. Publications, Neptune City, New Jersey. 941 p. (Ref. 205)
http://www.fishbase.org/references/FBRefSummary.php?id=205&speccode=1256
Trusted
Molecular Biology and Genetics
Molecular Biology
Barcode data: Syngnathus caribbaeus
The following is a representative barcode sequence, the centroid of all available sequences for this species.

There is 1 barcode sequence available from BOLD and GenBank. Below is the sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species. See the BOLD taxonomy browser for more complete information about this specimen. Other sequences that do not yet meet barcode criteria may also be available.
Download FASTA File
There is 1 barcode sequence available from BOLD and GenBank. Below is the sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species. See the BOLD taxonomy browser for more complete information about this specimen. Other sequences that do not yet meet barcode criteria may also be available.
CCTATATCTAGTATTCGGTGCATGAGCCGGAATAGTGGGCACTGCACTCAGCCTTCTAATCCGAGCAGAACTTAGTCAACCAGGAGCCCTCCTTGGCGATGACCAAATTTACAATGTAATCGTTACAGCTCATGCTTTTGTTATGATTTTTTTCATAGTTATACCCATTATGATCGGAGGTTTTGGCAACTGATTAGTACCACTAATGATTGGAGCCCCTGACATAGCATTCCCCCGAATAAATAACATAAGCTTCTGACTGCTGCCCCCTTCCTTCTTACTCCTTCTTGCTTCCTCAGGAGTAGAAGCAGGTGCAGGCACAGGATGAACTGTCTACCCTCCCCTCTCAGGTAATTTAGCCCATCAAGGGGCTTCTGTAGACCTAACAATTTTCTCCCTACACTTAGCGGGTGTATCCTCAATTCTAGGGGCTATTAACTTTATCACCACTATTATTAATATGAAACCCCCCTCAATCTCCCAATATCAAACACCCTTGTTTGTTTGAGCCGTTTTGATCACTGCCGTCTTACTTCTTCTCTCCCTACCTGTTTTAGCAGCCGGCATCACCATGCTTTTAACTGACCGAAATTTAAACACAACTTTCTTCGACCCTGCGGGAGGTGGGGATCCTATTCTCTACCAGCACCTCTTC
-- end --
-- end --
Download FASTA File
Trusted
Statistics of barcoding coverage: Syngnathus caribbaeus
Barcode of Life Data Systems (BOLDS) Stats
Public Records: 1
Specimens with Barcodes: 6
Species With Barcodes: 1
Public Records: 1
Specimens with Barcodes: 6
Species With Barcodes: 1
Trusted
Conservation
Threats
Not Evaluated
-
IUCN 2006 2006 IUCN red list of threatened species. www.iucnredlist.org. Downloaded July 2006.
http://www.fishbase.org/references/FBRefSummary.php?id=57073
Trusted
Wikipedia
Caribbean pipefish
Caribbean pipefish, Syngnathus caribbaeus, is a species of the pipefishes. Widespread in the Western Atlantic near the coasts of South America from Belize to Suriname, also from the Greater and Lesser Antilles. Marine tropical reef-associated fish, up to 22.5 cm length.
Unreviewed
Disclaimer
EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.
To request an improvement, please leave a comment on the page. Thank you!



