Overview

Comprehensive Description

Biology

Inhabits weedy or sandy bottoms of shallow inshore waters (Ref. 9710). Ovoviviparous (Ref. 205). The male carries the eggs in a brood pouch which is found under the tail (Ref. 205).
  • Randall, J.E. 1996 Caribbean reef fishes. Third Edition - revised and enlarged. T.F.H. Publications, Inc. Ltd., Hong Kong. 3nd ed. 368 p. (Ref. 13442)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Distribution

Western Atlantic: Belize to Suriname; also from the Greater and Lesser Antilles.
  • Lieske, E. and R. Myers 1994 Collins Pocket Guide. Coral reef fishes. Indo-Pacific & Caribbean including the Red Sea. Haper Collins Publishers, 400 p. (Ref. 9710)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Western Atlantic.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Physical Description

Morphology

Dorsal soft rays (total): 2732
  • Uyeno, T., K. Matsuura and E. Fujii (eds.) 1983 Fishes trawled off Suriname and French Guiana. Japan Marine Fishery Resource Research Center, Tokyo, Japan. 519 p. (Ref. 13608)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Size

Maximum size: 225 mm NG
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Max. size

22.5 cm TL (male/unsexed; (Ref. 9710))
  • Lieske, E. and R. Myers 1994 Collins Pocket Guide. Coral reef fishes. Indo-Pacific & Caribbean including the Red Sea. Haper Collins Publishers, 400 p. (Ref. 9710)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Type Information

Paratype for Syngnathus caribbaeus Dawson
Catalog Number: USNM 79697
Collection: Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Fishes
Collector(s): S. Meek & S. Hildebrand
Year Collected: 1912
Locality: Fox Bay, Colon, Panama, Panama, Caribbean Sea, Atlantic
  • Paratype: Dawson, C. E. 1979. Proceedings of the Biological Society of Washington. 92 (4): 672.
Creative Commons Attribution 3.0 (CC BY 3.0)

© Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Fishes

Source: National Museum of Natural History Collections

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Holotype for Syngnathus caribbaeus Dawson
Catalog Number: USNM 79703
Collection: Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Fishes
Collector(s): S. Meek & S. Hildebrand
Year Collected: 1911
Locality: Fox Bay, Colon, Panama, Colon Province, Panama, Fox Bay, Caribbean Sea, Atlantic
  • Holotype: Dawson, C. E. 1979. Proceedings of the Biological Society of Washington. 92 (4): 672.
Creative Commons Attribution 3.0 (CC BY 3.0)

© Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Fishes

Source: National Museum of Natural History Collections

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Paratype for Syngnathus caribbaeus Dawson
Catalog Number: USNM 79701
Collection: Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Fishes
Collector(s): S. Meek & S. Hildebrand
Year Collected: 1911
Locality: Fox Bay, Colon, Panama, Colon Province, Panama, Caribbean Sea, Atlantic
  • Paratype: Dawson, C. E. 1979. Proceedings of the Biological Society of Washington. 92 (4): 672.
Creative Commons Attribution 3.0 (CC BY 3.0)

© Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Fishes

Source: National Museum of Natural History Collections

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Ecology

Habitat

Environment

reef-associated; marine
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Depth range based on 6 specimens in 1 taxon.

Environmental ranges
  Depth range (m): 1 - 3

Graphical representation

Depth range (m): 1 - 3
 
Note: this information has not been validated. Check this *note*. Your feedback is most welcome.

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Life History and Behavior

Life Cycle

Male carries the eggs in a brood pouch (Ref. 205).
  • Breder, C.M. and D.E. Rosen 1966 Modes of reproduction in fishes. T.F.H. Publications, Neptune City, New Jersey. 941 p. (Ref. 205)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Syngnathus caribbaeus

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There is 1 barcode sequence available from BOLD and GenBank.

Below is the sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.

See the BOLD taxonomy browser for more complete information about this specimen.

Other sequences that do not yet meet barcode criteria may also be available.

CCTATATCTAGTATTCGGTGCATGAGCCGGAATAGTGGGCACTGCACTCAGCCTTCTAATCCGAGCAGAACTTAGTCAACCAGGAGCCCTCCTTGGCGATGACCAAATTTACAATGTAATCGTTACAGCTCATGCTTTTGTTATGATTTTTTTCATAGTTATACCCATTATGATCGGAGGTTTTGGCAACTGATTAGTACCACTAATGATTGGAGCCCCTGACATAGCATTCCCCCGAATAAATAACATAAGCTTCTGACTGCTGCCCCCTTCCTTCTTACTCCTTCTTGCTTCCTCAGGAGTAGAAGCAGGTGCAGGCACAGGATGAACTGTCTACCCTCCCCTCTCAGGTAATTTAGCCCATCAAGGGGCTTCTGTAGACCTAACAATTTTCTCCCTACACTTAGCGGGTGTATCCTCAATTCTAGGGGCTATTAACTTTATCACCACTATTATTAATATGAAACCCCCCTCAATCTCCCAATATCAAACACCCTTGTTTGTTTGAGCCGTTTTGATCACTGCCGTCTTACTTCTTCTCTCCCTACCTGTTTTAGCAGCCGGCATCACCATGCTTTTAACTGACCGAAATTTAAACACAACTTTCTTCGACCCTGCGGGAGGTGGGGATCCTATTCTCTACCAGCACCTCTTC
-- end --

Download FASTA File

Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Syngnathus caribbaeus

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 1
Specimens with Barcodes: 6
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Conservation

Threats

Not Evaluated
  • IUCN 2006 2006 IUCN red list of threatened species. www.iucnredlist.org. Downloaded July 2006.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Wikipedia

Caribbean pipefish

Caribbean pipefish, Syngnathus caribbaeus, is a species of the pipefishes. Widespread in the Western Atlantic near the coasts of South America from Belize to Suriname, also from the Greater and Lesser Antilles. Marine tropical reef-associated fish, up to 22.5 cm length.

Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

Source: Wikipedia

Unreviewed

Article rating from 0 people

Default rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!