Overview

Comprehensive Description

Biology

Inhabits weedy or sandy bottoms of shallow inshore waters (Ref. 9710). Ovoviviparous (Ref. 205). The male carries the eggs in a brood pouch which is found under the tail (Ref. 205).
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Distribution

Western Atlantic: Belize to Suriname; also from the Greater and Lesser Antilles.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Western Atlantic.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Physical Description

Morphology

Dorsal soft rays (total): 2732
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Size

Maximum size: 225 mm NG
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Max. size

22.5 cm TL (male/unsexed; (Ref. 9710))
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Type Information

Paratype for Syngnathus caribbaeus Dawson
Catalog Number: USNM 79697
Collection: Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Fishes
Collector(s): S. Meek & S. Hildebrand
Year Collected: 1912
Locality: Fox Bay, Colon, Panama, Panama, Caribbean Sea, Atlantic
  • Paratype: Dawson, C. E. 1979. Proceedings of the Biological Society of Washington. 92 (4): 672.
Creative Commons Attribution 3.0 (CC BY 3.0)

© Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Fishes

Source: National Museum of Natural History Image Collection

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Holotype for Syngnathus caribbaeus Dawson
Catalog Number: USNM 79703
Collection: Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Fishes
Collector(s): S. Meek & S. Hildebrand
Year Collected: 1911
Locality: Fox Bay, Colon, Panama, Colon Province, Panama, Fox Bay, Caribbean Sea, Atlantic
  • Holotype: Dawson, C. E. 1979. Proceedings of the Biological Society of Washington. 92 (4): 672.
Creative Commons Attribution 3.0 (CC BY 3.0)

© Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Fishes

Source: National Museum of Natural History Image Collection

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Paratype for Syngnathus caribbaeus Dawson
Catalog Number: USNM 79701
Collection: Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Fishes
Collector(s): S. Meek & S. Hildebrand
Year Collected: 1911
Locality: Fox Bay, Colon, Panama, Colon Province, Panama, Caribbean Sea, Atlantic
  • Paratype: Dawson, C. E. 1979. Proceedings of the Biological Society of Washington. 92 (4): 672.
Creative Commons Attribution 3.0 (CC BY 3.0)

© Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Fishes

Source: National Museum of Natural History Image Collection

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Ecology

Habitat

Environment

reef-associated; marine
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Depth range based on 6 specimens in 1 taxon.

Environmental ranges
  Depth range (m): 1 - 3

Graphical representation

Depth range (m): 1 - 3
 
Note: this information has not been validated. Check this *note*. Your feedback is most welcome.
Public Domain

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Life History and Behavior

Life Cycle

Male carries the eggs in a brood pouch (Ref. 205).
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Syngnathus caribbaeus

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There is 1 barcode sequence available from BOLD and GenBank.   Below is the sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen.  Other sequences that do not yet meet barcode criteria may also be available.

CCTATATCTAGTATTCGGTGCATGAGCCGGAATAGTGGGCACTGCACTCAGCCTTCTAATCCGAGCAGAACTTAGTCAACCAGGAGCCCTCCTTGGCGATGACCAAATTTACAATGTAATCGTTACAGCTCATGCTTTTGTTATGATTTTTTTCATAGTTATACCCATTATGATCGGAGGTTTTGGCAACTGATTAGTACCACTAATGATTGGAGCCCCTGACATAGCATTCCCCCGAATAAATAACATAAGCTTCTGACTGCTGCCCCCTTCCTTCTTACTCCTTCTTGCTTCCTCAGGAGTAGAAGCAGGTGCAGGCACAGGATGAACTGTCTACCCTCCCCTCTCAGGTAATTTAGCCCATCAAGGGGCTTCTGTAGACCTAACAATTTTCTCCCTACACTTAGCGGGTGTATCCTCAATTCTAGGGGCTATTAACTTTATCACCACTATTATTAATATGAAACCCCCCTCAATCTCCCAATATCAAACACCCTTGTTTGTTTGAGCCGTTTTGATCACTGCCGTCTTACTTCTTCTCTCCCTACCTGTTTTAGCAGCCGGCATCACCATGCTTTTAACTGACCGAAATTTAAACACAACTTTCTTCGACCCTGCGGGAGGTGGGGATCCTATTCTCTACCAGCACCTCTTC
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Statistics of barcoding coverage: Syngnathus caribbaeus

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 1
Specimens with Barcodes: 6
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Conservation

Threats

Not Evaluated
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Wikipedia

Caribbean pipefish

Caribbean pipefish, Syngnathus caribbaeus, is a species of the pipefishes. Widespread in the Western Atlantic near the coasts of South America from Belize to Suriname, also from the Greater and Lesser Antilles. Marine tropical reef-associated fish, up to 22.5 cm length.

Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

 

Source: Wikipedia

Unreviewed

Article rating from 0 people

Average rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!