Articles on this page are available in 1 other language: Chinese (Simplified) (4) (learn more)

Overview

Comprehensive Description

Description

  Common names: sharpnose-puffer (English), tamboril (Espanol)
 
Canthigaster valentini (Bleeker, 1853)


Black-saddled sharpnose-puffer,     Valentini's sharpnose-puffer


Robust, slightly compressed body; head large, blunt; snout long and pointed; 1 pair of small hole-like nostrils; nape with crest between eyes and dorsal fin; eyes high on sides of head; jaws are a beak composed of 4 fused heavy powerful teeth with a central suture on each jaw; a slit-like gill opening in front of the pectoral fin base; a single short- based dorsal fin at rear of body; a similar-shaped anal fin below the dorsal; dorsal 9 rays; anal 9 rays; pectoral 16-17 rays;  no pelvic fins; no spines in the fins; tail fin rounded, with 10 main rays; tough scaleless skin, head and body with scattered tiny spinules, no fleshy skin flaps.

Whitish; small brown spots on sides of body and head; short blue lines extend to rear from eye; dark brown saddle immediately behind eye, 2 long brown bars on body, dark brown saddle on tail base; tail fin yellow, upper and lower edges black.


Size: 11 cm.

Habitat: reefs.

Depth: 1-55 m.

Indo-Pacific; vagrant in the Galapagos.
   
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© Shorefishes of the tropical eastern Pacific online information system. www.stri.org/sftep

Source: Shorefishes of the Tropical Eastern Pacific Online Information System

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Biology

Found among coral heads and rocks of subtidal lagoon and seaward reefs (Ref. 4919, 5503). Common on coastal reefs at various depths. Mimic filefish, males are territorial and are often seen fighting (Ref. 48637). Feed mainly on filamentous green and red algae, tunicates, and on smaller amounts of corals, bryozoans, polychaetes, echinoderms, mollusks, and brown and coralline red algae. Form shoals (10-100 or more) often with the filefish, Paraluteres prionurus (about 5% of shoal) mimicking C. valentini to protect it from predators (Ref. 4919, 5503). Territorial and haremic; males spawn with a different female each day (Ref. 9710). One or more territories are occupied and defended each by a female where a single large male stands guard (Ref. 55082). All sexually mature females are territorial females (Ref. 55082). Demersal spawner (Ref. 35298).
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Distribution

Zoogeography

See Map (including site records) of Distribution in the Tropical Eastern Pacific 
 
Global Endemism: All species, TEP non-endemic, Indo-Pacific only (Indian + Pacific Oceans), "Transpacific" (East + Central &/or West Pacific), All Pacific (West + Central + East)

Regional Endemism: All species, Eastern Pacific non-endemic, Tropical Eastern Pacific (TEP) non-endemic, Island (s), Island (s) only

Residency: Vagrant

Climate Zone: Equatorial (Costa Rica to Ecuador + Galapagos, Clipperton, Cocos, Malpelo)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© Shorefishes of the tropical eastern Pacific online information system. www.stri.org/sftep

Source: Shorefishes of the Tropical Eastern Pacific Online Information System

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Red Sea, Indo-West Pacific: East Africa, South Africa, Seychelles, Madagascar and Mascarenes east to Tuamotu Archipelago, north to South Korea, southern Japan and Ogasawara Islands, south to Lord Howe Island; doubtfully in the Galápagos Islands (Eastern P
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Indo-Pacific: Red Sea south to Durban, South Africa (Ref. 4919) and east to the Tuamoto Islands, north to southern Japan, south to Lord Howe Island.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Depth

Depth Range (m): 1 (S) - 55 (S)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© Shorefishes of the tropical eastern Pacific online information system. www.stri.org/sftep

Source: Shorefishes of the Tropical Eastern Pacific Online Information System

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Physical Description

Morphology

Dorsal spines (total): 0; Dorsal soft rays (total): 9; Analspines: 0; Analsoft rays: 9
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Size

Length max (cm): 11.0 (S)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© Shorefishes of the tropical eastern Pacific online information system. www.stri.org/sftep

Source: Shorefishes of the Tropical Eastern Pacific Online Information System

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Size

Maximum size: 110 mm TL
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Max. size

11.0 cm TL (male/unsexed; (Ref. 4919))
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Diagnostic Description

Description

Found among coral heads and rocks of subtidal lagoon and seaward reefs to a depth of 55 m or more. Feeds mainly on filamentous green and red algae, tunicates, and on smaller amounts of corals, bryozoans, polychaetes, echinoderms, mollusks, and brown and coralline red algae. Forms shoals (10-100 or more) which often contains the filefish, @Paraluteres prionurus@ (about 5% of shoal) mimicking @C. valentini@ to protect it from predators (Refs. 4919 and 5503).
  • Anon. (1996). FishBase 96 [CD-ROM]. ICLARM: Los Baños, Philippines. 1 cd-rom pp.
Creative Commons Attribution 3.0 (CC BY 3.0)

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Side with two prominent dark bars extending to belly (Ref. 559).
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Ecology

Habitat

Depth: 1 - 55m.
From 1 to 55 meters.

Habitat: reef-associated. Model toby.  (Bleeker, 1853)  
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Environment

reef-associated; marine; depth range 1 - 55 m (Ref. 1602)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Depth range based on 151 specimens in 1 taxon.
Water temperature and chemistry ranges based on 72 samples.

Environmental ranges
  Depth range (m): 0.65 - 68.6
  Temperature range (°C): 24.146 - 29.061
  Nitrate (umol/L): 0.019 - 3.114
  Salinity (PPS): 33.507 - 36.142
  Oxygen (ml/l): 4.462 - 4.889
  Phosphate (umol/l): 0.055 - 0.546
  Silicate (umol/l): 0.819 - 5.551

Graphical representation

Depth range (m): 0.65 - 68.6

Temperature range (°C): 24.146 - 29.061

Nitrate (umol/L): 0.019 - 3.114

Salinity (PPS): 33.507 - 36.142

Oxygen (ml/l): 4.462 - 4.889

Phosphate (umol/l): 0.055 - 0.546

Silicate (umol/l): 0.819 - 5.551
 
Note: this information has not been validated. Check this *note*. Your feedback is most welcome.

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Salinity: Marine, Marine Only

Inshore/Offshore: Inshore, Inshore Only

Water Column Position: Bottom, Bottom only

Habitat: Reef (rock &/or coral), Reef only, Rocks, Corals, Reef associated (reef + edges-water column & soft bottom)

FishBase Habitat: Reef Associated
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© Shorefishes of the tropical eastern Pacific online information system. www.stri.org/sftep

Source: Shorefishes of the Tropical Eastern Pacific Online Information System

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Trophic Strategy

Found among coral heads and rocks of subtidal lagoon and seaward reefs (Ref. 4919, 5503). Common on coastal reefs at various depths. Mimic filefish, males are territorial and are often seen fighting (Ref. 48637). Feeds mainly on filamentous green and red algae, tunicates, and on smaller amounts of corals, bryozoans, polychaetes, echinoderms, mollusks, and brown and coralline red algae. Forms shoals (10-100 or more) often with the filefish, Paraluteres prionurus (about 5% of shoal) mimicking C. valentini to protect it from predators (Ref. 4919, 5503). Territorial and haremic; males spawn with a different female each day (Ref. 9710). One or more territories are occupied and defended each by a female where a single large male stands guard (Ref. 55082).
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Feeding

Feeding Group: Omnivore

Diet: benthic microalgae, sea-stars/cucumbers/urchins, sponges/seasquirts/bryozoa, soft corals/hydroids, sessile crustacea, sessile worms, sessile molluscs
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© Shorefishes of the tropical eastern Pacific online information system. www.stri.org/sftep

Source: Shorefishes of the Tropical Eastern Pacific Online Information System

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Life History and Behavior

Life Cycle

Social and mating systems of this species are based upon female territoriality where polygyny results from males defending females occupying a certain territory (female-defense polygyny) (Ref. 55082). All sexually mature females are territorial females (Ref. 55082). Neither parent guards the eggs which are laid in a nest located in the female's territory (Ref. 46142).During breeding, territorial females perform the 'caudal flexing with swollen abdomen display' to signal courtship and readiness to spawn. The male acknowledges with no courtship or color displays but rather by visiting the sites frequently. The territorial female then begins pecking at the substrate in preparation for egg laying. The female initiates the spawning event by pressing her abdomen into the prepared site. The territorial male quickly lays his body across her caudal peduncle and both remained in this position for 5-10 sec. The male swims away after leaving the female beating her anal fin rapidly over the nest site to ensure fertilization of the eggs and to push the eggs deep into the algal substrate (Ref. 46142). All territorial males spawn with territorial females, depriving the bachelor males of the chance to copulate which nevertheless don't interfere with the spawning between the territorial male and females (Ref. 46142).
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Reproduction

Egg Type: Benthic, Pelagic larva
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© Shorefishes of the tropical eastern Pacific online information system. www.stri.org/sftep

Source: Shorefishes of the Tropical Eastern Pacific Online Information System

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Canthigaster valentini

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 8 barcode sequences available from BOLD and GenBank.  Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

CACCCTCTACCTAGTATTTGGTGCCTGAGCCGGAATAGTAGGAACAGCCCTAAGCCTCCTTATTCGAGCTGAACTCAGCCAACCCGGCGCACTTTTAGGTGACGACCAAATTTATAATGTAATCGTCACAGCTCATGCATTCGTAATAATTTTCTTTATAGTAATGCCAATCATGATCGGCGGCTTTGGAAACTGGCTAGTACCCCTTATGATCGGGGCGCCCGACATGGCATTTCCTCGAATGAACAACATAAGTTTCTGACTACTACCACCCTCCTTCCTGCTTCTCCTAGCATCTTCCGGAGTAGAAGCAGGGGCTGGTACAGGCTGAACAGTCTACCCACCACTAGCGGGCAACCTAGCCCACGCAGGAGCATCCGTTGACCTCACAATTTTCTCCCTCCACCTGGCAGGTGTCTCATCAATTCTAGGTGCTATCAACTTTATTACTACAATTATCAACATGAAACCCCCAGCCATTTCACAATACCAGACTCCCCTCTTTGTATGAGCTGTCTTAATTACCGCAGTCCTACTACTTCTATCACTACCAGTTCTCGCAGCTGGAATTACAATGCTTCTCACAGACCGAAACCTAAACACCACTTTCTTCGACCCTGCAGGCGGAGGAGACCCCATTCTTTATCAACACCT
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Statistics of barcoding coverage: Canthigaster valentini

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 10
Specimens with Barcodes: 17
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Genomic DNA is available from 1 specimen with morphological vouchers housed at Museum of Tropical Queensland
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© Ocean Genome Legacy

Source: Ocean Genome Resource

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Conservation

Conservation Status

IUCN Red List: Not evaluated / Listed

CITES: Not listed
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© Shorefishes of the tropical eastern Pacific online information system. www.stri.org/sftep

Source: Shorefishes of the Tropical Eastern Pacific Online Information System

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Threats

Not Evaluated
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Relevance to Humans and Ecosystems

Benefits

Importance

aquarium: commercial
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Wikipedia

Valentinni's sharpnose puffer

Canthigaster valentini, also known as the Saddled puffer , Valentinni's sharpnose puffer or Black saddled toby, is a demersal Marine fish belonging to the family Tetraodontidae.

The Saddled puffer is a small sized fish which grows up to 11 cm.[1]

It is widely distributed throughout the tropical and subtropical waters of the Indian Ocean, Red Sea included, and until the oceanic islands of the Pacific Ocean.[2]

It inhabits rocky and coral reefs, lagoons and external reef until 55 m.[3] Canthigaster valentini has a diurnal activity.

It has four distinct black stripes (saddles) on its back. The head is blue-grey and the main body is white speckled with blue-grey spots. The tail and fins show hints of yellow and there is a rainbow streak of color behind the eyes.

Canthigaster valentini is omnivorous, it feeds on filamentous green and red algae, tunicates, and on smaller amounts of corals, bryozoans, polychaetes, echinoderms, mollusks, and brown and coralline red algae.[4]

Valentinni's sharpnose puffer is highly poisonous to eat.

C. valentini are occasionally found in schools together with Paraluteres prionurus, a non-toxic filefish which has evolved to mimic the very toxic C. valentini for protection against predators.

References[edit]

  1. ^ http://eol.org/pages/225023/details#size
  2. ^ http://eol.org/pages/225023/details#distribution
  3. ^ Lieske & Myers,Coral reef fishes,Princeton University Press, 2009, ISBN 9780691089959
  4. ^ http://eol.org/pages/225023/details#trophic_strategy
Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

Source: Wikipedia

Unreviewed

Article rating from 0 people

Average rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!