Overview

Comprehensive Description

Biology

This schooling species inhabits seagrass beds and hard-bottomed habitats from the reef flat to depths of 46 m or more on lagoon and seaward reefs. Often found with branching Acropora coral (Ref. 9710). Most common Neophion found in shallow areas (Ref. 9710). Benthopelagic (Ref. 58302). Feeds on small fishes (Ref. 30573), small crabs, and shrimps at night. Venomous spine at the corner of its preopercle. Marketed fresh (Ref. 9948).
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Distribution

Indo-Pacific: Red Sea and East Africa to the Marquesan and Ducie islands, north to southern Japan, the Ogasawara and Hawaiian islands, south to northern Australia and Lord Howe Island.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Indo-Pacific: Red Sea and East Africa to the Marquesan and Ducie islands, north to southern Japan and the Ogasawara and Hawaiian islands, northern Australia and Lord Howe Island. Throughout Micronesia
Creative Commons Attribution 3.0 (CC BY 3.0)

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Cargados Carajos, Chagos, Comores, Kenya, Madagascar, Mauritius, Mozambique, North West Atlantic, Reunion, Seychelles, Somalia, South Africa (country)
Creative Commons Attribution 3.0 (CC BY 3.0)

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Red Sea, Indo-Pacific: East Africa, Seychelles, Madagascar and Mascarenes east to Line Islands and Pitcairn Group, north to southern Japan, Ogasawara Islands and Hawaiian Islands, south to Western Australia at 20°33'S, New Caledonia, Lord Howe Island, Ton
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Physical Description

Morphology

Dorsal spines (total): 11; Dorsal soft rays (total): 11 - 13; Analspines: 4; Analsoft rays: 7 - 8
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Size

Maximum size: 320 mm ---
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Max. size

32.0 cm TL (male/unsexed; (Ref. 9710))
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Diagnostic Description

Pinkish silvery above, silvery below; a dark red to black spot on each scale. Reddish stripe along LL (Ref. 4201). Outer margin of caudal lobes and anterior soft rays of dorsal and anal fins reddish; pectoral fins pale pink, pelvic fins white (Ref. 4201).
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Description

This schooling species inhabits seagrass beds and hard-bottomed habitats from the reef flat to depths of 46 m or more on lagoon and seaward reefs. Feeds on small crabs and shrimps during the night. Venomous spine at the corner of its preopercle. Marketed fresh (Ref. 9948).
Creative Commons Attribution 3.0 (CC BY 3.0)

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Ecology

Habitat

Environment

reef-associated; marine; depth range 0 - 46 m (Ref. 9710)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

nektonic
Creative Commons Attribution 3.0 (CC BY 3.0)

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

This schooling species inhabits seagrass beds and hard-bottomed habitats from the reef flat to depths of 46 m or more on lagoon and seaward reefs. Often found with branching Acropora coral.
Creative Commons Attribution 3.0 (CC BY 3.0)

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Depth range based on 166 specimens in 1 taxon.
Water temperature and chemistry ranges based on 138 samples.

Environmental ranges
  Depth range (m): 0.305 - 41
  Temperature range (°C): 22.368 - 29.336
  Nitrate (umol/L): 0.019 - 2.714
  Salinity (PPS): 32.200 - 36.148
  Oxygen (ml/l): 4.427 - 5.079
  Phosphate (umol/l): 0.085 - 0.507
  Silicate (umol/l): 0.819 - 4.752

Graphical representation

Depth range (m): 0.305 - 41

Temperature range (°C): 22.368 - 29.336

Nitrate (umol/L): 0.019 - 2.714

Salinity (PPS): 32.200 - 36.148

Oxygen (ml/l): 4.427 - 5.079

Phosphate (umol/l): 0.085 - 0.507

Silicate (umol/l): 0.819 - 4.752
 
Note: this information has not been validated. Check this *note*. Your feedback is most welcome.
Public Domain

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Depth: 0 - 46m.
Recorded at 46 meters.

Habitat: reef-associated. Spotfin squirrelfish.  (Forsskal, 1775)  Attains 30 cm. Tropical Indo-Pacific from the Red Sea to Hawaii and the Pitcairn Group, Australia and Japan; south to Durban. In "Red Sea Reef Fishes" Randall uses synonym Flamneo sammara.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Trophic Strategy

Less secretive than most other species of squirrelfish. During the day, it hovers in small groups in the vicinity of branching corals, rocks, or ledges to feed primarily on isopods; at night it feeds on benthic crustaceans. This schooling species inhabits seagrass beds and hard-bottomed habitats from the reef flat to depths of 46 m or more on lagoon and seaward reefs. Often found with branching Acropora coral (Ref. 9710). Most common Neophion found in shallow areas (Ref. 9710). Feeds on small fishes (Ref. 30573), small crabs, and shrimps at night. Also Ref. 58534.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Diseases and Parasites

Hexangium Infestation. Parasitic infestations (protozoa, worms, etc.)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Neoniphon sammara

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 10 barcode sequences available from BOLD and GenBank.  Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

CACCCTTTATTTAGTATTCGGTGCGTGAGCTGGAATAGTTGGCACAGCCCTTAGCCTTCTTATTCGAGCTGAACTAAGCCAGCCCGGAGCCCTTCTGGGGGACGACCAGATTTATAATGTTATTGTTACAGCACACGCATTTGTAATAATTTTCTTTATAGTAATACCAATTATAATTGGAGGCTTCGGGAACTGACTAATCCCTCTAATAATTGGAGCTCCCGATATAGCATTCCCACGAATAAATAACATAAGCTTCTGACTACTTCCCCCTTCATTCCTCCTTCTACTAGCCTCCTCAGGAGTAGAAGCTGGTGCTGGGACAGGATGAACAGTATACCCGCCTCTTGCAGGAAACTTAGCACACGCAGGAGCCTCTGTAGATCTAACTATTTTCTCACTTCACTTAGCAGGTATTTCCTCAATTCTAGGAGCAATCAACTTTATTACAACTATTATTAACATAAAACCCCCTGCCATTTCTCAATATCAAACACCACTGTTTGTATGAGCTGTCCTAATTACAGCCGTCCTCCTTCTTCTTTCCCTCCCTGTCTTAGCAGCTGGCATCACTATGCTACTCACAGACCGAAATCTAAACACAACATTCTTTGATCCAGCAGGTGGTGGAGACCCTATTCTTTACCAACATTT
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Statistics of barcoding coverage: Neoniphon sammara

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 10
Specimens with Barcodes: 40
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Genomic DNA is available from 5 specimens with morphological vouchers housed at British Antarctic Survey
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© Ocean Genome Legacy

Source: Ocean Genome Resource

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Conservation

Threats

Not Evaluated
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Relevance to Humans and Ecosystems

Benefits

Importance

fisheries: minor commercial; aquarium: commercial; bait: usually; price category: medium; price reliability: very questionable: based on ex-vessel price for species in this family
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!