Overview
Comprehensive Description
Biology
This schooling species inhabits seagrass beds and hard-bottomed habitats from the reef flat to depths of 46 m or more on lagoon and seaward reefs. Often found with branching Acropora coral (Ref. 9710). Most common Neophion found in shallow areas (Ref. 9710). Benthopelagic (Ref. 58302). Feeds on small fishes (Ref. 30573), small crabs, and shrimps at night. Venomous spine at the corner of its preopercle. Marketed fresh (Ref. 9948).
-
Randall, J.E. and P.C. Heemstra 1986 Holocentridae. p. 415-427. In M.M. Smith and P.C. Heemstra (eds.) Smiths' sea fishes. Springer-Verlag, Berlin. (Ref. 4201)
http://www.fishbase.org/references/FBRefSummary.php?id=4201&speccode=4910
Trusted
Distribution
Indo-Pacific: Red Sea and East Africa to the Marquesan and Ducie islands, north to southern Japan, the Ogasawara and Hawaiian islands, south to northern Australia and Lord Howe Island.
-
Fricke, R. 1999 Fishes of the Mascarene Islands (Réunion, Mauritius, Rodriguez): an annotated checklist, with descriptions of new species. Koeltz Scientific Books, Koenigstein, Theses Zoologicae, Vol. 31:759 p. (Ref. 33390)
http://www.fishbase.org/references/FBRefSummary.php?id=33390&speccode=10
Trusted
Indo-Pacific: Red Sea and East Africa to the Marquesan and Ducie islands, north to southern Japan and the Ogasawara and Hawaiian islands, northern Australia and Lord Howe Island. Throughout Micronesia
-
North-West Atlantic Ocean species (NWARMS)
http://www.marinespecies.org/aphia.php?p=sourcedetails&id=2901
Trusted
Cargados Carajos, Chagos, Comores, Kenya, Madagascar, Mauritius, Mozambique, North West Atlantic, Reunion, Seychelles, Somalia, South Africa (country)
-
North-West Atlantic Ocean species (NWARMS)
http://www.marinespecies.org/aphia.php?p=sourcedetails&id=2901
-
Anon. (1996). FishBase 96 [CD-ROM]. ICLARM: Los Baños, Philippines. 1 cd-rom pp.
http://www.marinespecies.org/aphia.php?p=sourcedetails&id=5909
-
Anon. (2000). FishBase 2000 [CD-ROM]. ICLARM: Los Baños, Laguna, Philippines. 4 cd-roms pp.
http://www.marinespecies.org/aphia.php?p=sourcedetails&id=6542
-
Bock, K.R. (1996). Checklist of the reef fishes of Diani and Galu, Kenya. Journal of East African natural History 85: 5-22.
http://www.marinespecies.org/aphia.php?p=sourcedetails&id=6357
-
Letourneur, Y., M. Harmelin-Vivien & R. Galzin (1993). Impact of hurricane Firinga on fish community structure on fringing reefs of Reunion Island, S.W. Indian Ocean. Environmental Biology of Fishes 37: 109-120
http://www.marinespecies.org/aphia.php?p=sourcedetails&id=6048
Trusted
Red Sea, Indo-Pacific: East Africa, Seychelles, Madagascar and Mascarenes east to Line Islands and Pitcairn Group, north to southern Japan, Ogasawara Islands and Hawaiian Islands, south to Western Australia at 20°33'S, New Caledonia, Lord Howe Island, Ton
Trusted
Physical Description
Morphology
Dorsal spines (total): 11; Dorsal soft rays (total): 11 - 13; Analspines: 4; Analsoft rays: 7 - 8
-
Randall, J.E., G.R. Allen and R.C. Steene 1990 Fishes of the Great Barrier Reef and Coral Sea. University of Hawaii Press, Honolulu, Hawaii. 506 p. (Ref. 2334)
http://www.fishbase.org/references/FBRefSummary.php?id=2334&speccode=13770
Trusted
Size
Max. size
32.0 cm TL (male/unsexed; (Ref. 9710))
-
Lieske, E. and R. Myers 1994 Collins Pocket Guide. Coral reef fishes. Indo-Pacific & Caribbean including the Red Sea. Haper Collins Publishers, 400 p. (Ref. 9710)
http://www.fishbase.org/references/FBRefSummary.php?id=9710&speccode=13770
Trusted
Diagnostic Description
Pinkish silvery above, silvery below; a dark red to black spot on each scale. Reddish stripe along LL (Ref. 4201). Outer margin of caudal lobes and anterior soft rays of dorsal and anal fins reddish; pectoral fins pale pink, pelvic fins white (Ref. 4201).
-
Randall, J.E., G.R. Allen and R.C. Steene 1990 Fishes of the Great Barrier Reef and Coral Sea. University of Hawaii Press, Honolulu, Hawaii. 506 p. (Ref. 2334)
http://www.fishbase.org/references/FBRefSummary.php?id=2334&speccode=13770
Trusted
Description
This schooling species inhabits seagrass beds and hard-bottomed habitats from the reef flat to depths of 46 m or more on lagoon and seaward reefs. Feeds on small crabs and shrimps during the night. Venomous spine at the corner of its preopercle. Marketed fresh (Ref. 9948).
-
Anon. (1996). FishBase 96 [CD-ROM]. ICLARM: Los Baños, Philippines. 1 cd-rom pp.
http://www.marinespecies.org/aphia.php?p=sourcedetails&id=5909
Trusted
Ecology
Habitat
Environment
reef-associated; marine; depth range 0 - 46 m (Ref. 9710)
-
Lieske, E. and R. Myers 1994 Collins Pocket Guide. Coral reef fishes. Indo-Pacific & Caribbean including the Red Sea. Haper Collins Publishers, 400 p. (Ref. 9710)
http://www.fishbase.org/references/FBRefSummary.php?id=9710&speccode=13770
Trusted
nektonic
-
North-West Atlantic Ocean species (NWARMS)
http://www.marinespecies.org/aphia.php?p=sourcedetails&id=2901
Trusted
This schooling species inhabits seagrass beds and hard-bottomed habitats from the reef flat to depths of 46 m or more on lagoon and seaward reefs. Often found with branching Acropora coral.
-
North-West Atlantic Ocean species (NWARMS)
http://www.marinespecies.org/aphia.php?p=sourcedetails&id=2901
Trusted
Depth range based on 166 specimens in 1 taxon.
Water temperature and chemistry ranges based on 138 samples.
Environmental ranges
Depth range (m): 0.305 - 41
Temperature range (°C): 22.368 - 29.336
Nitrate (umol/L): 0.019 - 2.714
Salinity (PPS): 32.200 - 36.148
Oxygen (ml/l): 4.427 - 5.079
Phosphate (umol/l): 0.085 - 0.507
Silicate (umol/l): 0.819 - 4.752
Graphical representation
Depth range (m): 0.305 - 41
Temperature range (°C): 22.368 - 29.336
Nitrate (umol/L): 0.019 - 2.714
Salinity (PPS): 32.200 - 36.148
Oxygen (ml/l): 4.427 - 5.079
Phosphate (umol/l): 0.085 - 0.507
Silicate (umol/l): 0.819 - 4.752
Note: this information has not been validated. Check this *note*. Your feedback is most welcome.
Water temperature and chemistry ranges based on 138 samples.
Environmental ranges
Depth range (m): 0.305 - 41
Temperature range (°C): 22.368 - 29.336
Nitrate (umol/L): 0.019 - 2.714
Salinity (PPS): 32.200 - 36.148
Oxygen (ml/l): 4.427 - 5.079
Phosphate (umol/l): 0.085 - 0.507
Silicate (umol/l): 0.819 - 4.752
Graphical representation
Depth range (m): 0.305 - 41
Temperature range (°C): 22.368 - 29.336
Nitrate (umol/L): 0.019 - 2.714
Salinity (PPS): 32.200 - 36.148
Oxygen (ml/l): 4.427 - 5.079
Phosphate (umol/l): 0.085 - 0.507
Silicate (umol/l): 0.819 - 4.752
Note: this information has not been validated. Check this *note*. Your feedback is most welcome.
Trusted
Depth: 0 - 46m.
Recorded at 46 meters.
Habitat: reef-associated. Spotfin squirrelfish. (Forsskal, 1775) Attains 30 cm. Tropical Indo-Pacific from the Red Sea to Hawaii and the Pitcairn Group, Australia and Japan; south to Durban. In "Red Sea Reef Fishes" Randall uses synonym Flamneo sammara.
Recorded at 46 meters.
Habitat: reef-associated. Spotfin squirrelfish. (Forsskal, 1775) Attains 30 cm. Tropical Indo-Pacific from the Red Sea to Hawaii and the Pitcairn Group, Australia and Japan; south to Durban. In "Red Sea Reef Fishes" Randall uses synonym Flamneo sammara.
Trusted
Trophic Strategy
Less secretive than most other species of squirrelfish. During the day, it hovers in small groups in the vicinity of branching corals, rocks, or ledges to feed primarily on isopods; at night it feeds on benthic crustaceans. This schooling species inhabits seagrass beds and hard-bottomed habitats from the reef flat to depths of 46 m or more on lagoon and seaward reefs. Often found with branching Acropora coral (Ref. 9710). Most common Neophion found in shallow areas (Ref. 9710). Feeds on small fishes (Ref. 30573), small crabs, and shrimps at night. Also Ref. 58534.
-
Myers, R.F. 1991 Micronesian reef fishes. Second Ed. Coral Graphics, Barrigada, Guam. 298 p. (Ref. 1602)
http://www.fishbase.org/references/FBRefSummary.php?id=1602&speccode=4306
Trusted
Diseases and Parasites
Hexangium Infestation. Parasitic infestations (protozoa, worms, etc.)
-
Arthur, J.R. and S. Lumanlan-Mayo 1997 Checklist of the parasites of fishes of the Philippines. FAO Fish. Tech. Pap. 369, 102 p. FAO, Rome. (Ref. 26129)
http://www.fishbase.org/references/FBRefSummary.php?id=26129&speccode=1258
Trusted
Molecular Biology and Genetics
Molecular Biology
Barcode data: Neoniphon sammara
The following is a representative barcode sequence, the centroid of all available sequences for this species.

There are 10 barcode sequences available from BOLD and GenBank. Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species. See the BOLD taxonomy browser for more complete information about this specimen and other sequences.
Download FASTA File
There are 10 barcode sequences available from BOLD and GenBank. Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species. See the BOLD taxonomy browser for more complete information about this specimen and other sequences.
CACCCTTTATTTAGTATTCGGTGCGTGAGCTGGAATAGTTGGCACAGCCCTTAGCCTTCTTATTCGAGCTGAACTAAGCCAGCCCGGAGCCCTTCTGGGGGACGACCAGATTTATAATGTTATTGTTACAGCACACGCATTTGTAATAATTTTCTTTATAGTAATACCAATTATAATTGGAGGCTTCGGGAACTGACTAATCCCTCTAATAATTGGAGCTCCCGATATAGCATTCCCACGAATAAATAACATAAGCTTCTGACTACTTCCCCCTTCATTCCTCCTTCTACTAGCCTCCTCAGGAGTAGAAGCTGGTGCTGGGACAGGATGAACAGTATACCCGCCTCTTGCAGGAAACTTAGCACACGCAGGAGCCTCTGTAGATCTAACTATTTTCTCACTTCACTTAGCAGGTATTTCCTCAATTCTAGGAGCAATCAACTTTATTACAACTATTATTAACATAAAACCCCCTGCCATTTCTCAATATCAAACACCACTGTTTGTATGAGCTGTCCTAATTACAGCCGTCCTCCTTCTTCTTTCCCTCCCTGTCTTAGCAGCTGGCATCACTATGCTACTCACAGACCGAAATCTAAACACAACATTCTTTGATCCAGCAGGTGGTGGAGACCCTATTCTTTACCAACATTT
-- end --
-- end --
Download FASTA File
Trusted
Statistics of barcoding coverage: Neoniphon sammara
Barcode of Life Data Systems (BOLDS) Stats
Public Records: 10
Specimens with Barcodes: 40
Species With Barcodes: 1
Public Records: 10
Specimens with Barcodes: 40
Species With Barcodes: 1
Trusted
Genomic DNA is available from 5 specimens with morphological vouchers housed at British Antarctic Survey
Trusted
Conservation
Threats
Not Evaluated
-
IUCN 2006 2006 IUCN red list of threatened species. www.iucnredlist.org. Downloaded July 2006.
http://www.fishbase.org/references/FBRefSummary.php?id=57073
Trusted
Relevance to Humans and Ecosystems
Benefits
Importance
fisheries: minor commercial; aquarium: commercial; bait: usually; price category: medium; price reliability: very questionable: based on ex-vessel price for species in this family
-
Randall, J.E. 1984 Holocentridae. In W. Fischer and G. Bianchi (eds.) FAO species identification sheets for fishery purposes. Western Indian Ocean fishing area 51. Vol. 2. (Ref. 3418)
http://www.fishbase.org/references/FBRefSummary.php?id=3418&speccode=26201
Trusted
Disclaimer
EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.
To request an improvement, please leave a comment on the page. Thank you!


