Overview

Comprehensive Description

Biology

A rare species that lives in outer reef areas.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Distribution

Pacific Ocean: Queensland, Australia to the Pitcairn Group.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

West Pacific.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Physical Description

Size

Maximum size: 280 mm TL
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Max. size

28.0 cm TL (male/unsexed; (Ref. 2334))
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Diagnostic Description

Caudal fin with black crescent.
  • Matsuura, K. 2001 Balistidae. Triggerfishes. p. 3911-3928. In K.E. Carpenter and V. Niem (eds.) FAO species identification guide for fishery purposes. The living marine resources of the Western Central Pacific. Vol. 6. Bony fishes part 4 (Labridae to Latimeriidae), estuarine crocodiles. FAO, Rome. (Ref. 9770)   http://www.fishbase.org/references/FBRefSummary.php?id=9770&speccode=9 External link.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Type Information

Paratype for Rhinecanthus lunula Randall & Steene
Catalog Number: USNM 220357
Collection: Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Fishes
Collector(s): J. Randall
Year Collected: 1956
Locality: Tuamotus: Takaroa. Sea Side of Atoll, SW of Pass, French Polynesia, Tuamotu Archipelago, Pacific
Depth (m): 6 to 6
  • Paratype: Randall, J. E. & Steene, R. C. 1983. Freshwater And Marine Aquarium. 6 (7): 45.
Creative Commons Attribution 3.0 (CC BY 3.0)

© Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Fishes

Source: National Museum of Natural History Collections

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Ecology

Habitat

Environment

reef-associated; marine; depth range 10 - ? m (Ref. 9710)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Depth range based on 2 specimens in 1 taxon.
Water temperature and chemistry ranges based on 2 samples.

Environmental ranges
  Depth range (m): 20 - 20
  Temperature range (°C): 28.341 - 28.341
  Nitrate (umol/L): 0.079 - 0.079
  Salinity (PPS): 35.335 - 35.335
  Oxygen (ml/l): 4.587 - 4.587
  Phosphate (umol/l): 0.231 - 0.231
  Silicate (umol/l): 1.066 - 1.066
 
Note: this information has not been validated. Check this *note*. Your feedback is most welcome.

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Rhinecanthus lunula

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 2 barcode sequences available from BOLD and GenBank.  Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

ACCCTATACCTAATTTTCGGTGCTTGAGCTGGGATAGTAGGCACAGCCTTAAGCTTACTAATCCGGGCAGAACTGAGCCAACCCGGCGCTCTCTTAGGCGATGATCAAATCTACAATGTCATCGTTACAGCACATGCTTTCGTTATAATTTTCTTTATAGTAATACCAATCATAATTGGTGGTTTCGGAAACTGGCTAATCCCACTAATGATCGGAGCCCCCGATATAGCATTCCCCCGAATGAACAACATGAGCTTCTGACTCCTGCCGCCTTCACTCCTACTACTTCTTGCCTCCTCAAGCGTAGAAGCCGGTGCTGGAACCGGATGGACAGTATATCCCCCTCTCGCAGGAAACCTGGCCCACGCGGGAGCCTCTGTTGACCTCACTATCTTTTCGCTGCACTTGGCAGGAATCTCATCAATTCTAGGGGCTATTAATTTTATTACAACAATTATTAATATGAAACCCCCTGCCATTTCCCAATATCAAACACCACTGTTCGTTTGAGCAGTCCTAATTACAGCAGTCCTTCTCCTCCTATCTCTCCCAGTCCTAGCTGCCGGGATTACAATACTACTAACTGATCGAAATTTAAACACCACATTCTTCGATCCTGCTGGAGGCGGAGATCCAATCCTTTACCAACACTTA
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Rhinecanthus lunula

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 2
Specimens with Barcodes: 2
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Conservation

Threats

Not Evaluated
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!