Overview

Comprehensive Description

Biology

A rare species that lives in outer reef areas.
  • Randall, J.E., G.R. Allen and R.C. Steene 1990 Fishes of the Great Barrier Reef and Coral Sea. University of Hawaii Press, Honolulu, Hawaii. 506 p. (Ref. 2334)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Distribution

Pacific Ocean: Queensland, Australia to the Pitcairn Group.
  • Randall, J.E., G.R. Allen and R.C. Steene 1990 Fishes of the Great Barrier Reef and Coral Sea. University of Hawaii Press, Honolulu, Hawaii. 506 p. (Ref. 2334)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

West Pacific.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Physical Description

Size

Maximum size: 280 mm TL
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Max. size

28.0 cm TL (male/unsexed; (Ref. 2334))
  • Randall, J.E., G.R. Allen and R.C. Steene 1990 Fishes of the Great Barrier Reef and Coral Sea. University of Hawaii Press, Honolulu, Hawaii. 506 p. (Ref. 2334)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Diagnostic Description

Caudal fin with black crescent.
  • Matsuura, K. 2001 Balistidae. Triggerfishes. p. 3911-3928. In K.E. Carpenter and V. Niem (eds.) FAO species identification guide for fishery purposes. The living marine resources of the Western Central Pacific. Vol. 6. Bony fishes part 4 (Labridae to Latimeriidae), estuarine crocodiles. FAO, Rome. (Ref. 9770)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Type Information

Paratype for Rhinecanthus lunula Randall & Steene
Catalog Number: USNM 220357
Collection: Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Fishes
Collector(s): J. Randall
Year Collected: 1956
Locality: Tuamotus: Takaroa. Sea Side of Atoll, SW of Pass, French Polynesia, Tuamotu Archipelago, Pacific
Depth (m): 6 to 6
  • Paratype: Randall, J. E. & Steene, R. C. 1983. Freshwater And Marine Aquarium. 6 (7): 45.
Creative Commons Attribution 3.0 (CC BY 3.0)

© Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Fishes

Source: National Museum of Natural History Collections

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Ecology

Habitat

Environment

reef-associated; marine; depth range 10 - ? m (Ref. 9710)
  • Lieske, E. and R. Myers 1994 Collins Pocket Guide. Coral reef fishes. Indo-Pacific & Caribbean including the Red Sea. Haper Collins Publishers, 400 p. (Ref. 9710)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Depth range based on 2 specimens in 1 taxon.
Water temperature and chemistry ranges based on 2 samples.

Environmental ranges
  Depth range (m): 20 - 20
  Temperature range (°C): 28.341 - 28.341
  Nitrate (umol/L): 0.079 - 0.079
  Salinity (PPS): 35.335 - 35.335
  Oxygen (ml/l): 4.587 - 4.587
  Phosphate (umol/l): 0.231 - 0.231
  Silicate (umol/l): 1.066 - 1.066
 
Note: this information has not been validated. Check this *note*. Your feedback is most welcome.

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Rhinecanthus lunula

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 2 barcode sequences available from BOLD and GenBank.

Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.

See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

ACCCTATACCTAATTTTCGGTGCTTGAGCTGGGATAGTAGGCACAGCCTTAAGCTTACTAATCCGGGCAGAACTGAGCCAACCCGGCGCTCTCTTAGGCGATGATCAAATCTACAATGTCATCGTTACAGCACATGCTTTCGTTATAATTTTCTTTATAGTAATACCAATCATAATTGGTGGTTTCGGAAACTGGCTAATCCCACTAATGATCGGAGCCCCCGATATAGCATTCCCCCGAATGAACAACATGAGCTTCTGACTCCTGCCGCCTTCACTCCTACTACTTCTTGCCTCCTCAAGCGTAGAAGCCGGTGCTGGAACCGGATGGACAGTATATCCCCCTCTCGCAGGAAACCTGGCCCACGCGGGAGCCTCTGTTGACCTCACTATCTTTTCGCTGCACTTGGCAGGAATCTCATCAATTCTAGGGGCTATTAATTTTATTACAACAATTATTAATATGAAACCCCCTGCCATTTCCCAATATCAAACACCACTGTTCGTTTGAGCAGTCCTAATTACAGCAGTCCTTCTCCTCCTATCTCTCCCAGTCCTAGCTGCCGGGATTACAATACTACTAACTGATCGAAATTTAAACACCACATTCTTCGATCCTGCTGGAGGCGGAGATCCAATCCTTTACCAACACTTA
-- end --

Download FASTA File

Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Rhinecanthus lunula

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 2
Specimens with Barcodes: 2
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Conservation

Threats

Not Evaluated
  • IUCN 2006 2006 IUCN red list of threatened species. www.iucnredlist.org. Downloaded July 2006.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!