Articles on this page are available in 1 other language: Chinese (Simplified) (4) (learn more)

Overview

Comprehensive Description

Description

  Common names: milkfish (English), chano (Espanol), sabalote (Espanol)
 
Chanos chanos (Forsskäl, 1775)

Milkfish



Elongate, moderately compressed; head pointed; eye large; mouth small, opens at front, without teeth; 1 dorsal fin, at midbody; pelvics under dorsal fin; anal fin small, well behind dorsal; large forked tail fin; scales small, smooth; lateral line present, straight, entire length of body.



Silvery; upper (inner) surfaces of pectoral and pelvic fins black.


Size: 180 cm.

Habitat: soft bottoms to the surface.

Depth: 0-15 m.

An Indo-Pacific species that extends into the eastern Pacific. Southern California to the central Gulf of California to Peru, Clipperton, Cocos, the Galapagos and Malpelo.
   
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© Shorefishes of the tropical eastern Pacific online information system. www.stri.org/sftep

Source: Shorefishes of the Tropical Eastern Pacific Online Information System

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Biology

Found in offshore marine waters and shallow coastal embayments, but also frequently enter estuaries and occasionally penetrate freshwater streams (Ref. 44894). A marine species which enters estuaries and rivers (Ref. 52331). Adults occur in small to large schools near the coasts or around islands where reefs are well developed. Eggs and larvae are pelagic up to 2-3 weeks. Older larvae migrate onshore and settle in coastal wetlands (mangroves, estuaries) during the juvenile stage, or occasionally enter freshwater lakes. Juveniles and sub-adults return to sea where they mature sexually. Spawn only in fully saline water. Larvae eat zooplankton; juveniles and adults eat cyanobacteria, soft algae, small benthic invertebrates, and even pelagic fish eggs and larvae. Larvae are collected from rivers and are grown in culture ponds into juveniles, which are marketed fresh, smoked, canned or frozen. Brood stocks can be raised and spawned in captivity to produce larvae in the hatchery (Ref. 12868). Can thrive and grow in water as hot as 32° C (Ref. 9987).
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Distribution

National Distribution

United States

Origin: Native

Regularity: Regularly occurring

Currently: Present

Confidence: Confident

Type of Residency: Year-round

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Zoogeography

See Map (including site records) of Distribution in the Tropical Eastern Pacific 
 
Global Endemism: All species, TEP non-endemic, Indo-Pacific only (Indian + Pacific Oceans), "Transpacific" (East + Central &/or West Pacific), All Pacific (West + Central + East)

Regional Endemism: All species, Eastern Pacific non-endemic, Tropical Eastern Pacific (TEP) non-endemic, Continent + Island (s), Continent, Island (s)

Residency: Resident

Climate Zone: North Temperate (Californian Province &/or Northern Gulf of California), Northern Subtropical (Cortez Province + Sinaloan Gap), Northern Tropical (Mexican Province to Nicaragua + Revillagigedos), Equatorial (Costa Rica to Ecuador + Galapagos, Clipperton, Cocos, Malpelo), South Temperate (Peruvian Province )
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© Shorefishes of the tropical eastern Pacific online information system. www.stri.org/sftep

Source: Shorefishes of the Tropical Eastern Pacific Online Information System

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Indo-Pacific: along continental shelves and around islands, where temperatures are greater than 20°C. Red Sea and South Africa to Hawaii and the Marquesas, north to Japan, south to Victoria, Australia. Eastern Pacific: San Pedro, California to the Galapagos.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Geographic Range

Milkfish are native to regions in the Indian and Pacific Oceans. Their range spans from the east coast of Africa and Madagascar to the coasts of India and Southeast Asia around Malaysia, Indonesia, New Guinea, Australia, northward to the southern tip of Japan, and eastward into the Pacific Islands.

Biogeographic Regions: indian ocean (Native ); pacific ocean (Native )

  • Bagarinao, T. 1994. Systematics, distribution, genetics and life history of milkfish, Chanos chanos. Environmental Biology of Fishes, 39: 23-41.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Red Sea, Indo-Pacific and adjacent river systems: East Africa, South Africa, Seychelles, Madagascar and Mascarenes east to Hawaiian Islands and Panama, north to southern Japan, south to Western Australia at 32°05'S, New South Wales (Australia) and Norfolk
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Depth

Depth Range (m): 0 (S) - 15 (S)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© Shorefishes of the tropical eastern Pacific online information system. www.stri.org/sftep

Source: Shorefishes of the Tropical Eastern Pacific Online Information System

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Physical Description

Morphology

Dorsal spines (total): 2; Dorsal soft rays (total): 13 - 17; Analspines: 2; Analsoft rays: 8 - 10; Vertebrae: 46
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Physical Description

Milkfish have a long, muscular, silvery body with a forked tail. The forked tail is fairly large and strong, thus making them fast and powerful swimmers of the open sea (Bagarinao 1994). Milkfish have large eyes, a pointed snout with a terminal mouth, and cycloid scales. The total length ranges from 50 cm to 180 cm (Bagarinao 1994, Gale 2003). They weigh between 4 and 14 kg (Bagarinao 1994). Milkfish have 13 to 17 rays in their dorsal fin, 6 to 8 anal rays, 15 to 17 pectoral rays, and 10 to 11 pelvic rays (Gale 2003).

There have been rare occurrences of variant forms of milkfish. One variant, found in the Philippines, has distinctly long dorsal, pelvic and anal fins, and the caudal fin is as long as the length of the body. This variant is the ‘goldfish-type’ milkfish. Another variant, seen in Hawaii, Indonesia, and Australia, is called the ‘shad-type’ milkfish because its length-to-depth ratio is 2.0 to 2.5 instead of the typical 3.5 to 4.0.

Range mass: 4 to 14 kg.

Range length: 50 to 180 cm.

Other Physical Features: ectothermic ; heterothermic ; bilateral symmetry

Sexual Dimorphism: sexes alike

  • Gale Group. 2003. Milkfish Chanos chanos. Pp. 293 in M Hutchins, D Thoney, P Loiselle, N Schlager, eds. Grizimek's Animal Life Encyclopedia, Vol. 4, 2nd Edition Edition. Farmington Hills, MI: Schlager Group, Inc..
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Size

Length max (cm): 180.0 (S)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© Shorefishes of the tropical eastern Pacific online information system. www.stri.org/sftep

Source: Shorefishes of the Tropical Eastern Pacific Online Information System

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Size

Maximum size: 1800 mm SL
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Max. size

180 cm SL (male/unsexed; (Ref. 9710)); 124 cm SL (female); max. published weight: 14.0 kg (Ref. 9814); max. reported age: 15 years (Ref. 9814)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Diagnostic Description

Description

Adults occur in small to large schools near the coasts or around islands where reefs are well developed. Eggs and larvae are pelagic up to 2-3 weeks. Older larvae migrate onshore and settle in coastal wetlands (mangroves, estuaries) during the juvenile stage, or occasionally enter freshwater lakes. Juveniles and subadults return to sea where they mature sexually. Spawns only in fully saline water. Larvae eat zooplankton; juveniles and adults eat cyanobacteria, soft algae, small benthic invertebrates, and even pelagic fish eggs and larvae. Larvae are collected from rivers and are grown in culture ponds into juveniles, which are marketed fresh, smoked, canned and frozen. Broodstocks can be raised and spawned in captivity to produce larvae in the hatchery (Ref. 9815). Can thrive and grow in water as hot as 32° C (Ref. 9987).
  • Anon. (1996). FishBase 96 [CD-ROM]. ICLARM: Los Baños, Philippines. 1 cd-rom pp.
Creative Commons Attribution 3.0 (CC BY 3.0)

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Diagnosis: body elongate and somewhat compressed; mouth small and toothless; branchiostegal rays 4; one dorsal fin; pectoral fins falcate; body olive green; flanks silvery; fins dark bordered (Ref. 55763). Superficially resembles bonefishes but by evolution more advanced by having 4 branchiostegal rays (Ref. 1602). Jaws toothless (Ref. 12693).Description: 31 caudal fin rays (Ref. 50686).
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Ecology

Habitat

Habitat Type: Marine

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Environment

benthopelagic; amphidromous (Ref. 51243); freshwater; brackish; marine; depth range 1 - 30 m (Ref. 6898)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Milkfish are usually found along the coasts of continents or islands, particularly where reefs are well developed. They also occur in large coastal lagoons. Milkfish are found in tropical waters, rarely in waters that are affected by cold ocean currents. They are found in clear, shallow, saline, and warm waters above 20°C. Adult milkfish also occur in freshwater lakes in the Philippines, Indonesia, and Madagascar. Juveniles are found in large coastal lagoons, atolls, and freshwater lakes. The depth range of the milkfish is 0 to 30 m.

Range depth: 0 to 30 m.

Habitat Regions: tropical ; saltwater or marine ; freshwater

Aquatic Biomes: reef ; lakes and ponds; coastal ; brackish water

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Depth range based on 20 specimens in 1 taxon.
Water temperature and chemistry ranges based on 8 samples.

Environmental ranges
  Depth range (m): 0.3 - 15
  Temperature range (°C): 26.270 - 29.325
  Nitrate (umol/L): 0.000 - 0.402
  Salinity (PPS): 32.182 - 35.185
  Oxygen (ml/l): 4.223 - 4.693
  Phosphate (umol/l): 0.108 - 0.279
  Silicate (umol/l): 1.005 - 6.656

Graphical representation

Depth range (m): 0.3 - 15

Temperature range (°C): 26.270 - 29.325

Nitrate (umol/L): 0.000 - 0.402

Salinity (PPS): 32.182 - 35.185

Oxygen (ml/l): 4.223 - 4.693

Phosphate (umol/l): 0.108 - 0.279

Silicate (umol/l): 1.005 - 6.656
 
Note: this information has not been validated. Check this *note*. Your feedback is most welcome.

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Depth: 10 - 13m.
From 10 to 13 meters.

Habitat: benthopelagic.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Salinity: Marine, Brackish

Inshore/Offshore: Inshore, Inshore Only

Water Column Position: Surface, Mid Water, Bottom, Bottom + water column

Habitat: Reef (rock &/or coral), Rocks, Corals, Reef and soft bottom, Reef associated (reef + edges-water column & soft bottom), Soft bottom (mud, sand,gravel, beach, estuary & mangrove), Sand & gravel, Estuary, Water column

FishBase Habitat: Bentho-Pelagic
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© Shorefishes of the tropical eastern Pacific online information system. www.stri.org/sftep

Source: Shorefishes of the Tropical Eastern Pacific Online Information System

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Migration

Non-Migrant: No. All populations of this species make significant seasonal migrations.

Locally Migrant: No. No populations of this species make local extended movements (generally less than 200 km) at particular times of the year (e.g., to breeding or wintering grounds, to hibernation sites).

Locally Migrant: No. No populations of this species make annual migrations of over 200 km.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Amphidromous. Refers to fishes that regularly migrate between freshwater and the sea (in both directions), but not for the purpose of breeding, as in anadromous and catadromous species. Sub-division of diadromous. Migrations should be cyclical and predictable and cover more than 100 km.Characteristic elements in amphidromy are: reproduction in fresh water, passage to sea by newly hatched larvae, a period of feeding and growing at sea usually a few months long, return to fresh water of well-grown juveniles, a further period of feeding and growing in fresh water, followed by reproduction there (Ref. 82692).
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Trophic Strategy

Feeds on algae as well as on zooplankton and benthic invertebrates (Ref. 11889).Temperature is the prime factor responsible for limiting the habitat of the species to tropical and subtropical regions of the Indian and the Pacific Ocean. Also, susceptibility to predation limits the distribution of the species.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Partner Web Site: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Food Habits

Milkfish feed on a variety of foods depending on the type of environment. As larvae they feed on zooplankton. As they develop into juveniles they start to feed on benthic items. The most common food items for juveniles are cynobacteria, diatoms, detritus, green algae, and invertebrates such as small crustaceans and worms. Adults feed on similar items, and on planktonic and nektonic prey such as clupeid juveniles. Adult milkfish have a well-developed epibranchial organ, which is an extension of the alimentary canal. The epibranchial organ allows milkfish to digest plant material (Gale 2003).

Animal Foods: fish; aquatic or marine worms; aquatic crustaceans; other marine invertebrates; zooplankton

Plant Foods: algae

Other Foods: detritus

Primary Diet: omnivore

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Feeding

Feeding Group: Planktivore, Omnivore, Herbivore

Diet: benthic microalgae, mobile benthic worms, mobile benthic crustacea (shrimps/crabs), zooplankton, pelagic fish eggs, pelagic fish larvae
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© Shorefishes of the tropical eastern Pacific online information system. www.stri.org/sftep

Source: Shorefishes of the Tropical Eastern Pacific Online Information System

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Associations

Ecosystem Roles

Not much is known about the effects that milkfish have on the ecosystem. They are important as both predators and prey of other fish species and of coastal planktonic communities.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Predation

Milkfish are most vulnerable to predators in the egg, larval, and fry stages. In order to minimize the impact of predation, milkfish produce large amounts of eggs in deep water (Bagarinao 1994).

Known Predators:

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Diseases and Parasites

Vibriosis Disease (general). Bacterial diseases
  • Leong, T.S. 1992 Diseases of brackishwater and marine fish cultured in some Asian countries. p. 223-236. In M. Shariff, R.P. Subasinghe and J.R. Arthur (eds.) Proceedings of the First Symposium on Diseases in Asian Aquaculture. Asian Fisheries Society, Manila, Philippines. (Ref. 48652)   http://www.fishbase.org/references/FBRefSummary.php?id=48652&speccode=80 External link.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Tripartiella Disease. Parasitic infestations (protozoa, worms, etc.)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Trichodinosis. Parasitic infestations (protozoa, worms, etc.)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Transversotrema Infestation. Parasitic infestations (protozoa, worms, etc.)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Transversotrema Infestation 3. Parasitic infestations (protozoa, worms, etc.)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Scolex Infestation (Scolex pleuronectis). Parasitic infestations (protozoa, worms, etc.)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Riboscyphidia Infestation. Parasitic infestations (protozoa, worms, etc.)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Procerovum Infestation 1. Parasitic infestations (protozoa, worms, etc.)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Posthodiplostomum Infestation. Parasitic infestations (protozoa, worms, etc.)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Nematode Infestation. Parasitic infestations (protozoa, worms, etc.)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Leptotheca Infestation. Parasitic infestations (protozoa, worms, etc.)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Isorchis Infestation. Parasitic infestations (protozoa, worms, etc.)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Ichthyoxenus Disease. Parasitic infestations (protozoa, worms, etc.)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Heterophyopsis Infestation. Parasitic infestations (protozoa, worms, etc.)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Haplorchis Infestation 1. Parasitic infestations (protozoa, worms, etc.)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Genolinea Infestation. Parasitic infestations (protozoa, worms, etc.)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Fin-rot Disease (late stage). Bacterial diseases
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Fin Rot (early stage). Bacterial diseases
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

False Fungal Infection (Apiosoma sp.). Parasitic infestations (protozoa, worms, etc.)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Cryptobia Infestation. Parasitic infestations (protozoa, worms, etc.)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Ceratomyxa Infestation. Parasitic infestations (protozoa, worms, etc.)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Cavisoma Infestation. Parasitic infestations (protozoa, worms, etc.)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Caligus Infestation 4. Parasitic infestations (protozoa, worms, etc.)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Caligus Infestation 3. Parasitic infestations (protozoa, worms, etc.)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Caligus Infestation 12. Parasitic infestations (protozoa, worms, etc.)
  • Koesharyani, I., D. Roza, K. Mahardika, F. Johnny, [N.] Zafran and K. Yuasa 2001 Manual for fish disease diagnosis: Marine fish and crustacean diseases in Indonesia. Gondol Research Station for Coastal Fisheries, Central Research Institute for Fisheries, Agency for Agricultural Research and Development and Japan International Cooperation Agency, Indonesia. 57 p. (Ref. 48690)   http://www.fishbase.org/references/FBRefSummary.php?id=48690&speccode=80 External link.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Anchor worm Disease. Parasitic infestations (protozoa, worms, etc.)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Ambiphyra Infestation. Parasitic infestations (protozoa, worms, etc.)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Alitropus Infestation. Parasitic infestations (protozoa, worms, etc.)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Acanthocephalus Infestation. Parasitic infestations (protozoa, worms, etc.)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Life History and Behavior

Behavior

Communication and Perception

Not much is known about how milkfish communicate with one another during mating or how they perceive the environment. Like all fishes, they have a well-developed sensory system, including a lateral line system and a well-developed sense of vision. Milkfish are members of the Ostariophysi, which produce and respond to an alarm substance. This alarm substance is produced when the skin of the milkfish has been injured, particularly by a predator. This alarm substance warns other fish to seek a hiding place in order to avoid the predator.

Communication Channels: chemical

Other Communication Modes: pheromones

Perception Channels: visual

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Life Cycle

Spawns in clear shallow waters above a bottom of sand or coral and at a distance of not more than 30 km from the shore. Females spawn up to 5 million eggs which hatch in about 24 hr. The larvae seek out clear coastal and estuarine waters warmer than 23°C with 10-32 salinity and abundant phytoplankton. Spawning and fertilization take place at night.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Development

Fertilized milkfish eggs can be found in the open sea of tropical waters. The eggs are spherical in shape and range from 1.1 to 1.25 mm in diameter (Bagarinao 1994). The eggs have a yellowish yolk and lack oil globules. The outer embryonic membrane seems to be granular with a distinct, segmented pattern. There is a narrow perivitelline space present in milkfish eggs (Garcia 1990). Development of the embryo takes about 20 to 35 hours in water temperatures of 26 to 32°C and of salinity 29 to 34 ppt (Bagarinao 1994).

Once the eggs hatch, the larvae are about 3.5 mm total length. At hatching, the larvae’s eyes are not pigmented and their mouth is not open (Bagarinao 1994). For about five days milkfish larvae depend solely on their yolk for nutrients (Garcia 1990).

Milkfish larvae go through a series of complex morphological, physiological, and behavioral stages, which last about 2 to 4 weeks, before becoming juveniles. Younger larvae occur in water depths of 20 to 30 m, while older larvae occur near the water’s surface. Younger larvae occur both near and far from shore. More advanced larval stages begin to migrate towards nearshore areas, and are found most frequently there (Bagarinao 1994; Garcia 1990). Milkfish larvae migrate towards shore when they are about 10 to 17 mm total length (Garcia 1990).

Once milkfish become larger than 20 mm total length they are considered juveniles. Juveniles appear to have the same characteristics and structure of adult milkfish (Garcia 1990). Juveniles enter brackish water and coastal wetland habitats where the food supply is more abundant. The kind of habitat, depth, and connection with the sea has been found to be the factors determining maximum size and duration of stay of juvenile milkfish in the nursery grounds (Bagarinao 1994).

Growth and development of milkfish is influenced by water temperature. Temperatures between 23.7 to 33°C seem to be the optimal temperatures for development of milkfish larvae. The rate of development is faster at higher temperatures. Temperatures lower than 20°C and up to 22.6°C cause young milkfish to be rather sluggish, thus making them more vulnerable to predation.

Development - Life Cycle: metamorphosis

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Life Expectancy

Lifespan/Longevity

Not much is known about natural mortality rates of adult milkfish, but the shortest recorded lifespan of milkfish is 3 years and the maximum lifespan is 15 years. Most mortality occurs at the egg and larval stages.

Range lifespan

Status: wild:
3 to 15 years.

Average lifespan

Status: captivity:
15 years.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Reproduction

Not much is known about mating systems and behaviors in milkfish.

Milkfish breed near shore in clean, clear, saline, warm, and shallow waters over sand or coral reefs. These spawning locations are as close as 6 km off shore (Bagarinao 1994) but are no more than 30 km off shore (Garcia 1994). Milkfish may spawn more than once a year and spawning usually takes place during the night. Spawning is highly seasonal and may be influenced by the lunar cycle (Bagarinao 1994). Milkfish breeding season is longer near the equator than at higher latitudes. The length of the spawning season may be influenced by surface water temperatures in certain areas (Garcia 1990).

Breeding interval: Milkfish may spawn more than once a year.

Breeding season: Spawning usually takes place at night and may be influenced by the lunar cycle. Milkfish breeding may occur throughout much of the year, depending on latitude.

Range number of offspring: 0.5 million eggs to 6 million eggs.

Range time to hatching: 20 to 35 hours.

Range age at sexual or reproductive maturity (female): 3 to 10 years.

Range age at sexual or reproductive maturity (male): 3 to 10 years.

Key Reproductive Features: iteroparous ; seasonal breeding ; gonochoric/gonochoristic/dioecious (sexes separate); sexual ; fertilization (External ); broadcast (group) spawning; oviparous

There does not appear to be any parental involvement once the eggs have been released into the water.

Parental Investment: no parental involvement; pre-fertilization (Provisioning, Protecting: Female)

  • Bagarinao, T. 1994. Systematics, distribution, genetics and life history of milkfish, Chanos chanos. Environmental Biology of Fishes, 39: 23-41.
  • Garcia, L. 1990. Fishery Biology of Milkfish (Chanos chanos Forskal). Proceedings of the Regional Workshop on Milkfish Culture Development in the South Pacific. Accessed October 10, 2005 at http://www.fao.org/docrep/field/003/AC282E/AC282E04.htm#ch3.2.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Egg Type: Pelagic, Pelagic larva
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© Shorefishes of the tropical eastern Pacific online information system. www.stri.org/sftep

Source: Shorefishes of the Tropical Eastern Pacific Online Information System

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Chanos chanos

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 17 barcode sequences available from BOLD and GenBank.

Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.

See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

ACACGCTGATTTTTCTCAACTAATCACAAAGACATTGGCACCCTGTATCTAGTATTCGGTGCCTGAGCTGGAATGGTTGGAACAGCACTAAGCCTCTTAATTCGAGCAGAGCTTAGCCAACCAGGATCTCTTCTGGGCGAT---GATCAAATCTATAACGTCATCGTCACAGCGCACGCTTTTGTAATAATCTTCTTTATAGTAATGCCTATCCTCATTGGAGGGTTCGGGAACTGACTTGTCCCACTAATGATCGGGGCCCCAGACATGGCATTCCCTCGAATGAACAACATAAGCTTCTGGCTTCTTCCACCTTCGTTCCTTCTCCTCCTAGCATCGTCTGGAGTTGAAGCCGGAGCCGGAACAGGATGAACAGTCTACCCCCCACTAGCCGGAAATCTTGCTCACGCAGGAGCCTCCGTGGACTTAACAATTTTCTCTCTTCACCTAGCAGGGGTCTCTTCAATTCTTGGAGCAATTAATTTCATTACTACTATTATTAACATGAAACCCCCAGCCATCTCCCAATATCAAACACCTCTATTTGTTTGAGCCGTTCTCGTTACAGCCGTGCTTCTCCTTCTATCTCTTCCAGTGCTAGCCGCTGGAATTACGATGCTCCTGACAGATCGAAACCTTAATACAACATTCTTCGACCCGGCTGGAGGAGGAGACCCAATTCTGTACCAACACCTGTTCTGATTCTTTGGCCACCCAGAAGTCTACATCCTTATTCTTCCAGGGTTCGGGATGATTTCACACATCGTCGCCTACTACGCCGGGAAAAAAGAACCATTCGGATACATAGGAATGGTCTGGGCCATGATGGCAATCGGCCTCCTAGGCTTCATTGTCTGAGCCCACCACATGTTCACAGTTGGGATGGACGTAGACACCCGTG
-- end --

Download FASTA File

Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Chanos chanos

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 22
Specimens with Barcodes: 34
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Genomic DNA is available from 1 specimen with morphological vouchers housed at Ocean Genome Legacy
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© Ocean Genome Legacy

Source: Ocean Genome Resource

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Conservation

Conservation Status

National NatureServe Conservation Status

United States

Rounded National Status Rank: NNR - Unranked

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

NatureServe Conservation Status

Rounded Global Status Rank: GNR - Not Yet Ranked

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Chanos chanos populations seem to be stable, this species is not listed on any conservation registry.

US Federal List: no special status

CITES: no special status

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

IUCN Red List: Not evaluated / Listed

CITES: Not listed
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© Shorefishes of the tropical eastern Pacific online information system. www.stri.org/sftep

Source: Shorefishes of the Tropical Eastern Pacific Online Information System

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Threats

Not Evaluated
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Relevance to Humans and Ecosystems

Benefits

Importance

fisheries: highly commercial; aquaculture: commercial; gamefish: yes; bait: usually; price category: unknown; price reliability:
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Economic Importance for Humans: Negative

There are no known adverse effects of Chanos chanos on humans.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Economic Importance for Humans: Positive

Milkfish are commercially raised for food in the Philippines and Indonesia (Gale 2003). More than a quarter of a million tons of milkfish are harvested every year in brackish ponds in Indonesia, Taiwan, and the Philippines. These fish contribute around 60% of the total fish production from aquaculture in Southeast Asia (Garcia 1990).

Positive Impacts: food

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Wikipedia

Milkfish

The milkfish (Chanos chanos) is the sole living species in the family Chanidae, in which about seven extinct species in five additional genera have been reported.[citation needed] The Hawaiian name for the fish is awa — not to be confused with ‘awa, the word for kava (Piper methysticum), which has an initial glottal stop. It is called bangús in the Philippines, where it is the national fish. In the Nauruan language, it is referred to as ibiya.

Description and biology[edit]

The milkfish has a generally symmetrical and streamlined appearance, with a sizable forked caudal fin. They can grow to 1.70 m (5 ft 7 in), but are most often about 1 m (39 in) in length. They have no teeth and generally feed on algae and invertebrates.

They occur in the Indian Ocean and across the Pacific Ocean, tending to school around coasts and islands with reefs. The young fry live at sea for two to three weeks and then migrate to mangrove swamps, estuaries, and sometimes lakes, and return to sea to mature sexually and reproduce.

Consumption[edit]

The milkfish is an important seafood in Southeast Asia and some Pacific Islands. Because milkfish is notorious for being much bonier than other food fish, deboned milkfish, called "boneless bangús" in the Philippines, has become popular in stores and markets.

Another popular presentation of milkfish in Indonesia is bandeng presto (ikan bandeng is the Indonesian name for milkfish) from Central Java. Bandeng presto is milkfish pressure cooked until the bones are rendered tender.

Aquaculture[edit]

History[edit]

Milkfish aquaculture first occurred around 800 years ago in the Philippines and spread in Indonesia, Taiwan, and into the Pacific.[1] Traditional milkfish aquaculture relied upon restocking ponds by collecting wild fry. This led to a wide range of variability in quality and quantity between seasons and regions.[1]

In the late 1970s, farmers first successfully spawned breeding fish. However, they were hard to obtain and produced unreliable egg viability.[2] In 1980, the first spontaneous spawning happened in sea cages. These eggs were found to be sufficient to generate a constant supply for farms.[3]

Farming methods[edit]

Fry are raised in either sea cages, large saline ponds (Philippines), or concrete tanks (Indonesia, Taiwan).[1] Milkfish reach sexual maturity at 1.5 kg (3.3 lb), which takes five years in floating sea cages, but eight to 10 years in ponds and tanks. Once they reach 6 kg (13 lb), (eight years), 3-4 million eggs are produced each breeding cycle.[1] This is mainly done using natural environmental cues. However, attempts have been made using gonadotropin-releasing hormone analogue (GnRH-A) to induce spawning.[4] Some still use the traditional wild stock method - capturing wild fry using nets.[1] Milkfish hatcheries, like most hatcheries, contain a variety of cultures, for example rotifers, green algae, and brine shrimp, as well as the target species.[1][5] They can either be intensive or semi-intensive.[1] Semi-intensive methods are more profitable at US$6.67 per thousand fry in 1998, compared with $27.40 for intensive methods.[5] However, the experience required by labour for semi-intensive hatcheries is higher than intensive.[5] Milkfish nurseries in Taiwan are highly commercial and have densities of about 2000/l.[6] Indonesia achieves similar densities, but has more backyard-type nurseries.[6] The Philippines has integrated nurseries with grow-out facilities and densities of about 1000/l.[6] The three methods of outgrowing are pond culture, pen culture, and cage culture.

  • Shallow ponds are found mainly in Indonesia and the Philippines. These are shallow (30–40 centimetres (12–16 in)), brackish ponds with benthic algae, usually used as feed.[1] They are usually excavated from nipa or mangrove areas and produce about 800 kg/ha/yr. Deep ponds (2-3 m) have more stable environments and their use began in 1970. They so far have shown less susceptibility to disease than shallow ponds.[6]
  • In 1979, pen culture was introduced in Laguna de Bay, which had high primary production.[6] This provided an excellent food source. Once this ran out, fertilizer was applied.[6] They are susceptible to disease.
  • Cage culture occurs in coastal bays.[1] These consist of large cages suspended in open water. They rely largely upon natural sources of food.[1]

Most food is natural (known as lab-lab) or a combination of phytoplankton and macroalgae.[1][7] Traditionally, this was made on site; food is now made commercially to order.[1] Harvest occurs when the individuals are 20 - 40 cm long (250 -500 g in weight). Partial harvests remove uniformly sized individuals with seine nets or gill nets. Total harvest removes all individuals and leads to a variety of sizes. Forced harvest happens when an environmental problem occurs, such as depleted oxygen due to algal blooms, and all stock is removed. Possible parasites include nematodes, copepods, protozoa, and helminths.[1] Many of these are treatable with chemicals and antibiotics.

Processing and marketing[edit]

Milkfish processing takes two forms. Traditional ways include smoking, drying, and fermenting. Bottling, canning, and freezing are of recent origin.[1] Demand has been steadily increasing since 1950.[1] In 2005, 595,000 tonnes were harvested worth US$616 million.[1]

A trend toward value-added products is occurring.[1] In recent years, the possibility of using milkfish juveniles as bait for tuna long-lining has started to be investigated, opening up new markets for fry hatcheries.[8]

Golden bangus[edit]

On April 21, 2012, a Filipino fisherman donated a milkfish with yellowish coloring to the Philippine Bureau of Fisheries and Aquatic Resources, which was later on called the "golden bangus".[9] However, the fish soon died, allegedly because of a lower level of oxygen in the pond to which it was transferred.[10]

See also[edit]

Notes[edit]

References[edit]

Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

Source: Wikipedia

Unreviewed

Article rating from 0 people

Default rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!