Overview

Comprehensive Description

Biology

Inhabits seagrass beds in bays and estuaries, but also enters fresh water (Ref. 7251). Resident in estuaries during spring through fall, migrates into near shore continental shelf waters during winter. Found in waters of 4-17 °C. Ovoviviparous (Ref. 205). The male carries the eggs in a brood pouch which is found under the tail (Ref. 205).
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Distribution

occurs (regularly, as a native taxon) in multiple nations

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

National Distribution

Canada

Origin: Native

Regularity: Regularly occurring

Currently: Present

Confidence: Confident

Type of Residency: Year-round

United States

Origin: Native

Regularity: Regularly occurring

Currently: Present

Confidence: Confident

Type of Residency: Year-round

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Gulf of St. Lawrence to northeastern Florida
  • North-West Atlantic Ocean species (NWARMS)
Creative Commons Attribution 3.0 (CC BY 3.0)

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Western Atlantic: Gulf of St. Lawrence in Canada to northeastern Florida in USA; also in northwestern Gulf of Mexico.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Western North Atlantic: Florida to Canada.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Physical Description

Size

Maximum size: 330 mm TL
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Max. size

33.0 cm TL (male/unsexed; (Ref. 6330))
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Ecology

Habitat

Habitat Type: Marine

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

benthic
  • North-West Atlantic Ocean species (NWARMS)
Creative Commons Attribution 3.0 (CC BY 3.0)

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Found in sea grass beds in bays and estuaries at depths of 5- 366 m.
  • North-West Atlantic Ocean species (NWARMS)
Creative Commons Attribution 3.0 (CC BY 3.0)

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Environment

demersal; amphidromous; freshwater; brackish; marine; depth range 5 - 366 m
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Depth range based on 611 specimens in 1 taxon.
Water temperature and chemistry ranges based on 328 samples.

Environmental ranges
  Depth range (m): 0 - 294
  Temperature range (°C): 4.667 - 23.660
  Nitrate (umol/L): 0.325 - 21.663
  Salinity (PPS): 32.397 - 36.472
  Oxygen (ml/l): 3.782 - 6.835
  Phosphate (umol/l): 0.110 - 1.405
  Silicate (umol/l): 0.756 - 13.305

Graphical representation

Depth range (m): 0 - 294

Temperature range (°C): 4.667 - 23.660

Nitrate (umol/L): 0.325 - 21.663

Salinity (PPS): 32.397 - 36.472

Oxygen (ml/l): 3.782 - 6.835

Phosphate (umol/l): 0.110 - 1.405

Silicate (umol/l): 0.756 - 13.305
 
Note: this information has not been validated. Check this *note*. Your feedback is most welcome.

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Depth: 5 - 366m.
From 5 to 366 meters.

Habitat: demersal. Inhabits seagrass beds in bays and estuaries, but also enters fresh water (Ref. 7251). Resident in estuaries during spring through fall, migrates into nearshore continental shelf waters during winter. Found in waters of 4 - 17 °C.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Migration

Non-Migrant: No. All populations of this species make significant seasonal migrations.

Locally Migrant: No. No populations of this species make local extended movements (generally less than 200 km) at particular times of the year (e.g., to breeding or wintering grounds, to hibernation sites).

Locally Migrant: No. No populations of this species make annual migrations of over 200 km.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Amphidromous. Refers to fishes that regularly migrate between freshwater and the sea (in both directions), but not for the purpose of breeding, as in anadromous and catadromous species. Sub-division of diadromous. Migrations should be cyclical and predictable and cover more than 100 km.Characteristic elements in amphidromy are: reproduction in fresh water, passage to sea by newly hatched larvae, a period of feeding and growing at sea usually a few months long, return to fresh water of well-grown juveniles, a further period of feeding and growing in fresh water, followed by reproduction there (Ref. 82692).
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Trophic Strategy

Lives in relatively shallow water. Diurnal predator (Ref. 42026). Feeds on minute organisms, copepods, amphipods, fish eggs and larvae. Parasites of the species include a cestode, Rhynchobothrium heterospine and 2 digenetic trematodes, Cymbephallus vitellosus and Opecoeloides manteri (Ref. 5951).
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Life History and Behavior

Behavior

Diet

Feed on copepods, amphipods, fish eggs and larvae
  • North-West Atlantic Ocean species (NWARMS)
Creative Commons Attribution 3.0 (CC BY 3.0)

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Life Cycle

Male carries the eggs in a brood pouch (Ref. 205).
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Syngnathus fuscus

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There is 1 barcode sequence available from BOLD and GenBank.   Below is the sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen.  Other sequences that do not yet meet barcode criteria may also be available.

CACCCTATATCTAGTATTTGGTGCATGAGCCGGAATAGTAGGTACTGCACTTAGTCTCCTCATTCGAGCGGAACTTAGTCAACCGGGGGCCCTCCTAGGCGACGACCAGATTTACAATGTAATCGTTACGGCCCATGCTTTCGTTATAATTTTCTTCATAGTTATACCCATCATAATTGGGGGTTTTGGTAACTGGTTAGTGCCTTTAATAATTGGAGCCCCAGATATAGCATTCCCTCGAATAAATAATATGAGCTTCTGACTACTACCCCCCTCCTTTCTGCTTCTACTTGCCTCTTCAGGAGTGGAAGCAGGCGCGGGTACAGGGTGAACTGTCTACCCCCCGCTCTCAGGTAATTTAGCCCATCAAGGAGCTTCTGTAGACCTTACAATTTTCTCTTTGCACCTAGCGGGGGTATCCTCGATCCTCGGAGCTATCAACTTCATCACCACTATTATTAATATAAAACCCCCTTCAATCTCTCAATACCAGACACCCTTATTTGTTTGGGCTGTTCTCATCACTGCCGTTCTGCTTCTTCTCTCCCTGCCTGTCCTAGCAGCTGGTATTACTATGTTATTAACTGACCGTAATTTAAACACAACTTTCTTTGACCCCGCAGGAGGGGGGGACCCTATTCTCTACCAACAT
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Statistics of barcoding coverage: Syngnathus fuscus

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 1
Specimens with Barcodes: 8
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Conservation

Conservation Status

National NatureServe Conservation Status

Canada

Rounded National Status Rank: N5 - Secure

United States

Rounded National Status Rank: NNR - Unranked

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

NatureServe Conservation Status

Rounded Global Status Rank: G5 - Secure

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Threats

Not Evaluated
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Wikipedia

Northern pipefish

Northern pipefish (Syngnathus fuscus) is a species of the pipefishes, which widespread in the north-western Atlantic from the Gulf of Saint Lawrence in Canada to north-eastern Florida in USA and north-western Gulf of Mexico. Marine \ freshwater demersal amphidromous fish, up to 30.0 cm length. Found on the depth <2–366 m.

Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

Source: Wikipedia

Unreviewed

Article rating from 0 people

Average rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!