Overview

Comprehensive Description

Biology

Found in kelp beds, rarely in bays (Ref. 2850). Ovoviviparous (Ref. 205). The male carries the eggs in a brood pouch which is found under the tail (Ref. 205).
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Distribution

Eastern Pacific: Bodega Bay in northern California, USA to southern Baja California, Mexico.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Eastern Pacific: California.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Physical Description

Size

Maximum size: 500 mm TL
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Max. size

50.0 cm TL (male/unsexed; (Ref. 2850))
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Ecology

Habitat

Environment

demersal; marine; depth range ? - 15 m (Ref. 2850)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Depth range based on 2 specimens in 1 taxon.
Water temperature and chemistry ranges based on 1 sample.

Environmental ranges
  Depth range (m): 1 - 492
  Temperature range (°C): 6.140 - 6.140
  Nitrate (umol/L): 39.811 - 39.811
  Salinity (PPS): 34.301 - 34.301
  Oxygen (ml/l): 0.321 - 0.321
  Phosphate (umol/l): 3.216 - 3.216
  Silicate (umol/l): 81.249 - 81.249

Graphical representation

Depth range (m): 1 - 492
 
Note: this information has not been validated. Check this *note*. Your feedback is most welcome.

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Depth: 0 - 15m.
Recorded at 15 meters.

Habitat: demersal. Found in kelp beds. Rarely occurs in bays.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Trophic Strategy

Feeds by sucking the food items into the mouth from a distance of 2.5 cm or more. This takes place so rapidly that it is nearly impossible for the human eye to follow the action (Ref. 4930).
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Life History and Behavior

Life Cycle

Male carries the eggs in a brood pouch (Ref. 205).
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Syngnathus californiensis

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 2 barcode sequences available from BOLD and GenBank.  Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

CCTATATCTAGTATTTGGTGCATGAGCCGGAATGGTGGGTACTGCACTTAGCCTTCTCATCCGAGCAGAACTAAGTCAACCAGGAGCCCTTTTGGGTGACGACCAAATTTATAATGTAATCGTTACAGCCCATGCTTTTGTTATAATCTTCTTTATAGTTATACCAATTATAATTGGTGGTTTCGGTAATTGACTGATCCCTTTAATAATTGGAGCTCCAGATATAGCATTTCCCCGGATAAATAACATAAGTTTTTGACTTCTTCCACCATCTTTCCTTCTCCTTCTCGCCTCATCAGGAGTAGAAGCAGGGGCAGGAACAGGATGAACCGTATATCCCCCTCTTTCAGGGAATTTAGCACATCAAGGAGCCTCCGTAGATCTGACTATTTTCTCCCTACATTTAGCAGGCGTATCCTCAATTTTAGGGGCTATTAACTTCATCACTACTATTATTAACATAAAACCTCCCTCAATCTCTCAATACCAGACGCCCTTATTTGTTTGAGCCGTACTAATTACTGCTGTATTACTTCTTCTATCTTTACCCGTTTTAGCAGCCGGTATCACTATGCTTTTAACTGACCGAAATTTAAACACAACTTTTTTTGATCCAGCAGGAGGGGGAGATCCTATCCTTTATCAACACCTG
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Statistics of barcoding coverage: Syngnathus californiensis

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 2
Specimens with Barcodes: 2
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Conservation

Threats

Not Evaluated
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Wikipedia

Kelp pipefish

Kelp pipefish, Syngnathus californiensis, is a species of the pipefishes. Habits the Eastern Pacific from the Bodega Bay in northern California, USA, to southern Baja California, Mexico. Marine subtropical demersal fish, up to 50.0 cm length.

Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

Source: Wikipedia

Unreviewed

Article rating from 0 people

Average rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!