Overview

Comprehensive Description

Biology

Oviparous. Distinct pairing with embrace. Young may tend to follow large objects, such as their mother (Ref. 205). Eggs are oblong capsules with stiff pointed horns at the corners deposited in sandy or muddy flats (Ref. 205). Egg capsules are 12.4-15.0 cm long and 8.7-9.0 cm wide (Ref. 41249, 41253). Depth range given by H. Ishihara (pers.comm. 07/07). Reported to feed primarily on amphipods, decapods, fishes, euphausids, and squid on Yamato Bank in the Sea of Japan. Maximum length reported 116 cm TL (Ref, 89865).
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Distribution

Range Description

Northwest Pacific: occurs from the northern part of the Sea of Japan to the western Bering Sea, through the Sea of Okhotsk. In Japanese waters of the Sea of Japan it is distributed south to Oki Island and in Russian waters from Peter Great Bay to Tatarsky Strait. Records of this species from the Pacific coast of Hokkaido (Nagasawa and Torisawa 1991) require confirmation (Ishihara pers. obs. 2004).

The geographic range of the Gloden Skate requires further study, its taxonomy remains uncertain and it has been misidentified with Alaska Skate (Bathyraja parmifera). This skate has not been listed among species found in Russian waters (Sokolovskaya et al. 1998, Parin 2001). However, according to Ishihara (1990) and Novikov et al. (2002) Golden Skate occurs in the northwest Pacific from the northern part of the Sea of Japan to the western Bering Sea, through the Sea of Okhotsk. In Japanese waters of the Sea of Japan it is distributed south to Oki Island and in Russian waters from Peter Great Bay to Tatarsky Strait. Records of this species from the Pacific coast of Hokkaido (Nagasawa and Torisawa 1991) require confirmation (Ishihara pers. obs. 2004).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

North Pacific: Sea of Okhotsk, Kuril Islands, and the Sea of Japan.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Physical Description

Size

Max. size

102 cm TL (male/unsexed; (Ref. 89865))
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Diagnostic Description

This species is distinguished from all other members of Arctoraja by the absence of a complete row of middorsal thorns and with the ridge of clasper poorly developed (vs. strongly developed). It is further distinguished from B. parmifera which occasionally lacks middorsal thorns by having a narrow interdorsal space 0.1-1.4% TL (vs. 1.0-3.9% TL), distal projection of the ventral marginal projects directly distally (vs. distolaterally), ventral terminal lanceolate (vs. tear-drop shaped), dorsal and ventral marginals extending farther distally to distal tip of dorsal terminal 3 (vs. extending to about a quarter the length of dorsal terminal 2); from B. panthera by its narrower interdorsal length (vs. 1.4-3.1% TL), anterior portion of body shorter and narrower (vs. longer and wider), tail shorter (vs. longer), single cranial fontanelle (vs. separate anterior and posterior fontanelles), ventral terminal lanceolate (vs. tear-drop shaped), dorsal and ventral marginals extending farther distally to distal tip of dorsal terminal 3 (vs. extending to about a quarter the length of dorsal terminal 2); from B. simoterus by having fewer vertebrae 118-127 (vs. 131), fewer precaudal vertebrae 31-38 (vs. 41), larger mouth size 8.3-11.6% TL (vs. 8.1-9.1% TL), neurocranium with 1 fontanelle (vs. 2), internal carotid foramina close together in a single pit (vs. widely separated), scapulocoracoid with 5 foramina, anterior- and posteriormost larger than 3 intermediates (vs. 3 foramina, more posterior each slightly smaller), and pelvic girdle with 2 obturator foramina close together (vs. widely spaced) (Ref. 89865).
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Ecology

Habitat

Habitat and Ecology

Habitat and Ecology
This species occurs at depths of 100–1,125 m (Ishihara 1990). This species is born at around 22 cm total length (TL) (Ishihara 1990) and is thought to reach a maximum size of 116 cm TL (Ishiyama 1958). Estimates for size at maturity have been made at 100 and 92 cm TL for males and females respectively (Ishihara 1990). Very little information on species ecology and biology is available. In Japanese waters this species preys mostly upon crustaceans (shrimps and crabs), octopus and fish (Japanese sardine, Pacific saury, Japanese horse mackerel, and rockfish) (Ishihara 1990).

Systems
  • Marine
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Environment

demersal; marine; depth range 100 - 1000 m
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Depth range based on 4 specimens in 1 taxon.
Water temperature and chemistry ranges based on 2 samples.

Environmental ranges
  Depth range (m): 75 - 891
  Temperature range (°C): 0.014 - 0.392
  Nitrate (umol/L): 20.961 - 24.481
  Salinity (PPS): 32.338 - 34.074
  Oxygen (ml/l): 4.808 - 6.791
  Phosphate (umol/l): 1.772 - 2.292
  Silicate (umol/l): 37.252 - 48.826

Graphical representation

Depth range (m): 75 - 891

Temperature range (°C): 0.014 - 0.392

Nitrate (umol/L): 20.961 - 24.481

Salinity (PPS): 32.338 - 34.074

Oxygen (ml/l): 4.808 - 6.791

Phosphate (umol/l): 1.772 - 2.292

Silicate (umol/l): 37.252 - 48.826
 
Note: this information has not been validated. Check this *note*. Your feedback is most welcome.

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Life History and Behavior

Life Cycle

Oviparous, paired eggs are laid. Embryos feed solely on yolk (Ref. 50449). Distinct pairing with embrace. Young may tend to follow large objects, such as their mother (Ref. 205). Eggs have horn-like projections on the shell (Ref. 205).
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Bathyraja smirnovi

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There is 1 barcode sequence available from BOLD and GenBank.   Below is the sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen.  Other sequences that do not yet meet barcode criteria may also be available.

CTGATCCGAGCTGAATTAAGCCAACCTGGAACCCTTTTAGGTGAT---GATCAAATCTATAATGTTATTGTTACAGCCCATGCCTTTGTAATAATCTTCTTTATGGTTATACCAATCATAATTGGAGGTTTTGGTAATTGACTTGTCCCTTTAATGATTGGTTCTCCAGACATAGCTTTTCCACGCATAAATAATATGAGCTTCTGACTTCTGCCTCCATCTTTTCTTCTGCTTCTAGCTTCTGCCGGTGTTGAAGCCGGAGCAGGAACTGGCTGAACTGTTTATCCTCCACTAGCAGGAAATCTTGCCCATGCAGGAGCTTCCGTTGATTTAACAATTTTCTCTCTTCACTTAGCCGGAATCTCATCTATCTTAGCATCAATTAATTTCATTACTACTATTATTAATATAAAGCCACCAGCAATTTCACAATACCAAACACCTTTATTTGTCTGATCAGTTCTTGTTACAACTGTACTACTTCTTTTAGCTCTTCCAGTT
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Statistics of barcoding coverage: Bathyraja smirnovi

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 1
Specimens with Barcodes: 1
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Conservation

Conservation Status

IUCN Red List Assessment


Red List Category
LC
Least Concern

Red List Criteria

Version
3.1

Year Assessed
2009

Assessor/s
Ishihara, H. & Orlov, A.M.

Reviewer/s
Valenti, S.V. & Musick, J.A. (Shark Red List Authority)

Contributor/s

Justification
The Golden Skate (Bathyraja smirnovi) is an apparently common, large (to at least 116 cm TL) species of deepwater skate, found in the Northwest Pacific from the northern part of the Sea of Japan to the western Bering Sea, through the Sea of Okhotsk. It occurs at depths of 100–1,125 m on the continental shelf and slope. It is a common utilized bycatch in bottom trawl and longline fisheries for cod, spiny dogfish and anglerfish, however, these fisheries reportedly only operate in the upper part of this species’ bathymetric distribution. No data are currently available on catch levels, but the species is assessed as Least Concern because the majority of the population is considered to have refuge beyond the range of current fisheries. Species-specific monitoring is required to determine catch levels and trends. If fisheries expand further across this species’ range, or if a target fishery was to develop, then this assessment should be revisited.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Population

Population
A common and dominant skate species in the Sea of Japan (Ishihara 1990). Also common in the Sea of Okhotsk and Bering Sea (Novikov et al. 2002). No other information on the population of this species is available. Its taxonomy remains uncertain and it has been misidentified with Alaska Skate (Bathyraja parmifera), thus populations of this species are uncertain.

Population Trend
Unknown
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Threats

Major Threats
This species is a common bycatch of bottom trawl and longline fisheries in the Sea of Japan. It is taken regularly in Japanese fisheries as bycatch of bottom trawl fisheries targeting cod, spiny dogfish and angler fish, and retained for human consumption. Although it is a common bycatch component, fisheries are reportedly only operating in the upper part of this species’ bathymetric distribution, placing the majority of the population outside the range of current fisheries (H. Ishihara and A. Orlov pers. obs. 2007).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Least Concern (LC)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Management

Conservation Actions

Conservation Actions
There are no conservation measures in place for this species. Catches and population trends need to be carefully monitored. Further research on the taxonomy of this species is also required.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!