Overview
Comprehensive Description
Biology
Adults occur in clear lagoon and seaward reefs, usually in loose aggregations near caves and ledges. Abundant over branching corals and leeward coasts (Ref. 9710). Benthopelagic (Ref. 58302). Oviparous, distinct pairing during breeding (Ref. 205). Eggs are demersal and adhere to the substrate (Ref. 205). Males guard and aerate the eggs (Ref. 205).
-
Allen, G.R. 1991 Damselfishes of the world. Mergus Publishers, Melle, Germany. 271 p. (Ref. 7247)
http://www.fishbase.org/references/FBRefSummary.php?id=7247&speccode=11793
Trusted
Distribution
Indo-Pacific: East Africa to the Hawaiian and Pitcairn islands, north to the Ogasawara Islands, south to the Great Barrier Reef and New Caledonia. Primarily around oceanic islands.
-
Randall, J.E. 2005 Reef and shore fishes of the South Pacific. New Caledonia to Tahiti and the Pitcairn Islands. University of Hawaii Press, Honolulu, Hawaii. 720 p. (Ref. 54980)
http://www.fishbase.org/references/FBRefSummary.php?id=54980&speccode=61658
Trusted
Mozambique, Seychelles
-
Anon. (1996). FishBase 96 [CD-ROM]. ICLARM: Los Baños, Philippines. 1 cd-rom pp.
http://www.marinespecies.org/aphia.php?p=sourcedetails&id=5909
-
Smith, J.L.B. (1960). Coral Fishes of the Family Pomacentridae from the Western Indian Ocean and the Red Sea. Ichthyological Bulletin No. 19: 317-349
http://www.marinespecies.org/aphia.php?p=sourcedetails&id=6186
-
Anon. (2000). FishBase 2000 [CD-ROM]. ICLARM: Los Baños, Laguna, Philippines. 4 cd-roms pp.
http://www.marinespecies.org/aphia.php?p=sourcedetails&id=6542
-
Smith, J.L.B. & M.M. Smith (1963). The fishes of Seychelles. Department of Ichthyology, Rhodes University. Grahamstown.
http://www.marinespecies.org/aphia.php?p=sourcedetails&id=5926
Trusted
Indo-West Pacific: East Africa, Aldabra and Réunion (western Mascarenes) east to Wake Atoll and Pitcairn Group, north to Ogasawara Islands, south to Elizabeth Reef, New Caledonia, Tonga and Rapa.
Trusted
Physical Description
Morphology
Dorsal spines (total): 12; Dorsal soft rays (total): 12 - 14; Analspines: 2; Analsoft rays: 12 - 14
-
Randall, J.E., G.R. Allen and R.C. Steene 1990 Fishes of the Great Barrier Reef and Coral Sea. University of Hawaii Press, Honolulu, Hawaii. 506 p. (Ref. 2334)
http://www.fishbase.org/references/FBRefSummary.php?id=2334&speccode=13770
Trusted
Size
Max. size
7.5 cm SL (male/unsexed; (Ref. 7247))
-
Allen, G.R. 1991 Damselfishes of the world. Mergus Publishers, Melle, Germany. 271 p. (Ref. 7247)
http://www.fishbase.org/references/FBRefSummary.php?id=7247&speccode=11793
Trusted
Diagnostic Description
Fish is rich golden brown, shading to purplish pink on lower head and chest. This species is distinguished from other similar Chromis by the large dark spot at the pectoral fin base.
-
Randall, J.E., G.R. Allen and R.C. Steene 1990 Fishes of the Great Barrier Reef and Coral Sea. University of Hawaii Press, Honolulu, Hawaii. 506 p. (Ref. 2334)
http://www.fishbase.org/references/FBRefSummary.php?id=2334&speccode=13770
Trusted
Description
Occurs in clear lagoon and seaward reefs, usually in loose aggregations near caves and ledges.
-
Smith, J.L.B. (1960). Coral Fishes of the Family Pomacentridae from the Western Indian Ocean and the Red Sea. Ichthyological Bulletin No. 19: 317-349
http://www.marinespecies.org/aphia.php?p=sourcedetails&id=6186
Trusted
Ecology
Habitat
Environment
reef-associated; non-migratory; marine; depth range 3 - 65 m (Ref. 1602)
-
Myers, R.F. 1991 Micronesian reef fishes. Second Ed. Coral Graphics, Barrigada, Guam. 298 p. (Ref. 1602)
http://www.fishbase.org/references/FBRefSummary.php?id=1602&speccode=4306
Trusted
Depth range based on 21 specimens in 1 taxon.
Water temperature and chemistry ranges based on 12 samples.
Environmental ranges
Depth range (m): 2 - 40.5
Temperature range (°C): 25.712 - 28.764
Nitrate (umol/L): 0.040 - 0.356
Salinity (PPS): 34.209 - 35.265
Oxygen (ml/l): 4.444 - 4.802
Phosphate (umol/l): 0.103 - 0.204
Silicate (umol/l): 0.910 - 1.571
Graphical representation
Depth range (m): 2 - 40.5
Temperature range (°C): 25.712 - 28.764
Nitrate (umol/L): 0.040 - 0.356
Salinity (PPS): 34.209 - 35.265
Oxygen (ml/l): 4.444 - 4.802
Phosphate (umol/l): 0.103 - 0.204
Silicate (umol/l): 0.910 - 1.571
Note: this information has not been validated. Check this *note*. Your feedback is most welcome.
Water temperature and chemistry ranges based on 12 samples.
Environmental ranges
Depth range (m): 2 - 40.5
Temperature range (°C): 25.712 - 28.764
Nitrate (umol/L): 0.040 - 0.356
Salinity (PPS): 34.209 - 35.265
Oxygen (ml/l): 4.444 - 4.802
Phosphate (umol/l): 0.103 - 0.204
Silicate (umol/l): 0.910 - 1.571
Graphical representation
Depth range (m): 2 - 40.5
Temperature range (°C): 25.712 - 28.764
Nitrate (umol/L): 0.040 - 0.356
Salinity (PPS): 34.209 - 35.265
Oxygen (ml/l): 4.444 - 4.802
Phosphate (umol/l): 0.103 - 0.204
Silicate (umol/l): 0.910 - 1.571
Note: this information has not been validated. Check this *note*. Your feedback is most welcome.
Trusted
Depth: 3 - 65m.
From 3 to 65 meters.
Habitat: reef-associated. Occurs in clear lagoon and seaward reefs, usually in loose aggregations near caves and ledges. Abundant over branching corals and leeward coasts (Ref. 9710).
From 3 to 65 meters.
Habitat: reef-associated. Occurs in clear lagoon and seaward reefs, usually in loose aggregations near caves and ledges. Abundant over branching corals and leeward coasts (Ref. 9710).
Trusted
Trophic Strategy
Occurs inshore (Ref. 75154). Found in clear lagoon and seaward reefs, usually in loose aggregations near caves and ledges. Abundant over branching corals and leeward coasts (Ref. 9710). Feeds on plants and zooplankton (Ref. 26990).
-
Lieske, E. and R. Myers 1994 Collins Pocket Guide. Coral reef fishes. Indo-Pacific & Caribbean including the Red Sea. Haper Collins Publishers, 400 p. (Ref. 9710)
http://www.fishbase.org/references/FBRefSummary.php?id=9710&speccode=13770
Trusted
Life History and Behavior
Life Cycle
Oviparous, distinct pairing during breeding (Ref. 205). Eggs are demersal and adhere to the substrate (Ref. 205). Males guard and aerate the eggs (Ref. 205).
-
Breder, C.M. and D.E. Rosen 1966 Modes of reproduction in fishes. T.F.H. Publications, Neptune City, New Jersey. 941 p. (Ref. 205)
http://www.fishbase.org/references/FBRefSummary.php?id=205&speccode=1256
Trusted
Molecular Biology and Genetics
Molecular Biology
Barcode data: Chromis agilis
The following is a representative barcode sequence, the centroid of all available sequences for this species.

There are 3 barcode sequences available from BOLD and GenBank. Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species. See the BOLD taxonomy browser for more complete information about this specimen and other sequences.
Download FASTA File
There are 3 barcode sequences available from BOLD and GenBank. Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species. See the BOLD taxonomy browser for more complete information about this specimen and other sequences.
CACCCTATACCTAGTATTTGGTGCCTGAGCAGGTATGGTAGGCACAGCCTTAAGCCTTCTCATCCGAGCAGAACTGAGCCAACCAGGTGCTCTCCTGGGAGACGACCAGATTTATAACGTTATCGTTACGGCACACGCCTTCGTAATAATTTTCTTTATAGTAATGCCAATCATAATTGGAGGATTCGGAAACTGACTTATTCCCCTAATGATCGGAGCCCCTGACATGGCATTCCCTCGAATGAACAATATGAGCTTCTGACTATTGCCCCCTTCATTCCTCCTTCTTCTCGCCTCTTCAGGCGTTGAAGCAGGGGCAGGCACAGGGTGAACCGTTTATCCTCCCTTATCCGGAAACTTAGCCCACGCGGGAGCCTCTGTAGACTTAACTATCTTCTCCTTACACCTAGCAGGGATCTCTTCAATCCTTGGGGCAATCAATTTTATCACAACTATTATTAACATGAAGCCCCCTGCCATCTCCCAATACCAAACACCCCTATTTGTGTGGGCCGTTCTAATTACTGCTGTTCTCCTTCTCCTCTCCCTTCCAGTCTTAGCCGCTGGTATCACCATGCTCCTAACAGACCGAAATCTAAATACCACATTCTTTGACCCTGCAGGAGGGGGAGACCCAATCCTTTACCAACACTTA
-- end --
-- end --
Download FASTA File
Trusted
Statistics of barcoding coverage: Chromis agilis
Barcode of Life Data Systems (BOLDS) Stats
Public Records: 3
Specimens with Barcodes: 6
Species With Barcodes: 1
Public Records: 3
Specimens with Barcodes: 6
Species With Barcodes: 1
Trusted
Conservation
Threats
Not Evaluated
-
IUCN 2006 2006 IUCN red list of threatened species. www.iucnredlist.org. Downloaded July 2006.
http://www.fishbase.org/references/FBRefSummary.php?id=57073
Trusted
Relevance to Humans and Ecosystems
Benefits
Importance
fisheries: of no interest; aquarium: commercial
-
Miyasaka, A. 1993 A database on scientific and common names of fishes exported from Hawaii. The information was derived from the above mentioned database. A printout of the names is also available from the State of Hawaii, Department of Land and Natural Resources, 1151 Punchbowl Street, Honolulu, Hawaii. (Ref. 5358)
http://www.fishbase.org/references/FBRefSummary.php?id=5358&speccode=4306
-
Allen, G.R. 1986 Pomacentridae. p. 670-682. In M.M. Smith and P.C. Heemstra (eds.) Smiths' sea fishes. Springer-Verlag, Berlin. (Ref. 4391)
http://www.fishbase.org/references/FBRefSummary.php?id=4391&speccode=5110
Trusted
Disclaimer
EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.
To request an improvement, please leave a comment on the page. Thank you!


