Overview

Comprehensive Description

Biology

Adults occur in clear lagoon and seaward reefs, usually in loose aggregations near caves and ledges. Abundant over branching corals and leeward coasts (Ref. 9710). Benthopelagic (Ref. 58302). Oviparous, distinct pairing during breeding (Ref. 205). Eggs are demersal and adhere to the substrate (Ref. 205). Males guard and aerate the eggs (Ref. 205).
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Distribution

Indo-Pacific: East Africa to the Hawaiian and Pitcairn islands, north to the Ogasawara Islands, south to the Great Barrier Reef and New Caledonia. Primarily around oceanic islands.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Mozambique, Seychelles
Creative Commons Attribution 3.0 (CC BY 3.0)

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Indo-West Pacific: East Africa, Aldabra and Réunion (western Mascarenes) east to Wake Atoll and Pitcairn Group, north to Ogasawara Islands, south to Elizabeth Reef, New Caledonia, Tonga and Rapa.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Physical Description

Morphology

Dorsal spines (total): 12; Dorsal soft rays (total): 12 - 14; Analspines: 2; Analsoft rays: 12 - 14
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Size

Maximum size: 75 mm SL
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Max. size

7.5 cm SL (male/unsexed; (Ref. 7247))
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Diagnostic Description

Fish is rich golden brown, shading to purplish pink on lower head and chest. This species is distinguished from other similar Chromis by the large dark spot at the pectoral fin base.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Description

Occurs in clear lagoon and seaward reefs, usually in loose aggregations near caves and ledges.
Creative Commons Attribution 3.0 (CC BY 3.0)

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Ecology

Habitat

Environment

reef-associated; non-migratory; marine; depth range 3 - 65 m (Ref. 1602)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Depth range based on 21 specimens in 1 taxon.
Water temperature and chemistry ranges based on 12 samples.

Environmental ranges
  Depth range (m): 2 - 40.5
  Temperature range (°C): 25.712 - 28.764
  Nitrate (umol/L): 0.040 - 0.356
  Salinity (PPS): 34.209 - 35.265
  Oxygen (ml/l): 4.444 - 4.802
  Phosphate (umol/l): 0.103 - 0.204
  Silicate (umol/l): 0.910 - 1.571

Graphical representation

Depth range (m): 2 - 40.5

Temperature range (°C): 25.712 - 28.764

Nitrate (umol/L): 0.040 - 0.356

Salinity (PPS): 34.209 - 35.265

Oxygen (ml/l): 4.444 - 4.802

Phosphate (umol/l): 0.103 - 0.204

Silicate (umol/l): 0.910 - 1.571
 
Note: this information has not been validated. Check this *note*. Your feedback is most welcome.
Public Domain

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Depth: 3 - 65m.
From 3 to 65 meters.

Habitat: reef-associated. Occurs in clear lagoon and seaward reefs, usually in loose aggregations near caves and ledges. Abundant over branching corals and leeward coasts (Ref. 9710).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Trophic Strategy

Occurs inshore (Ref. 75154). Found in clear lagoon and seaward reefs, usually in loose aggregations near caves and ledges. Abundant over branching corals and leeward coasts (Ref. 9710). Feeds on plants and zooplankton (Ref. 26990).
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Life History and Behavior

Life Cycle

Oviparous, distinct pairing during breeding (Ref. 205). Eggs are demersal and adhere to the substrate (Ref. 205). Males guard and aerate the eggs (Ref. 205).
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Chromis agilis

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 3 barcode sequences available from BOLD and GenBank.  Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

CACCCTATACCTAGTATTTGGTGCCTGAGCAGGTATGGTAGGCACAGCCTTAAGCCTTCTCATCCGAGCAGAACTGAGCCAACCAGGTGCTCTCCTGGGAGACGACCAGATTTATAACGTTATCGTTACGGCACACGCCTTCGTAATAATTTTCTTTATAGTAATGCCAATCATAATTGGAGGATTCGGAAACTGACTTATTCCCCTAATGATCGGAGCCCCTGACATGGCATTCCCTCGAATGAACAATATGAGCTTCTGACTATTGCCCCCTTCATTCCTCCTTCTTCTCGCCTCTTCAGGCGTTGAAGCAGGGGCAGGCACAGGGTGAACCGTTTATCCTCCCTTATCCGGAAACTTAGCCCACGCGGGAGCCTCTGTAGACTTAACTATCTTCTCCTTACACCTAGCAGGGATCTCTTCAATCCTTGGGGCAATCAATTTTATCACAACTATTATTAACATGAAGCCCCCTGCCATCTCCCAATACCAAACACCCCTATTTGTGTGGGCCGTTCTAATTACTGCTGTTCTCCTTCTCCTCTCCCTTCCAGTCTTAGCCGCTGGTATCACCATGCTCCTAACAGACCGAAATCTAAATACCACATTCTTTGACCCTGCAGGAGGGGGAGACCCAATCCTTTACCAACACTTA
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Statistics of barcoding coverage: Chromis agilis

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 3
Specimens with Barcodes: 6
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Conservation

Threats

Not Evaluated
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Relevance to Humans and Ecosystems

Benefits

Importance

fisheries: of no interest; aquarium: commercial
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!