Overview

Comprehensive Description

Biology

Inhabits steep outer reef slopes, occasionally on lagoon reefs (Ref. 9710). Herbivorous (Ref. 33482). Forms harems of 2-4 individuals. Frequently exported through the aquarium trade (Ref. 48391).
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Distribution

Pacific Ocean: Taiwan to the Tuamoto Islands, north to southern Japan, south to the Great Barrier Reef.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Range Description

This species is widely distributed in the central and western Pacific where it ranges east from southern Japan and the island of Taiwan to the Tuamotu Islands (French Polynesia), and as far south as the Great Barrier Reef (Australia) (Pyle 2001, G.R. Allen pers. comm. 2006). It may be encountered at depths of between 8-45 m (Pyle 2001, G.R. Allen pers. comm. 2006).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Western Pacific.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Physical Description

Morphology

Dorsal spines (total): 15; Dorsal soft rays (total): 15; Analspines: 3; Analsoft rays: 17
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Size

Maximum size: 100 mm NG
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Max. size

10.0 cm TL (male/unsexed; (Ref. 9710))
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Diagnostic Description

Overall color is bright yellow to bright yellow orange with a dusky olive patch with yellow spots behind the eye.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Type Information

Paratype for Centropyge heraldi
Catalog Number: USNM 140094
Collection: Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Fishes
Collector(s): V. Brock, E. Herald, Donaldson, A. Welander, Potski & Bradner
Year Collected: 1946
Locality: Marshall Islands: Bikini Atoll, isolated coral area 100 yds offshore of Airukiiji (Arji) Island; Bikini Atoll, lagoon side., Bikini Atoll, Ralik Chain, Marshall Islands, Pacific
Depth (m): 12
  • Paratype:
Creative Commons Attribution 3.0 (CC BY 3.0)

© Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Fishes

Source: National Museum of Natural History Image Collection

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Type for Centropyge heraldi
Catalog Number: USNM 140093
Collection: Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Fishes
Collector(s): V. Brock, E. Herald, Donaldson, A. Welander, Potski & Bradner
Year Collected: 1946
Locality: Marshall Islands: Bikini Atoll, isolated coral area 100 yds offshore of Airukiiji (Arji) Island; Bikini Atoll, lagoon side., Bikini Atoll, Ralik Chain, Marshall Islands, Pacific
Depth (m): 12
  • Type:
Creative Commons Attribution 3.0 (CC BY 3.0)

© Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Fishes

Source: National Museum of Natural History Image Collection

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Paratype for Centropyge heraldi
Catalog Number: USNM 140095
Collection: Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Fishes
Collector(s): V. Brock & E. Herald
Year Collected: 1946
Locality: Marshall Islands: Rongelap Atoll at Tufa Island, coral heads in lagoon side of island in 28 feet of water., Rongelap Atoll, Ralik Chain, Marshall Islands, Pacific
Depth (m): 9 to 9
  • Paratype:
Creative Commons Attribution 3.0 (CC BY 3.0)

© Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Fishes

Source: National Museum of Natural History Image Collection

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Paratype for Centropyge heraldi
Catalog Number: USNM 140096
Collection: Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Fishes
Collector(s): L. Schultz & E. Herald
Year Collected: 1946
Locality: Marshall Islands: Rongelap Atoll, Kabelle Island at north end, lagoon reef., Rongelap Atoll, Ralik Chain, Marshall Islands, Pacific
Depth (m): 2
  • Paratype:
Creative Commons Attribution 3.0 (CC BY 3.0)

© Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Fishes

Source: National Museum of Natural History Image Collection

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Ecology

Habitat

Environment

reef-associated; non-migratory; marine; depth range 5 - 90 m (Ref. 33482)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Habitat and Ecology

Habitat and Ecology
This species is largely associated with outer coral reef slopes, but may also encountered on shallower lagoon reefs (Pyle 2001, G.R. Allen pers. comm. 2006). Feeds on algae; forms harems of two to four animals (Pyle 2001).

Systems
  • Marine
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Depth range based on 9 specimens in 1 taxon.
Water temperature and chemistry ranges based on 9 samples.

Environmental ranges
  Depth range (m): 1.83 - 83.22
  Temperature range (°C): 22.621 - 28.954
  Nitrate (umol/L): 0.050 - 5.586
  Salinity (PPS): 34.131 - 35.383
  Oxygen (ml/l): 4.057 - 4.747
  Phosphate (umol/l): 0.100 - 0.494
  Silicate (umol/l): 1.057 - 9.319

Graphical representation

Depth range (m): 1.83 - 83.22

Temperature range (°C): 22.621 - 28.954

Nitrate (umol/L): 0.050 - 5.586

Salinity (PPS): 34.131 - 35.383

Oxygen (ml/l): 4.057 - 4.747

Phosphate (umol/l): 0.100 - 0.494

Silicate (umol/l): 1.057 - 9.319
 
Note: this information has not been validated. Check this *note*. Your feedback is most welcome.
Public Domain

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Depth: 5 - 40m.
From 5 to 40 meters.

Habitat: reef-associated. Inhabits steep outer reef slopes, occasionally on lagoon reefs.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Trophic Strategy

Inhabits steep outer reef slopes, occasionally on lagoon reefs (Ref. 9710). Herbivorous (Ref. 33482).
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Centropyge heraldi

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 11 barcode sequences available from BOLD and GenBank.  Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

ACCCTCTACTTGCTATTTGGTGCTTGGGCTGGGATGGTAGGAACCGCTTTAAGCCTACTAATTCGAGCAGAACTTAATCAGCCAGGGAGCCTCCTAGGAGATGACCAAATTTATAATGTGATCGTAACAGCACATGCATTTGTTATAATTTTCTTTATAGTTATGCCCGCTATAATCGGGGGGTTCGGAAACTGGCTGATCCCTCTAATAATCGGAGCCCCAGATATGGCATTTCCTCGAATGAACAACATGAGCTTTTGGCTCCTCCCCCCCTCCCTTCTGCTTCTCCTCGCGTCTGCAGGGGTAGAAGCCGGGGCCGGGACTGGCTGAACAGTCTACCCCCCACTAGCCGGTAATCTTGCCCATGCGGGGGCATCCGTGGATCTGACTATTTTCTCCCTCCACCTAGCAGGGGTCTCCTCAATTTTAGGGGCTATCAACTTTATCACCACCATCATTAACATGAAACCCCCAGCTATTTCTCAATACCAGACACCACTCTTCGTCTGAGCAGTATTAATTACTGCCGTCCTCCTGCTTCTTTCCCTCCCAGTCCTTGCTGCAGGGATTACTATACTCCTAACAGACCGGAATCTGAACACCACCTTCTTCGACCCTGCAGGGGGAGGGGATCCAATCCTTTACCAACACTTA
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Statistics of barcoding coverage: Centropyge heraldi

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 11
Specimens with Barcodes: 11
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Conservation

Conservation Status

IUCN Red List Assessment


Red List Category
LC
Least Concern

Red List Criteria

Version
3.1

Year Assessed
2010

Assessor/s
Pyle, R. & Rocha, L.A.

Reviewer/s
Elfes, C., Polidoro, B., Livingstone, S. & Carpenter, K.E.

Contributor/s

Justification

Listed as Least Concern in view of its wide distribution, large overall population, collection for the aquarium fish trade is not globally impacting the population, and there are no other potential major threats.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Population

Population

It is generally common with stable populations.


Population Trend
Stable
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Threats

Least Concern (LC)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Major Threats

There appear to be no major threats to this species. Although it is sometimes collected for the aquarium trade, harvest levels are not considered to be impacting the global population. There is no substantial habitat loss in the range of this species.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Management

Conservation Actions

Conservation Actions

There appear to be no species-specific conservation measures in place. This species is present within some marine protected areas.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Relevance to Humans and Ecosystems

Benefits

Importance

aquarium: commercial
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Wikipedia

Centropyge heraldi

Centropyge heraldi is a species of Marine angelfish from the Pacific Ocean that sometimes makes its way into the aquarium trade. It grows to a size of 10cm in length.

References


Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

 

Source: Wikipedia

Unreviewed

Article rating from 0 people

Average rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!