Overview

Comprehensive Description

Biology

Inhabits muddy bottoms of inshore bays and lagoons from about 3 to at least 20 m and uses a vertical, tube-like burrow of an unidentified invertebrate for refuge (Ref. 1602). Occurs in coastal and inner reefs on sand and rubble flats to about 20 meters depth (Ref. 48637). Feeds by sifting mouthfuls of sand to capture small invertebrates and organic matter (Ref. 1602).
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Distribution

Western Central Pacific: Philippines to New Caledonia, north to Yaeyama Islands, south to the Great Barrier Reef; throughout Micronesia.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Western Pacific and southeastern Indian Ocean.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Physical Description

Morphology

Dorsal spines (total): 7; Dorsal soft rays (total): 14; Analspines: 1; Analsoft rays: 14
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Size

Maximum size: 80 mm NG
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Max. size

9.5 cm SL (male/unsexed; (Ref. 48637))
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Diagnostic Description

Characterized by pale bluish-grey body color with pair of distinct orange stripes on head; sides with four faint orange stripes and diffuse cross-bars; base of caudal fin with orange spot;; first and second dorsal fin equal in height; rounded caudal fin; longitudinal scale series 55-60; predorsal scales 23-28; scales dorsally on opercle, absent on cheek; ctenoid body scales; cycloid scales on nape, abdomen, and opercle; depth of body 4.0-4.6 in SL (Ref. 90102).
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Ecology

Habitat

Depth range based on 47 specimens in 1 taxon.
Water temperature and chemistry ranges based on 35 samples.

Environmental ranges
  Depth range (m): 0.7625 - 37
  Temperature range (°C): 23.822 - 29.336
  Nitrate (umol/L): 0.043 - 1.204
  Salinity (PPS): 32.276 - 35.037
  Oxygen (ml/l): 4.130 - 4.847
  Phosphate (umol/l): 0.108 - 0.441
  Silicate (umol/l): 0.983 - 15.721

Graphical representation

Depth range (m): 0.7625 - 37

Temperature range (°C): 23.822 - 29.336

Nitrate (umol/L): 0.043 - 1.204

Salinity (PPS): 32.276 - 35.037

Oxygen (ml/l): 4.130 - 4.847

Phosphate (umol/l): 0.108 - 0.441

Silicate (umol/l): 0.983 - 15.721
 
Note: this information has not been validated. Check this *note*. Your feedback is most welcome.
All rights reserved

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Environment

reef-associated; brackish; marine; depth range ? - 25 m (Ref. 27115), usually 3 - 25 m (Ref. 27115)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Depth range based on 47 specimens in 1 taxon.
Water temperature and chemistry ranges based on 35 samples.

Environmental ranges
  Depth range (m): 0.7625 - 37
  Temperature range (°C): 23.822 - 29.336
  Nitrate (umol/L): 0.043 - 1.204
  Salinity (PPS): 32.276 - 35.037
  Oxygen (ml/l): 4.130 - 4.847
  Phosphate (umol/l): 0.108 - 0.441
  Silicate (umol/l): 0.983 - 15.721

Graphical representation

Depth range (m): 0.7625 - 37

Temperature range (°C): 23.822 - 29.336

Nitrate (umol/L): 0.043 - 1.204

Salinity (PPS): 32.276 - 35.037

Oxygen (ml/l): 4.130 - 4.847

Phosphate (umol/l): 0.108 - 0.441

Silicate (umol/l): 0.983 - 15.721
 
Note: this information has not been validated. Check this *note*. Your feedback is most welcome.

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Trophic Strategy

Feeds on benthic invertebrates and organic matter (Ref. 1602).
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Partner Web Site: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Amblygobius decussatus

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 5 barcode sequences available from BOLD and GenBank.

Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.

See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

CCTTTACCTAGTATTTGGTGCCTGAGCCGGCATGGTAGGCACAGCACTGAGCCTCCTGATTCGAGCTGAACTCAGTCAACCCGGAGCACTACTGGGTGACGACCAAATTTACAATGTAATCGTTACCGCCCACGCATTCGTAATAATCTTCTTTATAGTAATGCCAATTATGATTGGAGGCTTCGGAAACTGACTGATTCCACTGATGATCGGCGCCCCAGACATGGCTTTCCCCCGAATAAACAACATGAGCTTTTGACTACTTCCTCCGTCTTTCCTTCTTCTGCTCGCATCCTCCGGGGTAGAAGCGGGGGCAGGTACAGGATGAACTGTTTACCCGCCCTTATCAGGCAACCTGGCCCACGCAGGGGCATCCGTTGATTTAACGATTTTCTCCCTGCACTTGGCGGGTATCTCTTCCATTCTTGGGGCCATTAATTTTATTACCACAATTCTAAATATGAAACCTCCAGCCATCTCTCAGTACCAAACACCACTGTTCGTTTGAGCAGTGCTGATCACAGCAGTTCTTCTTCTCCTGTCCCTCCCAGTTCTTGCCGCCGGGATCACAATGCTCCTCACAGATCGAAACCTAAACACTACCTTTTTTGACCCTGCCGGAGGGGGAGACCCAATTCTTTACCAGCATCTC
-- end --

Download FASTA File

Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Amblygobius decussatus

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 5
Specimens with Barcodes: 12
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Conservation

Threats

Not Evaluated
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Relevance to Humans and Ecosystems

Benefits

Importance

aquarium: commercial
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Wikipedia

Amblygobius decussatus

Amblygobius decussatus, the Orange-striped goby, is a species of goby native to tropical reefs in the western Pacific Ocean,[1] but may be widespread in the central Indo-Pacific area. It prefers living on muddy substrates where it utilizes an invertebrate burrow for shelter. It sifts through mouthfuls of sand, consuming organic matter and small invertebrates contained therein. This species can reach a length of 9.5 centimetres (3.7 in) SL.[2] It can also be found in the aquarium trade.[3]

References[edit source | edit]

Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

Source: Wikipedia

Unreviewed

Article rating from 0 people

Default rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!