Articles on this page are available in 1 other language: Chinese (Simplified) (4) (learn more)

Overview

Comprehensive Description

Biology

Apparently the most common shallow-water species of the genus found in coral reef areas, but may occur at depths greater than 30 m. Usually found in rubble areas near or within coral reefs and in symbiotic association with alpheid shrimps, most often with Alpheus ochrostriatus. Found in coastal sand slopes and deep lagoons, shallow to 40 meters depth range (Ref. 48637).
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Distribution

Red Sea, Indo-West Pacific: East Africa, South Africa, Saint Brandon's Shoals and Mascarenes east to Marshall Islands, north to southern Japan and Ogasawara Islands, south to northwestern Australia and Great Barrier Reef (Queensland, Australia).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Indo-Pacific: East Africa to Fiji, north to southern Japan, south to the Great Barrier Reef.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Physical Description

Morphology

Dorsal spines (total): 7; Dorsal soft rays (total): 12; Analspines: 1; Analsoft rays: 12
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Size

Maximum size: 80 mm NG
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Max. size

10.0 cm SL (male/unsexed; (Ref. 48637))
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Diagnostic Description

Wide bands on body; red spots on dorsal and caudal fins; broad red band along the basal part of the anal fin; reddish oblique stripe on caudal fin; pelvic fins fused and with blue spots (Ref. 2798).
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Ecology

Habitat

Environment

reef-associated; marine; depth range 5 - 40 m (Ref. 48637), usually 5 - 15 m (Ref. 27115)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Depth range based on 13 specimens in 1 taxon.
Water temperature and chemistry ranges based on 9 samples.

Environmental ranges
  Depth range (m): 0.65 - 17
  Temperature range (°C): 26.159 - 28.954
  Nitrate (umol/L): 0.068 - 0.923
  Salinity (PPS): 33.797 - 35.037
  Oxygen (ml/l): 4.443 - 4.686
  Phosphate (umol/l): 0.079 - 0.245
  Silicate (umol/l): 0.983 - 3.229

Graphical representation

Depth range (m): 0.65 - 17

Temperature range (°C): 26.159 - 28.954

Nitrate (umol/L): 0.068 - 0.923

Salinity (PPS): 33.797 - 35.037

Oxygen (ml/l): 4.443 - 4.686

Phosphate (umol/l): 0.079 - 0.245

Silicate (umol/l): 0.983 - 3.229
 
Note: this information has not been validated. Check this *note*. Your feedback is most welcome.

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Trophic Strategy

Apparently the most common shallow-water species of the genus found in coral reef areas, but may occur at depths greater than 30 m. Usually found in rubble areas near or within coral reefs and in symbiotic association with alpheid shrimps, most often with Alpheus ochrostriatus.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Statistics of barcoding coverage: Amblyeleotris wheeleri

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 6
Specimens with Barcodes: 11
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Barcode data: Amblyeleotris wheeleri

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 3 barcode sequences available from BOLD and GenBank.  Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

CCTTTACCTCGTATTTGGTGCCTGAGCCGGAATAGTGGGCACAGCACTTAGCCTGCTAATCCGGGCTGAACTCTCCCAACCCGGCGCACTACTGGGAGATGACCAAATTTACAACGTCATCGTAACTGCCCACGCATTTGTAATAATCTTCTTTATAGTAATACCAATTATGATTGGAGGATTTGGAAACTGACTAATTCCACTAATGATTGGCGCCCCCGACATGGCCTTCCCTCGAATAAACAACATGAGTTTCTGACTCCTGCCCCCTTCTTTCCTCCTACTTCTCGCCTCCTCTGGGGTCGAGGCCGGGGCAGGTACAGGTTGAACTGTCTACCCCCCACTTGCAGGCAACCTGGCACATGCAGGAGCCTCCGTAGACCTGACCATCTTCTCTCTTCACCTAGCTGGTATTTCATCAATTCTTGGGGCAATCAACTTCATTACAACCATCCTAAATATGAAACCCCCAGCCATCTCACAATACCAAACCCCACTATTCGTCTGAGCAGTACTAATCACAGCTGTACTTCTTCTCCTTTCCCTCCCCGTTCTTGCTGCTGGCATCACAATGCTTCTGACAGACCGAAACCTGAATACAACTTTCTTCGACCCCGCAGGTGGAGGAGACCCTATCCTTTATCAACACCTG
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Conservation

Threats

Not Evaluated
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Relevance to Humans and Ecosystems

Benefits

Importance

aquarium: commercial
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Wikipedia

Gorgeous prawn goby

Amblyeleotris wheeleri, the Gorgeous prawn-goby, is a species of goby native to tropical reefs of the Indian Ocean to the western Pacific Ocean. It can be found at depths of from 5 to 40 metres (16 to 130 ft) though is usually does not occur deeper than 15 metres (49 ft). It is a commensal with alpheid shrimps, most often being found in association with Alpheus ochrostriatus. This species can reach a length of 10 centimetres (3.9 in) SL. It can also be found in the aquarium trade.[1]

References[edit source | edit]

  1. ^ Froese, Rainer and Pauly, Daniel, eds. (2013). "Amblyeleotris wheeleri" in FishBase. April 2013 version.
Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

Source: Wikipedia

Unreviewed

Article rating from 0 people

Average rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!