Overview

Comprehensive Description

Silurus glanis ZBK Linnaeus, 1758

Inland water: 30900-876 (1 spc.), 05.07.1998 , Iznik Lake , M. Ôzulug , N. Meriç , Örner Altun .

  • Nurettin Meriç, Lütfiye Eryilmaz, Müfit Özulug (2007): A catalogue of the fishes held in the Istanbul University, Science Faculty, Hydrobiology Museum. Zootaxa 1472, 29-54: 37-37, URL:http://www.zoobank.org/urn:lsid:zoobank.org:pub:428F3980-C1B8-45FF-812E-0F4847AF6786
Public Domain

MagnoliaPress via Plazi

Source: Plazi.org

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Biology

Inhabits large and medium size lowland rivers, backwaters and well vegetated lakes (Ref. 59043). Occurs mainly in large lakes and rivers, though occasionally enters brackish water in the Baltic and Black Seas (Ref. 9988). Found in deep waters of dams constructed on the lower reaches of rivers (Ref. 9696). A nocturnal predator, foraging near bottom and in water column. Larvae and juveniles are benthic, feeding on a wide variety of invertebrates and fish. Adults prey on fish and other aquatic vertebrates. Attains first sexual maturity at 2-3 years of age (Ref. 59043). Spawns in the salt water of the Aral Sea (at Kulandy) (Ref. 1441). Marketed fresh, canned and frozen; can be pan-fried and baked (Ref. 9988). Locally threatened due to river regulation destroying shallow spawning sites (Ref. 59043).
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Distribution

Range Description

North, Baltic, Black, Caspian and Aral Sea basins, as far north as southern Sweden and Finland; Aegean Sea basin, in Maritza and from Stuma to Sperchios drainages; Turkey. Absent from rest of Mediterranean basin. Introduced in Rhône drainage in 1857 and in British Isles during second half of 19th century. Now widely introduced and translocated throughout Europe and Lake Balkhash basin (Kazakhstan).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Europe and Asia. North, Baltic, Black, Caspian and Aral Sea basins, as far north as southern Sweden and Finland; Aegean Sea basin in Maritza and from Struma to Sperchios drainages; Turkey. Absent from the rest of Mediterranean basin. Now widely introduced and translocated throught Europe and Lake Balkhash basin in Kazakhstan. Several countries report adverse ecological impact after introduction. In Appendix III of the Bern Convention (protected fauna).
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Geographic Range

Silurus soldatovi, sheatfish or wels catfish, is native to eastern Europe and Asia. It has been introduced to several other areas including Germany, France, Spain, England, Greece, Turkey and the Netherlands.

Biogeographic Regions: palearctic (Introduced , Native )

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Eastern Europe to central Asia; widely introduced.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Physical Description

Morphology

Dorsal spines (total): 1; Dorsal soft rays (total): 4 - 5; Analspines: 1; Analsoft rays: 83 - 95
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Physical Description

The elongated, scaleless body has a strong upper body and a laterally flattened tail. Silurus soldatovi varies in color. The upper side is usually a dark color and the flanks and belly are more pale. The fins are brownish. The body has a mottled appearance that is sometimes accompanied by brown spots. These catfish can grow to be quite large, perhaps as large as 3 meters long. A maximum reported weight was 220 kg. Most individuals reach sizes between 1.3 and 1.6 meters. Silurus soldatovi reach an average of 45 kg and has been considered one of the largest freshwater fish in its range.

Silurus soldatovi individuals have 1 dorsal spine and 4 to 5 dorsal soft rays, 1 anal spine and 90 to 94 anal soft rays, and a caudal fin with 17 rays. They have paired pectoral fins with 1 spine and 14 to 17 soft rays each. Their paired pelvic fins are positioned behind the dorsal fin with 1 spine each and 11 to 12 soft rays each.

There are several members in the family Siluridae. Silurus soldatovi is distinguished by its smaller dorsal fin, only two pairs of barbels, and the caudal fin being distinct from the anal fin.

Sex can be determined by the flap of skin behind the vent, in males it is thin and comes to a point, females have a thicker and shorter flap of skin.

Range mass: 220 (high) kg.

Average mass: 45 kg.

Range length: 3 (high) m.

Average length: 1.3-1.6 m.

Other Physical Features: ectothermic ; heterothermic ; bilateral symmetry

Sexual Dimorphism: sexes alike

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Size

Maximum size: 5000 mm TL
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Max. size

500 cm SL (male/unsexed; (Ref. 59043)); max. published weight: 306.0 kg (Ref. 9988); max. reported age: 80 years (Ref. 59043)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Diagnostic Description

Distinguished from all other freshwater fishes in Europe by the following unique characters: two pairs of mental barbels; and anal fin with 83-91½ rays. Differs further from the following combination of features: body naked; large, depressed head; dorsal fin with 2-4½ rays; caudal fin rounded or truncate; no adipose fin; and anal rays almost touching caudal (Ref. 59043). Caudal fin with 17 rays (Ref. 2196).
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Ecology

Habitat

Habitat and Ecology

Habitat and Ecology
Habitat:
Large and medium size lowland rivers, backwaters and well vegetated lakes. Spawns in shallow, warm and well vegetated riverine habitats without current.

Biology:
Lives up to 80 years in the wild. Spawns for the first time at 2-3 years and 1-2 kg. Spawns in April-June, in northern areas until August, when temperature reaches about 20°C. In spawning grounds, males defend small territories and build nests of plant material, dig shallow depressions or clean spawning substrate such as willow (Salix) roots. Nests are defended by males until larvae emerge. Spawns in pairs. During spawning act, the male embraces the female. Eggs hatch in 2-3 days and larvae remain in nest until yolk sack is absorbed (2-4 days). A nocturnal predator, feeding near bottom and in water column. Very sensitive to extra-aquatic sounds. Head sensory canal system allows to track the wakes [a trail of hydrodynamic and chemical signatures left by a swimming fish] of prey up to 10 seconds old over distances up to 55 times the length of the prey. Larvae and juveniles benthic and negatively phototactic, feeding on a wide variety of invertebrates and fish. Adults feed on fish and other aquatic vertebrates.

Systems
  • Freshwater
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Environment

benthopelagic; non-migratory; freshwater; brackish; depth range 0 - 30 m (Ref. 9988)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Silurus soldatovi is found primarily in large rivers and lakes and in deep water near dams. These catfish sometimes enter brackish water in the Black Sea and Baltic Sea.

Range depth: 0 to 30 m.

Habitat Regions: temperate ; freshwater

Aquatic Biomes: lakes and ponds; rivers and streams; brackish water

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Migration

Introduction

This species has been introduced or released in Dutch waters.
  • Nijssen, H.; de Groot, S.J. (1987). De vissen van Nederland: systematische indeling, historisch overzicht, het ontstaan van de viskweek, uitheemse vissoorten, determineersleutels, beschrijvingen, afbeeldingen, literatuur, van alle in Nederlandse wateren voor komende zee- en zoetwatervissoorten [Fishes of the Netherlands: systematic classification, historical overview, origins of fish culture, non-indigenous species, determination keys, descriptions, drawings, literature references on all marine and freshwater fish species living in Dutch waters]. KNNV Uitgeverij: Utrecht, The Netherlands. ISBN 90-5011-006-1. 224 pp.
Creative Commons Attribution 3.0 (CC BY 3.0)

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Trophic Strategy

Found in deep waters of dams constructed in the lower reaches of rivers (Ref. 9696).
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Food Habits

Silurus soldatovi fry feed on plankton during their first year of life. When they reach larger sizes they begin to eat worms, snails, crustaceans, aquatic insects, and small fish. At adult sizes they will also prey on ducks, voles, crayfish, fish, eels, frogs, rats, coypu, and snakes. They use the incredible suction created by suddenly opening their large mouths to take in prey.

Both the top and bottom jaws each have hundreds of inward sloping, soft teeth used to grip prey. There are two "crushing plates" in front of the throat cavity used to crush prey before swallowing. Silurus soldatovi manipulate their prey prior to consumption by using several short spikes along the edge of the gill rakers.

Animal Foods: birds; mammals; amphibians; reptiles; fish; carrion ; insects; mollusks; terrestrial worms; aquatic crustaceans; zooplankton

Plant Foods: phytoplankton

Primary Diet: carnivore (Eats terrestrial vertebrates, Piscivore ); planktivore

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Associations

Ecosystem Roles

Silurus soldatovi carry bacterial diseases that can be transmitted to other fish. They are important predators of fish, crustaceans, small mammals, and aquatic birds.

Commensal/Parasitic Species:

  • "red head disease" (Vibrio sp. bacterium)
  • "gill disease" (Flavobacterium)

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Predation

Northern pike (Esox lucius) and humans are two predators of Silurus soldatovi. Their large size protects adults from many predators. Smaller fish may be protected somewhat by their dorsal spines.

Known Predators:

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Diseases and Parasites

SVC. Viral diseases
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Life History and Behavior

Behavior

Communication and Perception

Silurus soldatovi individuals use their barbels and olfactory buds to sense chemical cues in the water. They are thought to be extraordinarily sensitive to chemical stimuli. They also have a lateral line system that helps them detect water movement. Silurus soldatovi individuals may use path analysis to track prey. One study found that S. glanis can track the three-dimensional swim path of a guppy and successfully attack it without the presence of light. Little is known about communication in these mainly solitary animals.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Life Cycle

Males defend small territories in the spawning sites and construct nests made of plant materials. They dig shallow depressions or clean spawning substrate such as willow (Salix) and roots. Males guard the nests until larvae emerge. Spawns in pairs. Eggs hatch in 2-3 days. Larvae live in the nest until yolk sac is absorbed for 2-4 (Ref. 59043). Eggs are surrounded by a mucous and adherent wrapping. Incubation lasts about 50 hours at 24°C. Egg size 3 mm, larval length at hatching 8.5 mm (Ref. 26211).
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Development

The larvae hatch in approximately 3 days, measuring around 7 mm, and begin feeding on plankton. These fish grow quickly and can reach between 1.5 and 4.5 kg in their first year.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Life Expectancy

Lifespan/Longevity

The longest know lifespan in the wild is 80 years old for S. glanis. The expected lifespan in the wild is as high as 20 to 30 years old.

Range lifespan

Status: wild:
80 (high) years.

Typical lifespan

Status: wild:
20 to 30 years.

Average lifespan

Status: wild:
20 to 30 years.

Average lifespan

Status: captivity:
60 years.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Lifespan, longevity, and ageing

Maximum longevity: 60 years (captivity) Observations: In captivity, these animals have been reported to live up to 60 years (Nigrelli 1954), which seems possible.
Creative Commons Attribution 3.0 (CC BY 3.0)

© Joao Pedro de Magalhaes

Source: AnAge

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Reproduction

There is little known about mating behavior in this species. Males create nests where females deposit their eggs. Males then guard the eggs until they hatch.

Mating System: polygynandrous (promiscuous)

The male creates a shallow depression that will hold thousands of eggs laid by the female. The eggs are protected by the male until they hatch. Females can lay about 30,000 eggs per kilogram of body weight. Males grow faster and mature earlier than females. One study found that males matured at 78.82 cm at age 3 and females matured at 87.05 cm at age 4.

Breeding interval: Wels catfish breed annually during the spring.

Breeding season: Breeding/spawning season runs from May through July.

Range gestation period: 3 to 10 days.

Range time to independence: 3 to 10 days.

Average age at sexual or reproductive maturity (female): 4 years.

Average age at sexual or reproductive maturity (male): 3 years.

Key Reproductive Features: iteroparous ; seasonal breeding ; gonochoric/gonochoristic/dioecious (sexes separate); sexual ; fertilization (External ); oviparous

Average age at sexual or reproductive maturity (male)

Sex: male:
912 days.

Average age at sexual or reproductive maturity (female)

Sex: female:
1277 days.

The male protects the eggs until they hatch.

Parental Investment: pre-fertilization (Provisioning, Protecting: Female); pre-hatching/birth (Protecting: Male)

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Statistics of barcoding coverage: Silurus glanis

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 38
Specimens with Barcodes: 45
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Barcode data: Silurus glanis

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 10 barcode sequences available from BOLD and GenBank.  Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

CCTTTACCTAGTATTTGGTGCCTGAGCCGGAATAGTCGGCACAGCCTTAAGTCTCCTAATCCGAGCAGAGCTGGCCCAACCTGGCGCCCTCCTAGGCGATGATCAAATTTATAACGTCATCGTTACTGCTCACGCCTTTGTAATAATCTTCTTTATAGTAATACCAATTATGATCGGAGGGTTTGGAAACTGGCTTGTGCCTCTTATGATTGGGGCACCAGACATGGCTTTCCCCCGGATAAACAACATAAGCTTCTGACTTCTCCCTCCTTCATTCCTGCTACTACTAGCCTCCTCCGGAGTCGAAGCGGGCGCAGGAACAGGATGAACCGTTTACCCCCCTCTTGCAGGAAACCTCGCCCACGCAGGTGCTTCCGTAGACTTAACAATCTTTTCACTACACCTCGCAGGTGTGTCCTCCATCCTTGGGGCCATCAATTTCATTACAACTATTATTAACATAAAACCCCCAGCCATCTCACAATACCAAACACCTTTATTTGTGTGGGCCGTACTAATTACAGCAGTGCTTTTACTCCTGTCCCTGCCAGTCCTGGCCGCAGGAATTACAATGCTCCTAACGGACCGAAATCTAAATACTACATTCTTTGACCCCGCAGGAGGCGGAGACCCAATCCTCTACCAACATCTT
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Conservation

Conservation Status

IUCN Red List Assessment


Red List Category
LC
Least Concern

Red List Criteria

Version
3.1

Year Assessed
2008

Assessor/s
Freyhof, J. & Kottelat, M.

Reviewer/s
Bogutskaya, N., & Smith, K. (IUCN Freshwater Biodiversity Unit)

Contributor/s

Justification
A widespread species with no known major widespread threats. However, the species is locally threatened due to river regulation destruction of shallow spawning sites.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Silurus glanis populations appear to be stable. They are protected by Appendix III of the Bern Convention. In areas where these fish have been introduced, negative ecological consequences have been noted.

US Federal List: no special status

CITES: no special status

IUCN Red List of Threatened Species: least concern

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Population

Population
Abundant.

Population Trend
Unknown
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Threats

Major Threats
River regulation destroying shallow spawning sites.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Least Concern (LC)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Management

Conservation Actions

Conservation Actions
No information.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Relevance to Humans and Ecosystems

Benefits

Importance

fisheries: commercial; aquaculture: commercial; gamefish: yes
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Economic Importance for Humans: Negative

Silurus soldatovi introductions have been implicated in declining populations of other commercial fishes.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Economic Importance for Humans: Positive

Silurus soldatovi is a commercial fish consumed by humans. This fish has boneless white flesh that is low in fat and highly palatable. Technological research for artificial reproduction, population genetics and conservation problems have been developed over the past 10 years in the Czech Republic, France and other European countries. It is also a valued game fish in European countries.

Positive Impacts: food

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Wikipedia

Wels catfish

The wels catfish (/ˈwɛls/ or /ˈvɛls/; Silurus glanis), also called sheatfish, is a large catfish native to wide areas of central, southern, and eastern Europe, and near the Baltic and Caspian Seas. It has been introduced to Western Europe and is now found from the United Kingdom all the way east to Kazakhstan and south to Greece. It is a scaleless fresh and brackish water fish recognizable by its broad, flat head and wide mouth. Wels catfish can live for at least thirty years and have very good hearing.

The wels catfish lives on annelid worms, gastropods, insects, crustaceans, and fish including other catfishes; the larger ones also eat frogs, mice, rats, and aquatic birds such as ducks. Recently, individuals of this species in environments that are not their native habitats have been observed lunging out of the water to grab pigeons on land.[1]

Habitat[edit]

The wels catfish lives in large, warm lakes and deep, slow-flowing rivers. It prefers to remain in sheltered locations such as holes in the riverbed, sunken trees, etc. It consumes its food in the open water or in the deep, where it can be recognized by its large mouth. Wels catfish are kept in fish ponds as food fish.

Physical characteristics[edit]

Wels catfish's mouth contains lines of numerous small teeth, two long barbels on the upper jaw and four shorter barbels on the lower jaw. It has a long anal fin that extends to the caudal fin, and a small sharp dorsal fin positioned relatively far forward. It uses its sharp pectoral fins to capture prey. With these fins, it creates an eddy to disorient its victim, which it then simply engulfs in its enormous throat. It has very slippery green-brown skin. Its belly is pale yellow or white. Colour varies with environment. Clear water will give the fish a black coloration while muddy water will often tend to produce brownish specimens. Weight and length are not correlated linearly, and also depend on the season.

The female produces up to 30,000 eggs per kilogram of body weight. The male guards the nest until the brood hatches, which, depending on water temperature, can take from three to ten days. If the water level decreases too much or too fast the male has been observed to splash the eggs with its muscular tail in order to keep them wet.[citation needed]

Size[edit]

EuropeseMeervalLucasVanDerGeest.jpg

With a possible total length up to 4 m (13 ft) and a maximum weight of over 180 kg (400 lb) it is the second largest freshwater fish in its region after the beluga sturgeon. However, such lengths are extremely rare and could not be proved during the last century, but there is a somewhat credible report from the 19th century of a wels catfish of this size. Brehms Tierleben cites Heckl's and Kner's old reports from Danube about specimens 3 m (9.8 ft) long and 200–250 kg (440–550 lb) in weight, and Vogt's 1894 report of a specimen caught in Lake Biel which was 2.2 m (7 ft 3 in) long and weighed 68 kg (150 lb).[2] In 1856, K. T. Kessler[3] wrote about specimens from Dniepr which were over 5 m (16 ft) long and weighed up to 400 kg (880 lb).

Most wels catfish are only about 1.3–1.6 m (4 ft 3 in–5 ft 3 in) long; fish longer than 2 m (6 ft 7 in) are normally extremely rare. At 1.5 m (4 ft 11 in) they can weigh 15–20 kg (33–44 lb) and at 2.2 m (7 ft 3 in) they can weigh 65 kg (143 lb).

Only under exceptionally good living circumstances can the wels catfish reach lengths of more than 2 m (6 ft 7 in), as with the record wels catfish of Kiebingen (near Rottenburg, Germany), which was 2.49 m (8 ft 2 in) long and weighed 89 kg (196 lb). This giant was surpassed by some even larger specimens from Poland (2,61 m. 109 kg.), Ukraine, France, Spain (in the River Ebro), Italy (in the Po River and Arno River), and Greece, where this fish was released a few decades ago. Greek wels grow well thanks to the mild climate, lack of competition, and good food supply. The largest accurate weight was 144 kg (317 lb) for a 2.78 m (9 ft 1 in) long specimen from the Po Delta in Italy.[4] Other reports of larger wels (around 5 m (16 ft) or more) are unlikely and are often regarded as typical big fish stories or in some cases misidentification of the now rare sturgeon.

Exceptionally large specimens are rumored to attack humans in rare instances, a claim investigated by extreme angler Jeremy Wade in an episode of the Animal Planet television series River Monsters following his capture of three fish, two of about 66 kg (145 lb) and one of about 73 kg (160 lb), of which two attempted to attack him following their release. A report in the Austrian newspaper Der Standard on 5 August 2009, mentions a wels catfish dragging a fisherman near Győr, Hungary, under water by his right leg after the man attempted to grab the fish in a hold. The man barely escaped with his life from the fish, which must have weighed over 100 kg (220 lb), according to the fisherman.[5]

Ecology[edit]

There are concerns about the ecological impact of introducing the wels catfish to non-native regions. These concerns take into account the situation in Lake Victoria in Africa, where Nile perch (available in stores as Lake Victoria perch) were introduced and rapidly caused the extinction of numerous indigenous species. This severely impacted the entire lake, destroying much of the original ecosystem. The introduction of foreign species is almost always a burden on the affected ecosystem. Following the introduction of wels catfish, some fishes' numbers are in clear and rapid decline. Since its introduction in the Mequinenza Reservoir in 1974, it has spread to other parts of the Ebro basin, including Ebro and its tributaries, especially the Segre River. Some endemic species of Iberian barbels, genus Barbus in the Cyprinidae, were once abundant especially in the Ebro river but due to competition from and predation by wels catfish have since disappeared in the middle channel Ebro. The ecology of the river has also changed, as there is now a major growth in aquatic vegetation such as seaweed and algae. Barbel species from mountain stream tributaries of the Ebro that wels catfish have not colonized are not affected.

As a food fish[edit]

Only the flesh of young Silurus glanis specimens is valued as food. It is palatable when the catfish weighs less than 15 kg (33 lb). Larger than this size, the fish is highly fatty and not recommended for consumption.

Related species[edit]

References[edit]

  1. ^ Cucherousset, J.; Boulêtreau, S. P.; Azémar, F. D. R.; Compin, A.; Guillaume, M.; Santoul, F. D. R. (2012). ""Freshwater Killer Whales": Beaching Behavior of an Alien Fish to Hunt Land Birds". In Steinke, Dirk. PLoS ONE 7 (12): e50840. doi:10.1371/journal.pone.0050840.  edit
  2. ^ Brehm, Alfred; Brehms Tierleben II - Fish, Amphibians, Reptiles 1
  3. ^ Mareš, Jaroslav; Legendární příšery a skutečná zvířata, Prague, 1993
  4. ^ Wood, Gerald C. (1982). The Guinness book of animal facts and feats. Enfield, Middlesex: Guinness Superlatives. ISBN 0-85112-235-3. 
  5. ^ Der Standard, 2009-08-05. Waller-Wrestling im ungarischen Fischerteich. Retrieved 2009-08-06. (German)

Additional reading[edit]

Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

Source: Wikipedia

Unreviewed

Article rating from 0 people

Average rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!