Overview

Comprehensive Description

Biology

Found on the outermost continental shelves and upper slopes, mostly below 275 m (Ref. 247). Epibenthic-pelagic (Ref. 58426). At high latitudes, may move up to the surface especially during the winter (Ref. 247). Bottom water temp. Are from 3.5 to 4.5°C, but sometimes down to 1°C. Segregation by sex and size as well as by movement into shallower water and by increase in school size is sometimes seen. Feeds on crustaceans, cephalopods, jellyfish and small fishes. Ovoviviparous (Ref. 205), with at least 14 pups in a litter (Ref. 247). Has luminescent organs in skin. May reach 107 cm.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Distribution

occurs (regularly, as a native taxon) in multiple nations

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

National Distribution

Canada

Origin: Native

Regularity: Regularly occurring

Currently: Present

Confidence: Confident

Type of Residency: Year-round

United States

Origin: Native

Regularity: Regularly occurring

Currently: Present

Confidence: Confident

Type of Residency: Year-round

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

South Baffin Island to Virginia
  • North-West Atlantic Ocean species (NWARMS)
Creative Commons Attribution 3.0 (CC BY 3.0)

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Range Description

Northwest Atlantic: Greenland south to Canada (Baffin Island, Labrador, Newfoundland, and Nova Scotia), United States (Scotian Shelf south to Massachusetts, New York, New Jersey, Maryland, Virginia, possibly North Carolina and Gulf of Mexico off Alabama).

Southwest Atlantic: Argentina (Beagle Channel).

Northeast Atlantic: Iceland along Atlantic Slope and including Iceland-Faroe Ridge, Faroes, southern Norway, Rockall Trough and Porcupine Seabight.

Eastern central Atlantic: Morocco, Mauritania, Senegal, Guinea and Sierra Leone.

Southeast Atlantic: Namibia and South Africa (west coast of Northern and Western Cape from the Orange River south to Cape Agulhas) (Compagno in prep.).

FAO Fishing Areas: 21, 41, 27, 34 and 47.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Northwest Atlantic: South Baffin Island and Greenland to Virginia, USA and possibly the Gulf of Mexico. Eastern Atlantic: Iceland along Atlantic slope to Senegal; Guinea to Sierra Leone; Namibia to Quoin Point, South Africa (Ref. 5578). Southwest Atlantic: Uruguay to Argentina (Ref. 58839).
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Atlantic.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Oceanic, widespread in the tropical and warm temperature belts of all oceans, including the Mediterranean. In the western side of the Atlantic it has been recorded as far north as St.Pierre Bank south of Newfoundland, and as far south as Brazil.
  • Bigelow, H. B. and Schroeder, W. C., 1953; Compagno, L. J. V., 1984; Compagno, L. J. V., D. A. Ebert and M. J. Smale, 1989; Long, D. J., 1991.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Gulf of Maine - CoML

Source: Gulf of Maine Area Census of Marine Life

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Physical Description

Size

Maximum size: 840 mm TL
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Max. size

107 cm TL (male/unsexed; (Ref. ))
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

720 cm TL, max. weight: 3,400 kg.
  • Bigelow, H. B. and Schroeder, W. C., 1953; Compagno, L. J. V., 1984; Compagno, L. J. V., D. A. Ebert and M. J. Smale, 1989; Long, D. J., 1991.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Gulf of Maine - CoML

Source: Gulf of Maine Area Census of Marine Life

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Diagnostic Description

Adults uniformly blackish; fins of juveniles with white margins (Ref. 6577).
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Ecology

Habitat

Habitat Type: Marine

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

benthic
  • North-West Atlantic Ocean species (NWARMS)
Creative Commons Attribution 3.0 (CC BY 3.0)

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Depths range from 275m to 1600m, found near surface in subarctic waters.
  • North-West Atlantic Ocean species (NWARMS)
Creative Commons Attribution 3.0 (CC BY 3.0)

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Habitat and Ecology

Habitat and Ecology
Unless stated otherwise, this information is taken from Compagno (in prep.).

A deepwater schooling shark of the outer continental shelf and slope found at depths from 180?2,250 m but mostly below 275 m. Off southern Africa the species is found from 275 to >1,300 m, but mostly below 500 m. In the Rockall Trough it has been recorded from the 1,250?1,500 m bathymetric zone (Mauchline and Gordon 1983). Off Iceland the species is most abundant between 800 and 1,200 m (range 436?1,653 m) (Jakobsdottir 2001). Off Greenland it is present from 338 to 1,299 m but more common below 500 m (Yano 1995) and in the NRA it is found from 400?1,400 m depth, with high concentrations between 350?500 m (Kulka 2006).

At high latitudes in the north Atlantic it may move near the surface, especially during the winter. In the boreal North Atlantic at the northern extremes of its range, this species does not extend into truly Arctic waters but occurs at the fringe. Most commonly caught at the bottom of the ocean where water temperatures usually range from 3.5?4.5°C, with a minimum of 1.0°C. In the NRA, the largest catches came from the warmest available locations (between 5 and 6.5°C), primarily in the Laurentian Channel (Kulka 2006).

Feeds on crustaceans, cephalopods, jellyfish, cod-like fishes and mackerel in the Northern Hemisphere. Off Namibia and the West Coast of South Africa it feeds primarily on crustaceans, especially penaeid shrimp but also euphausiids. Secondary prey includes cephalopods, lanternfish, barracudinas and unidentified teleosts (Ebert et al. 1992).

Reported size at maturity differs regionally (see Compagno in prep.; Yano 1995 and Jakobsdottir 2001) from around 51?70 cm and around 46?63 cm in females and males respectively. Maturity stages have been observed during two seasons indicating an undefined breeding season in Iceland waters (Jakobsdottir 2001).The species is ovoviviparous. Reports of litter size also range but has been reported at a mean of 16.4 (range 4?40) (Yano 1995). Size at birth has been reported from 15 cm (Compagno in prep.) and maximum size from 70 cm in South Africa (Compagno in prep.) to possibly 107 cm in the North Atlantic Ocean (Compagno in prep.). It is also sexually dimorphic; females grow to a larger size than males and are larger at first maturity.

Systems
  • Marine
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Environment

bathydemersal; marine; depth range 180 - 1600 m (Ref. 247), usually 550 - 1000 m (Ref. 55215)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Depth range based on 3320 specimens in 1 taxon.
Water temperature and chemistry ranges based on 1895 samples.

Environmental ranges
  Depth range (m): 38 - 1512.5
  Temperature range (°C): -0.752 - 19.109
  Nitrate (umol/L): 2.471 - 35.221
  Salinity (PPS): 31.462 - 36.286
  Oxygen (ml/l): 1.796 - 7.938
  Phosphate (umol/l): 0.423 - 2.571
  Silicate (umol/l): 2.110 - 57.643

Graphical representation

Depth range (m): 38 - 1512.5

Temperature range (°C): -0.752 - 19.109

Nitrate (umol/L): 2.471 - 35.221

Salinity (PPS): 31.462 - 36.286

Oxygen (ml/l): 1.796 - 7.938

Phosphate (umol/l): 0.423 - 2.571

Silicate (umol/l): 2.110 - 57.643
 
Note: this information has not been validated. Check this *note*. Your feedback is most welcome.

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Depth: 180 - 1600m.
From 180 to 1600 meters.

Habitat: bathydemersal.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Pelagic; brackish; marine. Depth range 0-1280 m. Primarily a coastal and offshore inhabitant of continental and insular shelves, but may also occur off oceanic island far from land. Often close inshore to the surfline and in shallow bays. Usually solitary or in pairs but can be found in feeding aggregations of 10 or more. Does not form schools.
  • Bigelow, H. B. and Schroeder, W. C., 1953; Compagno, L. J. V., 1984; Compagno, L. J. V., D. A. Ebert and M. J. Smale, 1989; Long, D. J., 1991.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Gulf of Maine - CoML

Source: Gulf of Maine Area Census of Marine Life

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Migration

Non-Migrant: No. All populations of this species make significant seasonal migrations.

Locally Migrant: No. No populations of this species make local extended movements (generally less than 200 km) at particular times of the year (e.g., to breeding or wintering grounds, to hibernation sites).

Locally Migrant: No. No populations of this species make annual migrations of over 200 km.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Trophic Strategy

Found on the outermost continental shelves and upper slopes, mostly below 275 m (Ref. 247). At high latitudes, may move up to the surface especially during the winter (Ref. 247). Bottom water temperature are from 3.5 to 4.5°C, but sometimes down to 1°C. Feeds on crustaceans, cephalopods, jellyfish and small fishes.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Bony fishes, sharks, rays, seals, cetaceans, sea birds, carrion, squid, octopi.
  • Bigelow, H. B. and Schroeder, W. C., 1953; Compagno, L. J. V., 1984; Compagno, L. J. V., D. A. Ebert and M. J. Smale, 1989; Long, D. J., 1991.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Gulf of Maine - CoML

Source: Gulf of Maine Area Census of Marine Life

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Life History and Behavior

Behavior

Diet

Feeds on crustaceans, cephalopods, jellyfish and small fishes
  • North-West Atlantic Ocean species (NWARMS)
Creative Commons Attribution 3.0 (CC BY 3.0)

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Life Cycle

Distinct pairing with embrace (Ref. 205).
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Reproduction

Ovoviviparous. Little is known of actual breeding habits.
  • Bigelow, H. B. and Schroeder, W. C., 1953; Compagno, L. J. V., 1984; Compagno, L. J. V., D. A. Ebert and M. J. Smale, 1989; Long, D. J., 1991.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Gulf of Maine - CoML

Source: Gulf of Maine Area Census of Marine Life

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Centroscyllium fabricii

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 2 barcode sequences available from BOLD and GenBank.  Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

CCTATACTTAATCTTTGGTGCATGAGCAGGCATAGTAGGCACAGCCTTAAGCTTACTTATTCGAGCAGAACTATCCCAACCTGGCTCTCTCCTGGGAGATGATCAGATCTACAATGTTATTGTAACCGCCCATGCTTTTGTAATAATCTTTTTTATAGTAATACCAGTAATAATCGGCGGATTTGGAAACTGATTAGTACCTTTAATGATTGGTGCACCTGATATAGCTTTTCCACGGATAAATAACATAAGCTTCTGATTATTACCTCCTGCACTTCTTCTACTCCTAGCCTCTGCTGGTGTTGAAGCAGGGGCCGGAACTGGTTGAACAGTCTATCCCCCACTTGCAGGAAACATAGCCCATGCCGGAGCATCTGTAGACTTGGCCATTTTTTCCCTTCATTTAGCCGGTATCTCTTCAATTTTAGCTTCCGTTAACTTTATCACAACTATTATTAATATAAAACCCCCTGCTATCTCTCAATACCAGACGCCACTCTTTGTCTGATCAATTCTTGTAACAACAGTCCTCCTTCTACTTGCCCTCCCTGTTCTTGCAGCTGCAATTACAATATTATTAACAGACCGTAATTTAAATACTACATTTTTTGACCCTTCTGGAGGGGGGGACCCCATTCTATATCAACACTTA
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Statistics of barcoding coverage: Centroscyllium fabricii

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 12
Specimens with Barcodes: 15
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Conservation

Conservation Status

National NatureServe Conservation Status

Canada

Rounded National Status Rank: NNR - Unranked

United States

Rounded National Status Rank: NNR - Unranked

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

NatureServe Conservation Status

Rounded Global Status Rank: GNR - Not Yet Ranked

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

IUCN Red List Assessment


Red List Category
LC
Least Concern

Red List Criteria

Version
3.1

Year Assessed
2009

Assessor/s
Ebert, D.A., Crozier, P. & Blasdale, T. & McCormack, C.

Reviewer/s
Cavanagh, R.D., Heupel, M.R., Simpfendorfer, C.A., Acuña, E. & Valenti, S.V. (Shark Red List Authority)

Contributor/s

Justification
The Black Dogfish (Centroscyllium fabricii) is a relatively small (to at least 90 cm total length) deepwater, schooling shark of the outer continental shelf and slope found at depths from 180?2,250 m (mostly below 275 m). The species has a widespread but discontinuous distribution in the temperate Atlantic Ocean (tropical records are uncertain). The species? wide depth distribution affords it refuge from fishing pressure in many parts of its range, where deepwater fisheries are less developed. Recent population trends in parts of the Northwest Atlantic appear stable. Given stable population trends in the Northwest Atlantic and the species? relatively wide depth and geographic range, there is no reason to suspect that the global population has declined by approaching 30% and the species is assessed as Least Concern. However, deepwater fisheries are more developed and have a long history of operation across this species? range in the Northeast Atlantic, where it is taken as bycatch. Significant fishing pressure throughout much of the species? geographic and depth range in the Northeast Atlantic warrant a regional assessment of Near Threatened in this region, on the basis of suspected continuing declines approaching 30% (close to meeting VU A4bd).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Population

Population
Eastern Atlantic
Although not commonly encountered, the species is found on the slope from central Africa to Iceland (Kulka 2006). In Icelandic waters it is most abundant off the west, southwest and southeast coasts (Jakobsdottir 2001).

Exhibits size structure segregation by depth for both sexes off Iceland with the smallest immature specimens found at 1,000 and 1,500 m, and larger individuals at depths in between. The overall sex ratio off Iceland was 1.00:1.19 in favour of females. Males were more numerous in shallower waters but in depths >1,000 m, the sex ratio was significantly in favour of females (Jakobsdottir 2001).

The species is apparently abundant off southern Africa, mainly below 500 m depth. There is some uncertainty as to whether the Southeast Atlantic and the Northeast Atlantic populations are in fact the same species.

Western Atlantic
Abundant on the upper and middle slope and along the Mid Atlantic Ridge (Kulka 2006). Common off southwest Greenland (Yano 1995) and Baffin Island, in slope waters off Labrador, Newfoundland, the Scotian Shelf and Georges Bank (Kulka 2006). In the Northwest Atlantic Ocean Fisheries Organisation Regulatory Area (NRA), C. fabricii occupy an area of 225,000 km² and are highly abundant in the Laurentian Channel where they are 10 times more densely concentrated than in the Grand Banks or Labrador Shelf slope waters (Kulka 2006). Recent population trends of adults in the NRA have been stable (Kulka 2006).

According to Kulka (2006), in Canadian waters, large (pregnant) females migrate to the shallow (<400 m) portion of the Laurentian Channel where pupping occurs. The young then move into deeper waters of the channel. As they mature they move onto the slope, moving great distances north from the Grand Banks to the Labrador Shelf into deeper waters of the slope as they grow. The exception to this pattern is an area west of Greenland where juveniles of all sizes have been found in slope waters (Yano 1995). Kulka (2006) has suggested that there may be two separate stocks off Greenland and Canada even though the distribution is continuous between the two. Little information is available from the Southwest Atlantic at present.

Population Trend
Unknown
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Threats

Major Threats
Eastern Atlantic
The threat status of this species is of concern in the North Atlantic because of intensive fisheries operating on the deep slopes, following depletion of demersal fish stocks on the continental shelves and fishing-banks (Compagno in prep.). In the northeast Atlantic C. fabricii is frequently taken as bycatch in deepwater trawl and longline fisheries; however bycatch data is scarcely available.

ICES (2005) gives full description of the mixed trawl, deepwater gillnet and mixed and directed longline fisheries operating in the northeast Atlantic. Many of these fisheries operate throughout much of the species? geographic range in this area and bycatch pressure is likely to be significant. For example, off Iceland, a considerable amount of C. fabricii, are likely to be discarded by the commercial fishery for Greenland halibut Reinhardtius hippoglossoides. Records are rare and purely incidental, but Jakobsdottir (2001) estimated a bycatch of 98 and 109 t in 1996 and 1997 respectively based on trawl surveys in the area. Records of the catch proportions of the fleet in this area are needed for a full evaluation of the level of discarding of this species.

C. fabricii, are landed by the French trawl fishery for mixed deep-water species. Initially this fishery was conducted in ICES sub-areas VIa, VIIc,k but in 2001 when the Irish deep-water trawl fishery started to operate in Subarea VII most of the French fishing fleet moved to Subarea VIa (ICES 2005). In sub-area XII there have been some French landings of deep-water sharks, but it is not possible to detect any trends from the available data (ICES 2005). Note that this Sub-area contains both the western part of Hatton Bank and the Mid-Atlantic Ridge (ICES 2005) where this species is known to occur. Landings in France (mainly from division Vb and sub-area VI) decreased from about 250 t in 2000 to nearly 30 t in 2004 (ICES 2005). Iceland reported few landings from division Va and the largest annual landings reported by Spain came from sub-area XII in 2000 (85 Tonnes) and 2001 (91 tonnes) (ICES 2005).

Despite the more northerly distribution exhibited by this species, concerns still exist that this species will be vulnerable to the growing trend of the French deep-water trawl and other fisheries to operate in deeper waters to the west of the British Isles. Furthermore, there is still a lack of data available on incidental catches. Although C. fabricii has higher ovarian fecundities than other squalid sharks of its size, females still attain a large size at first maturity (Jones et al. 2005), and therefore this species may also be subjected to overfishing by the deep-water fishery.

The species is occasionally taken as a bycatch off southern Africa, but generally occurs in deepwater beyond the hake fishery zone. The species is not considered to be threatened in this region; however the situation should be monitored if fisheries expand into deeper waters. There is little information on catches of this species in the eastern central Atlantic.

Western Atlantic
In the northwest Atlantic, the species is taken as bycatch in a number of fisheries. In Canadian waters, there is no directed fishery but C. fabricii are taken as bycatch in a number of fisheries, primarily the Greenland halibut R. hippoglossoides, crab, redfish, monkfish and witch fisheries where removals averaged a total of 68t annually between 1996 and 2005 (Kulka 2006).

In the NRA, there are no data on removals but bycatch would be significant on the R. hippoglossoides fishing grounds (Kulka 2006). Based on distributional information, it is expected that most of the fish that would be captured in the fisheries in the NRA slope waters would be large juveniles or adults (Kulka 2006). Samples from the Russian R. hippoglossoides fleet in the NRA support this (Kulka 2006). Although incidental catch of this species in the NRA has not yet been quantified, recent population trends of adults have been stable (Kulka 2006).

Little information is available on threats in the southwest Atlantic Ocean.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Least Concern (LC)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Management

Conservation Actions

Conservation Actions
This species is included in the total allowable catch (TACs) set for deepwater sharks by ICES in the Northeast Atlantic: In 2007, the TAC for deepwater sharks in sub-areas V, VI, VII, VIII and IX is 2,472 t. In 2008, the TAC for these species in these areas will be reduced to 1,646 t. In 2007 and 2008, the TAC for deepwater sharks is set at 20 t annually in Sub-area X, and 99 t in sub-area XII (ICES 2007).

Recommendations: Like many deeper water species, more information on biology, ecology and importance in fisheries are required to further assess future conservation needs.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Relevance to Humans and Ecosystems

Benefits

Importance

fisheries: subsistence fisheries
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Wikipedia

Black dogfish

The black dogfish (Centroscyllium fabricii) is a species of dogfish shark in the family Etmopteridae. It is common over the outer continental shelf and continental slope at depths of 180–2,250 m (590–7,380 ft). Females generally inhabit deeper water than males, and depending on the region, smaller sharks may occur at different depths than larger ones. This species is distributed widely in the Atlantic Ocean, from Greenland and Iceland to Virginia and West Africa in the north, and off southwestern Africa and Argentina in the south. The largest member of its family, the black dogfish, typically measures 60–75 cm (24–30 in) long. It has a stocky, dark brown body that is darker below than above, and bears scattered, minute bioluminescent organs. Its two dorsal fins are preceded by stout spines, and the anal fin is absent.

Active and schooling, the black dogfish is an opportunistic predator and scavenger that mainly consumes bony fishes, crustaceans, and cephalopods. It is aplacental viviparous, with females producing litters of four to 40 pups that are sustained to term by a yolk sac. There is no well-defined breeding season, and mating and birthing take place year-round. The black dogfish contributes significantly to the bycatch of deep-sea commercial fisheries operating in the North Atlantic; it is of little commercial value and is usually discarded. As large portions of its range see little deepwater fishing activity and its northwestern Atlantic population seems to be stable, the International Union for Conservation of Nature has listed this species under Least Concern overall. It has been assessed as Near Threatened in the northeastern Atlantic, where its numbers may have declined from heavy fishing pressure.

Contents

Taxonomy and phylogeny

Early illustration of a black dogfish

The first known specimen of the black dogfish was collected near Julianehåb in Greenland and described by Danish zoologist Johannes Reinhardt in his 1825 Ichthyologiske bidrag. Reinhardt gave it the name Spinax fabricii in honor of missionary and naturalist Otto Fabricius, who pioneered the study of Greenlandic fishes.[2] German biologists Johannes Müller and Jakob Henle, in their 1839–41 Systematische Beschreibung der Plagiostomen, created the new genus Centroscyllium for this species.[3][4]

According to the IUCN, further taxonomic investigation is required to confirm the black dogfish in the North Atlantic and the southeastern Atlantic represent the same species.[1] A 2010 phylogenetic study by Nicolas Straube and colleagues, based on nuclear and mitochondrial DNA, found the black dogfish is the sister species of the whitefin dogfish (C. ritteri), and the two are, in turn, sister to the clade formed by the granular dogfish (C. granulatum) and combtooth dogfish (C. nigrum).[5]

Distribution and habitat

The black dogfish is a common species, with a wide but discontinuous distribution in the temperate waters of the Atlantic Ocean; its range abuts, but does not extend into, the Arctic Ocean. In the northeast, it occurs from Iceland to Sierra Leone, including the Faroe Islands, southern Norway, and the Rockall Trough and Porcupine Seabight off Ireland. In the northwest, it is found from southern Greenland and Baffin Island to Virginia, being particularly abundant in the Laurentian Channel, and may occur further south to the Gulf of Mexico off Alabama. In the southeast, it is found off Namibia and South Africa as far as Cape Agulhas.[1][6] In the southwest, it has been recorded from the Beagle Channel at the southern tip of Argentina.[7]

Inhabiting the outer continental shelf and continental slope, the black dogfish is found mostly near the bottom in water 180–2,250 m (590–7,380 ft) deep.[6] It is most common at depths of 800–1,200 m (2,600–3,900 ft) off Iceland, 1,250–1,500 m (4,100–4,900 ft) in the Rockall Trough, 500–1,300 m (1,600–4,300 ft) off Greenland, 350–500 m (1,150–1,600 ft) off northern Canada, and below 500 m (1,600 ft) off southern Africa.[1][8] The species may venture closer to the surface in the northern extreme of its range, particularly during the dark, cold winter months.[6] Depth segregation by sex has been documented in the North Atlantic, with females outnumbering males at depths greater than 1 km (0.62 mi). Depth segregation by size varies by region: larger sharks are generally found in deeper water off western Greenland, in shallower water off western Iceland, and without pattern with respect to depth off eastern Iceland.[8] The black dogfish prefers water temperatures of 3.5–4.5 °C (38–40 °F), though off northern Canada, it is most abundant in water of 5–6.5 °C (41–44 °F); it can tolerate temperatures down to 1 °C (34 °F).[1] There is some evidence that this species conducts seasonal migrations, spending winter and spring in shallower water.[6] Sharks off northern Canada perform development-related movements (see below) not observed off western Greenland, suggesting the presence of two distinct stocks in the northwestern Atlantic.[1]

Description

The black dogfish has a stout, dark brown body and large green eyes; this specimen has light patches where its dermal denticles have rubbed off from handling.

Adult black dogfish typically measure 60–75 cm (24–30 in) in length and can reach 1.1 m (3.6 ft), making it the largest member of its family.[5][9] Females attain a larger ultimate size than males.[8] The shark has a rather stocky and laterally compressed body, with a moderately long, thick, and flattened snout that forms a very broad arch at the front. The sizable, horizontally oval eyes are a reflective green in life and lack nictitating membranes (protective third eyelids); they are followed a short distance behind by much smaller spiracles (accessory respratory openings). The nostrils are anteriorly placed and preceded by short flaps of skin. The mouth is wide and evenly arched, with thin lips and short but deep furrows around the corners. There are around 34 tooth rows in either side of both jaws; each tooth has three (occasionally up to five) slender cusps, with the central one the longest.[6][9][10]

Both dorsal fins are immediately preceded by stout, grooved spines, with the second much longer than the first. The small first dorsal fin has a rounded apex and a nearly straight trailing margin, with its origin lying behind the pectoral fins. The second dorsal fin is rather angular and has about double the area of the first, with its origin located opposite the midpoint of the pelvic fin bases. The pectoral fins are small and rounded. The pelvic fins are about as large as the second dorsal fin, with rounded tips and nearly straight trailing margins. The caudal peduncle is short and leads to a broad caudal fin comprising less than a quarter of the total length; the upper lobe has a convex upper margin leading to a squared-off tip, while the lower lobe is indistinct. The skin is densely covered by tiny dermal denticles; each one is recurved and thorn-like, rising from an irregular star-shaped base. This species is a plain dark brown above, darkening to almost black below, with white dorsal fin spines. Juvenile sharks have white edges on the dorsal, pectoral, and pelvic fins. Minute, luminescent dots are scattered about the skin without a regular pattern.[6][9][10]

Biology and ecology

The black dogfish forms shoals or schools that tend to be larger during the winter and spring.[6][11] Though fairly active,[12] its swimming muscles exhibit lower activity of glycolytic enzymes and higher activity of creatine phosphokinase compared to the shallow-water spiny dogfish (Squalus acanthias), suggesting a lesser capacity for bursts of speed.[13] The lipid-filled liver comprises about one-fifth of its total weight and functions in maintaining neutral buoyancy.[8] Potential predators of the black dogfish are larger sharks and bony fishes.[9] It is one of several deep-sea sharks parasitized by the barnacle Anelasma squalicola, which attaches in front of the second dorsal fin and impairs the reproductive development of its host.[14] Other known parasites of this species include the fluke Otodistomum cestoides,[15] the copepods Neoalbionella fabricii and Neoalbionella centroscyllii,[16][17] and the protozoans Haemogregarina delagei and Trypanosoma rajae.[18]

Rattails are among the prey consumed by the black dogfish.

Apparently opportunistic in feeding habits, the black dogfish typically hunts in open water, but also scavenges off the bottom.[12][19] The bulk of its diet consists of a variety of bony fishes, including rattails, whitings, rockfishes, lanternfishes, and barracudinas, as well as pelagic crustaceans such as krill and shrimp, and cephalopods. Fish become a progressively more important food source as the shark ages, while crustaceans become less important. Infrequently, polychaete worms and jellyfish are also eaten.[8][19] In the northwestern Atlantic, Greenland halibut (Reinhardtius hippoglossoides) and rattail offal discarded from fishing vessels have become a major source of food for this species, particularly for older sharks that are capable of consuming larger pieces such as heads.[20]

Life history

Reproduction in the black dogfish occurs year-round, with no well-defined seasonal pattern.[8][21] This species is aplacental viviparous, in which the developing embryos are retained inside the uterus and are sustained to term solely by yolk. Mature females have two functional ovaries and two functional uteruses. Fertilized eggs are ovulated into the uterus at a diameter of 3.0–4.5 cm (1.2–1.8 in), though a few may be retained in the ovary; the eggs are not enclosed in a capsule. The external yolk sac is fully resorbed when the embryo is close to term, with the remaining yolk having been transferred to an internal yolk sac attached to the intestine. The internal yolk sac serves to provision the newborn shark until it learns to feed. The litter size ranges from four to 40.[21] Newborns measure 13–19 cm (5.1–7.5 in) long.[21][22]

Various authors have reported the size at maturity as between 46 and 63 cm (18 and 25 in) for males and 51 and 70 cm (20 and 28 in) for females, reflecting differences between geographical areas.[1] Off northern Canada, females give birth in the portion of the Laurentian Channel less than 400 m (1,300 ft) deep. As the young grow, they migrate into the deeper parts of the Channel, and eventually a long distance northward over the Grand Banks or the Labrador Shelf, to the deep continental slope. This movement pattern has not been observed in black dogfish inhabiting adjacent waters off western Greenland.[1] A number of anomalous hermaphroditic specimens have been documented.[21]

Human interactions

The black dogfish is harmless to humans and of little commercial value. Substantial numbers are caught incidentally by commercial deep-sea trawl, gillnet, and longline fisheries operating throughout the North Atlantic, including the Icelandic Greenland halibut fishery, the French mixed-species trawl fishery, and the Canadian Greenland halibut, crab, redfish, monkfish, and witch fisheries. Captured sharks are usually discarded, though in recent years this and other small deepwater sharks have been increasingly retained and used for fishmeal.[1][9] Reported catches by European countries, of which France made the largest contribution, have followed a declining trend from 486 tons in 2001 to 35 tons in 2006.[23] The average catch by Canadian fisheries was 68 tons per year from 1996 to 2005. The black dogfish occurs mostly too deep for fisheries off southern Africa; in the remainder of its range, little information is available on fishery impact.[1]

The International Union for Conservation of Nature (IUCN) has listed the black dogfish under Least Concern worldwide; it is minimally affected by fishing activity across many parts of its range, while its population in the northwestern Atlantic presently seems to be stable and may have increased from 1978 to 1995.[1][24] By contrast, the intensity of deepwater fisheries in the northeastern Atlantic has led the IUCN to give this species a regional assessment of Near Threatened. The reproductive characteristics of the black dogfish, such as a large female maturation size, may render it susceptible to overfishing, though it is more fecund than other deep-sea dogfish sharks. In the northeastern Atlantic, catches of this species are managed as part of the total allowable catch for deep-sea sharks set by the International Council for the Exploration of the Sea (ICES).[1]

References

  1. ^ a b c d e f g h i j k l Ebert, D.A.; Crozier, P.; Blasdale, T. and McCormack, C. (2008). "Centroscyllium fabricii". IUCN Red List of Threatened Species. Version 2010.1. International Union for Conservation of Nature. Retrieved October 2, 2010. 
  2. ^ Reinhardt, J.C.H. (1825). "Ichthyologiske bidrag". In Örsted, H.C. Oversigt over det Kongelige Danske Videnskabernes Selskabs Forhandlinger og dets Medlemmers Arbeider (Kjøbenhavn) (in Danish). pp. 1–35. 
  3. ^ Müller, J. and Henle, F.G.J. (1839). Systematische Beschreibung der Plagiostomen (volume 2) (in German). Berlin: Veit und Comp. p. 191. 
  4. ^ Evermann, B.W. and Jordan, D.S. (1896). The Fishes of North and Middle America: A Descriptive Catalogue of the Species of Fish-like Vertebrates Found in the Waters of North America, North of the Isthmus of Panama (Volume 1). Government Printing Office. p. 56. 
  5. ^ a b Straube, N., S.P. Iglésias, D.Y. Sellos, J. Kriwet, and U.K. Schliewen (September 2010). "Molecular phylogeny and node time estimation of bioluminescent Lantern Sharks (Elasmobranchii: Etmopteridae)". Molecular Phylogenetics and Evolution 56 (3): 905–917. doi:10.1016/j.ympev.2010.04.042. PMID 20457263. 
  6. ^ a b c d e f g Compagno, L.J.V. (1984). Sharks of the World: An Annotated and Illustrated Catalogue of Shark Species Known to Date. Food and Agricultural Organization. pp. 46–48. ISBN 92-5-101384-5. 
  7. ^ Menni, R.C., G.H. Burgess, and M.L. Garcia (1993). "Occurrence of Centroscyllium fabricii (Reinhardt, 1825)(Elasmobranchii, Squalidae) in the Beagle Channel, southern south America". Bulletin of Marine Science 52 (2): 824–832. 
  8. ^ a b c d e f Jakobsdóttir, K.B. (May 2001). "Biological aspects of two deep-water squalid sharks: Centroscyllium fabricii (Reinhardt, 1825) and Etmopterus princeps (Collett, 1904) in Icelandic waters". Fisheries Research 51 (2–3): 247–265. doi:10.1016/S0165-7836(01)00250-8. 
  9. ^ a b c d e Burgess, G. and Bester, C. Biological Profiles: Black Dogfish. Florida Museum of Natural History Ichthyology Department. Retrieved on October 2, 2010.
  10. ^ a b Bigelow, H.B. and Schroeder, W.C. (1953). Fishes of the Western North Atlantic, Part 1. Sears Foundation for Marine Research, Yale University. pp. 480–486. 
  11. ^ Uiblein, F., M. Youngbluth, C. Jacoby, F. Pages, M. Picheral, and G. Gorsky (2005). "In situ observations of deepwater fishes in four canyons off the Georges Bank, NW Atlantic". Deep Sea 2003: Conference on the Governance and Management of Deep-sea Fisheries, Queenstown (New Zealand), 1–5 Dec 2003. Food and Agricultural Organization of the United Nations. pp. 98–106. ISBN 92-5-105402-9. 
  12. ^ a b Sedberry, G.R. and J.A. Musick (1978). "Feeding strategies of some demersal fishes of the continental slope and rise off the Mid-Atlantic Coast of the USA". Marine Biology 44 (4): 357–375. doi:10.1007/BF00390900. 
  13. ^ Treberg, J.R., R.A. Martin and W.R. Driedzic (2003). "Muscle enzyme activities in a deep-sea squaloid shark, Centroscyllium fabricii, compared with its shallow-living relative, Squalus acanthias". Journal of Experimental Zoology Part A: Comparative Experimental Biology 300A (2): 133–139. doi:10.1002/jez.a.10318. 
  14. ^ Yano, K. and J.A. Musick (2000). "The Effect of the Mesoparasitic Barnacle Anelasma on the Development of Reproductive Organs of Deep-sea Squaloid Sharks, Centroscyllium and Etmopterus". Environmental Biology of Fishes 59 (3): 329–339. doi:10.1023/A:1007649227422. 
  15. ^ Gibson, D.I. (1996). Guide to the Parasites of Fishes of Canada, Volume 4. NRC Research Press. p. 74. ISBN 0-660-16403-5. 
  16. ^ Rubec, L.A. and W.E. Hogans (1988). "Albionella fabricii n. sp. (Copepoda: Lernaeopodidae) from the gills of Centroscyllium fabricii from the Northwest Atlantic". Systematic Parasitology 11 (3): 219–225. doi:10.1007/BF00010002. 
  17. ^ Rodríguez, S.M., J.L. Luque and M. George-Nascimento (2010). "A parasitic copepod, Neoalbionella sp. (Lernaeopodidae), on the southern lanternshark Etmopterus granulosus (Etmopteridae) off Juan Fernández Archipelago, Chile". Revista de Biología Marina y Oceanografía 45 (2): 359–363. doi:10.4067/S0718-19572010000200020. Retrieved Oct 6, 2010. 
  18. ^ McDonald, T.E. and L. Margolis (1995). Synopsis of the parasites of fishes of Canada: Supplement (1978–1993). NRC Research Press. pp. 9, 19. ISBN 0-660-15902-3. 
  19. ^ a b Mauchline, J. and J.D.M. Gordon (1983). "Diets of the sharks and chimaeroids of the Rockall Trough, northeastern Atlantic Ocean". Marine Biology 75 (2–3): 269–278. doi:10.1007/BF00406012. 
  20. ^ Punzón, A. and M.A. Herrera (2000). "Feeding of Centroscyllium fabricii and the influence of discards on its diet in Flemish Pass (north-west Atlantic)". Journal of the Marine Biological Association of the UK 80 (4): 755–756. doi:10.1017/S002531540000268X. 
  21. ^ a b c d Yano, K. (1995). "Reproductive Biology of the Black Dogfish, Centroscyllium Fabricii, Collected From Waters off Western Greenland". Journal of the Marine Biological Association of the United Kingdom 75 (02): 285–310. doi:10.1017/S002531540001818X. 
  22. ^ Haedrich, R.L. (1995). "Structure over time of an exploited deepwater fish assemblage". In Hopper, A.G. Deep-water Fisheries of the North Atlantic Oceanic Slope. Kluwer Academic Publishers. pp. 70–96. ISBN 0-7923-3511-2. 
  23. ^ ICES (International Council for the Exploration of the Sea). (2007). Report of the Working Group Elasmobranch Fishes (WGEF), 22–28 June 2007, Galway, Ireland. ICES CM 2007/ACFM:27.
  24. ^ Baker, K.D., J.A. Devine and R.L. Haedrich (2009). "Deep-sea fishes in Canada’s Atlantic: population declines and predicted recovery times". Environmental Biology of Fishes 85 (1): 79–88. doi:10.1007/s10641-009-9465-8. 
Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

Source: Wikipedia

Unreviewed

Article rating from 0 people

Average rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!