Articles on this page are available in 1 other language: Chinese (Simplified) (4) (learn more)

Overview

Comprehensive Description

Biology

Nocturnally active, but occurring in large schools above lagoon patch reefs and along outer reef slopes during the day (Ref. 9768, 48637). Feeds mainly on fishes, but also on penaeid shrimps and squids. Sold fresh, frozen or dried salted. Reports of ciguatera poisoning need confirmation.
  • Rose, J.H. 1984 Sphyraenidae. In W. Fischer and G. Bianchi (eds.) FAO species identification sheets for fishery purposes. Western Indian Ocean (Fishing Area 51). Vol. 4. FAO, Rome. pag. var.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Distribution

Indo-Pacific: East Africa to Southeast Asia and the Marquesan and Society islands, north to southern Japan, south to New Caledonia.
  • Myers, R.F. 1991 Micronesian reef fishes. Second Ed. Coral Graphics, Barrigada, Guam. 298 p. (Ref. 1602)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Red Sea, Indo-West Pacific: East Africa east to Society and Marquesas Islands, north to southern Japan, south to, New Caledonia and Tonga.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Physical Description

Morphology

Dorsal spines (total): 6; Dorsal soft rays (total): 9; Analspines: 2; Analsoft rays: 9
  • Myers, R.F. 1991 Micronesian reef fishes. Second Ed. Coral Graphics, Barrigada, Guam. 298 p. (Ref. 1602)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Size

Maximum size: 750 mm ---
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Max. size

75.0 cm TL (male/unsexed; (Ref. 9710))
  • Lieske, E. and R. Myers 1994 Collins Pocket Guide. Coral reef fishes. Indo-Pacific & Caribbean including the Red Sea. Haper Collins Publishers, 400 p. (Ref. 9710)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Diagnostic Description

Body elongate and sub cylindrical with small cycloid scales; head long and pointed. Mouth large and horizontal, the tip of the lower jaw protruding; intermaxilla non-protractile. Preoperculum broadly rounded. Lower limb of the first fill arch with spiny tubercles. First dorsal fin origin opposite or before the pectoral tip, the first spine shorter than the second. Color is generally blackish above and silvery below.Description: Characterized further by having 112-123 lateral line scales; absence of gill rakers, spinules on 10-20 tubercles of lower limb; closely spaced teeth, posterior ones in lower jaw angeled backwards; very large eye; depth of body 6.9-7.7 in SL (Ref. 90102).
  • Myers, R.F. 1991 Micronesian reef fishes. Second Ed. Coral Graphics, Barrigada, Guam. 298 p. (Ref. 1602)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Description

Nocturnally active fish, but occuring in large schools above lagoon patch reefs and along outer reef slopes during the day (Ref. 9768). Feeds mainly on fishes, but also on penaeid shrimps and squids. Mainly nocturnal. Sold fresh, frozen or dried salted in markets. Unreliable claims of ciguatera poisoning from eating this species need confirmation.
  • Anon. (1996). FishBase 96 [CD-ROM]. ICLARM: Los Baños, Philippines. 1 cd-rom pp.
Creative Commons Attribution 3.0 (CC BY 3.0)

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Ecology

Habitat

Environment

reef-associated; marine; depth range 6 - 300 m (Ref. 1602)
  • Myers, R.F. 1991 Micronesian reef fishes. Second Ed. Coral Graphics, Barrigada, Guam. 298 p. (Ref. 1602)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Depth range based on 162 specimens in 1 taxon.
Water temperature and chemistry ranges based on 99 samples.

Environmental ranges
  Depth range (m): 0.05 - 135
  Temperature range (°C): 22.098 - 28.199
  Nitrate (umol/L): 0.048 - 9.015
  Salinity (PPS): 34.364 - 35.354
  Oxygen (ml/l): 2.975 - 4.701
  Phosphate (umol/l): 0.120 - 0.760
  Silicate (umol/l): 0.498 - 12.645

Graphical representation

Depth range (m): 0.05 - 135

Temperature range (°C): 22.098 - 28.199

Nitrate (umol/L): 0.048 - 9.015

Salinity (PPS): 34.364 - 35.354

Oxygen (ml/l): 2.975 - 4.701

Phosphate (umol/l): 0.120 - 0.760

Silicate (umol/l): 0.498 - 12.645
 
Note: this information has not been validated. Check this *note*. Your feedback is most welcome.

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Depth: 0 - 300m.
Recorded at 300 meters.

Habitat: reef-associated. Nocturnally active, but occuring in large schools above lagoon patch reefs and along outer reef slopes during the day (Ref. 9768). Feeds mainly on fishes, but also on penaeid shrimps and squids. Sold fresh, frozen or dried salted. Reports of ciguatera poisoning need confirmation.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Trophic Strategy

Nocturnally active, but occurring in large schools above lagoon patch reefs and along outer reef slopes during the day (Ref. 9768). Feeds mainly on fishes, but also on penaeid shrimps and squids.
  • Salini, J.P., S.J.M. Blaber and D.T. Brewer 1994 Diets of trawled predatory fish of the Gulf of Carpentaria, Australia, with particular reference to predation on prawns. Aust. J. Mar. Freshwat. Res. 45(3):397-411.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Partner Web Site: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Sphyraena forsteri

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 3 barcode sequences available from BOLD and GenBank.

Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.

See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

CCTCTATTTACTGTTTGGTGCCTGAGCTGGAATAGTGGGCACAGCCTTAAGCCTGCTTATTCGAGCTGAATTAAGCCAACCTGGCTCCCTCCTAGGGGACGACCAGATCTATAACGTAATTGTGACAGCACACGCCTTCGTAATAATCTTTTTTATGGTTATACCAATTATAATTGGAGGATTTGGAAACTGACTTATCCCCCTAATAATTGGAGCCCCTGATATAGCATTCCCCCGAATAAATAATATGAGCTTCTGACTGCTTCCTCCTTCCTTCCTATTACTCCTTTCTTCCTCGGCTGTAGAAGCCGGAGCTGGTACAGGGTGGACTGTCTACCCTCCTCTAGCCGGAAACCTAGCCCACGCAGGAGCATCCGTTGACCTTACCATCTTCTCCTTACATCTAGCGGGAATCTCTTCAATTTTAGGCGCTATCAATTTTATTACCACTATTATTAATATGAAACCAGCAGCAACCTCTATATATCAAATTCCCCTCTTCGTTTGAGCAGTCCTGATTACTGCCGTTCTTCTTCTCCTTTCACTCCCCGTACTAGCTGCTGGAATTACAATGCTCCTAACAGATCGAAACCTAAACACCGCCTTCTTTGACCCCGCAGGGGGAGGGGACCCCATCCTTTATCAACATTTATTC
-- end --

Download FASTA File

Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Sphyraena forsteri

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 3
Specimens with Barcodes: 11
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Conservation

Threats

Not Evaluated
  • IUCN 2006 2006 IUCN red list of threatened species. www.iucnredlist.org. Downloaded July 2006.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Relevance to Humans and Ecosystems

Benefits

Importance

fisheries: commercial
  • Senou, H. 2001 Sphyraenidae. Barracudas. p. 3685-3697. In K.E. Carpenter and V. Niem (eds.) FAO species identification guide for fishery purposes. The living marine resources of the Western Central Pacific. Vol. 6. Bony fishes part 4 (Labridae to Latimeriidae), estuarine crocodiles. FAO, Rome. (Ref. 9768)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!