Overview
Comprehensive Description
Biology
Nocturnally active, but occurring in large schools above lagoon patch reefs and along outer reef slopes during the day (Ref. 9768, 48637). Feeds mainly on fishes, but also on penaeid shrimps and squids. Sold fresh, frozen or dried salted. Reports of ciguatera poisoning need confirmation.
-
Rose, J.H. 1984 Sphyraenidae. In W. Fischer and G. Bianchi (eds.) FAO species identification sheets for fishery purposes. Western Indian Ocean (Fishing Area 51). Vol. 4. FAO, Rome. pag. var.
http://www.fishbase.org/references/FBRefSummary.php?id=4752
Trusted
Distribution
Indo-Pacific: East Africa to Southeast Asia and the Marquesan and Society islands, north to southern Japan, south to New Caledonia.
-
Myers, R.F. 1991 Micronesian reef fishes. Second Ed. Coral Graphics, Barrigada, Guam. 298 p. (Ref. 1602)
http://www.fishbase.org/references/FBRefSummary.php?id=1602&speccode=4306
Trusted
Chagos, Djibouti, Mozambique, Seychelles, Somalia, Tanzania
-
Anon. (1996). FishBase 96 [CD-ROM]. ICLARM: Los Baños, Philippines. 1 cd-rom pp.
http://www.marinespecies.org/aphia.php?p=sourcedetails&id=5909
-
Anon. (2000). FishBase 2000 [CD-ROM]. ICLARM: Los Baños, Laguna, Philippines. 4 cd-roms pp.
http://www.marinespecies.org/aphia.php?p=sourcedetails&id=6542
Trusted
Red Sea, Indo-West Pacific: East Africa east to Society and Marquesas Islands, north to southern Japan, south to, New Caledonia and Tonga.
Trusted
Physical Description
Morphology
Dorsal spines (total): 6; Dorsal soft rays (total): 9; Analspines: 2; Analsoft rays: 9
-
Myers, R.F. 1991 Micronesian reef fishes. Second Ed. Coral Graphics, Barrigada, Guam. 298 p. (Ref. 1602)
http://www.fishbase.org/references/FBRefSummary.php?id=1602&speccode=4306
Trusted
Size
Max. size
75.0 cm TL (male/unsexed; (Ref. 9710))
-
Lieske, E. and R. Myers 1994 Collins Pocket Guide. Coral reef fishes. Indo-Pacific & Caribbean including the Red Sea. Haper Collins Publishers, 400 p. (Ref. 9710)
http://www.fishbase.org/references/FBRefSummary.php?id=9710&speccode=13770
Trusted
Diagnostic Description
Body elongate and sub cylindrical with small cycloid scales; head long and pointed. Mouth large and horizontal, the tip of the lower jaw protruding; intermaxilla non-protractile. Preoperculum broadly rounded. Lower limb of the first fill arch with spiny tubercles. First dorsal fin origin opposite or before the pectoral tip, the first spine shorter than the second. Color is generally blackish above and silvery below.
-
Myers, R.F. 1991 Micronesian reef fishes. Second Ed. Coral Graphics, Barrigada, Guam. 298 p. (Ref. 1602)
http://www.fishbase.org/references/FBRefSummary.php?id=1602&speccode=4306
Trusted
Description
Nocturnally active fish, but occuring in large schools above lagoon patch reefs and along outer reef slopes during the day (Ref. 9768). Feeds mainly on fishes, but also on penaeid shrimps and squids. Mainly nocturnal. Sold fresh, frozen or dried salted in markets. Unreliable claims of ciguatera poisoning from eating this species need confirmation.
-
Anon. (1996). FishBase 96 [CD-ROM]. ICLARM: Los Baños, Philippines. 1 cd-rom pp.
http://www.marinespecies.org/aphia.php?p=sourcedetails&id=5909
Trusted
Ecology
Habitat
Environment
reef-associated; marine; depth range 6 - 300 m (Ref. 1602)
-
Myers, R.F. 1991 Micronesian reef fishes. Second Ed. Coral Graphics, Barrigada, Guam. 298 p. (Ref. 1602)
http://www.fishbase.org/references/FBRefSummary.php?id=1602&speccode=4306
Trusted
Depth range based on 162 specimens in 1 taxon.
Water temperature and chemistry ranges based on 99 samples.
Environmental ranges
Depth range (m): 0.05 - 135
Temperature range (°C): 22.098 - 28.199
Nitrate (umol/L): 0.048 - 9.015
Salinity (PPS): 34.364 - 35.354
Oxygen (ml/l): 2.975 - 4.701
Phosphate (umol/l): 0.120 - 0.760
Silicate (umol/l): 0.498 - 12.645
Graphical representation
Depth range (m): 0.05 - 135
Temperature range (°C): 22.098 - 28.199
Nitrate (umol/L): 0.048 - 9.015
Salinity (PPS): 34.364 - 35.354
Oxygen (ml/l): 2.975 - 4.701
Phosphate (umol/l): 0.120 - 0.760
Silicate (umol/l): 0.498 - 12.645
Note: this information has not been validated. Check this *note*. Your feedback is most welcome.
Water temperature and chemistry ranges based on 99 samples.
Environmental ranges
Depth range (m): 0.05 - 135
Temperature range (°C): 22.098 - 28.199
Nitrate (umol/L): 0.048 - 9.015
Salinity (PPS): 34.364 - 35.354
Oxygen (ml/l): 2.975 - 4.701
Phosphate (umol/l): 0.120 - 0.760
Silicate (umol/l): 0.498 - 12.645
Graphical representation
Depth range (m): 0.05 - 135
Temperature range (°C): 22.098 - 28.199
Nitrate (umol/L): 0.048 - 9.015
Salinity (PPS): 34.364 - 35.354
Oxygen (ml/l): 2.975 - 4.701
Phosphate (umol/l): 0.120 - 0.760
Silicate (umol/l): 0.498 - 12.645
Note: this information has not been validated. Check this *note*. Your feedback is most welcome.
Trusted
Depth: 0 - 300m.
Recorded at 300 meters.
Habitat: reef-associated. Nocturnally active, but occuring in large schools above lagoon patch reefs and along outer reef slopes during the day (Ref. 9768). Feeds mainly on fishes, but also on penaeid shrimps and squids. Sold fresh, frozen or dried salted. Reports of ciguatera poisoning need confirmation.
Recorded at 300 meters.
Habitat: reef-associated. Nocturnally active, but occuring in large schools above lagoon patch reefs and along outer reef slopes during the day (Ref. 9768). Feeds mainly on fishes, but also on penaeid shrimps and squids. Sold fresh, frozen or dried salted. Reports of ciguatera poisoning need confirmation.
Trusted
Trophic Strategy
Nocturnally active, but occurring in large schools above lagoon patch reefs and along outer reef slopes during the day (Ref. 9768). Feeds mainly on fishes, but also on penaeid shrimps and squids.
-
Salini, J.P., S.J.M. Blaber and D.T. Brewer 1994 Diets of trawled predatory fish of the Gulf of Carpentaria, Australia, with particular reference to predation on prawns. Aust. J. Mar. Freshw. Res. 45(3):397-411.
http://www.fishbase.org/references/FBRefSummary.php?id=6932
Trusted
Molecular Biology and Genetics
Molecular Biology
Barcode data: Sphyraena forsteri
The following is a representative barcode sequence, the centroid of all available sequences for this species.

There are 3 barcode sequences available from BOLD and GenBank. Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species. See the BOLD taxonomy browser for more complete information about this specimen and other sequences.
Download FASTA File
There are 3 barcode sequences available from BOLD and GenBank. Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species. See the BOLD taxonomy browser for more complete information about this specimen and other sequences.
CCTCTATTTACTGTTTGGTGCCTGAGCTGGAATAGTGGGCACAGCCTTAAGCCTGCTTATTCGAGCTGAATTAAGCCAACCTGGCTCCCTCCTAGGGGACGACCAGATCTATAACGTAATTGTGACAGCACACGCCTTCGTAATAATCTTTTTTATGGTTATACCAATTATAATTGGAGGATTTGGAAACTGACTTATCCCCCTAATAATTGGAGCCCCTGATATAGCATTCCCCCGAATAAATAATATGAGCTTCTGACTGCTTCCTCCTTCCTTCCTATTACTCCTTTCTTCCTCGGCTGTAGAAGCCGGAGCTGGTACAGGGTGGACTGTCTACCCTCCTCTAGCCGGAAACCTAGCCCACGCAGGAGCATCCGTTGACCTTACCATCTTCTCCTTACATCTAGCGGGAATCTCTTCAATTTTAGGCGCTATCAATTTTATTACCACTATTATTAATATGAAACCAGCAGCAACCTCTATATATCAAATTCCCCTCTTCGTTTGAGCAGTCCTGATTACTGCCGTTCTTCTTCTCCTTTCACTCCCCGTACTAGCTGCTGGAATTACAATGCTCCTAACAGATCGAAACCTAAACACCGCCTTCTTTGACCCCGCAGGGGGAGGGGACCCCATCCTTTATCAACATTTATTC
-- end --
-- end --
Download FASTA File
Trusted
Statistics of barcoding coverage: Sphyraena forsteri
Barcode of Life Data Systems (BOLDS) Stats
Public Records: 3
Specimens with Barcodes: 7
Species With Barcodes: 1
Public Records: 3
Specimens with Barcodes: 7
Species With Barcodes: 1
Trusted
Conservation
Threats
Not Evaluated
-
IUCN 2006 2006 IUCN red list of threatened species. www.iucnredlist.org. Downloaded July 2006.
http://www.fishbase.org/references/FBRefSummary.php?id=57073
Trusted
Relevance to Humans and Ecosystems
Benefits
Importance
fisheries: commercial
-
Senou, H. 2001 Sphyraenidae. Barracudas. p. 3685-3697. In K.E. Carpenter and V. Niem (eds.) FAO species identification guide for fishery purposes. The living marine resources of the Western Central Pacific. Vol. 6. Bony fishes part 4 (Labridae to Latimeriidae), estuarine crocodiles. FAO, Rome. (Ref. 9768)
http://www.fishbase.org/references/FBRefSummary.php?id=9768&speccode=5734
Trusted
Disclaimer
EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.
To request an improvement, please leave a comment on the page. Thank you!


