Overview

Comprehensive Description

Biology

Adults found mainly in ponds, ditches, swamps and marshes, but sometimes occur in muddy rivers. Can tolerate slightly brackish water. Omnivorous. Breed in confined waters during the monsoon months, but can breed in ponds, derelict ponds and ditches when sufficient rain-water accumulates. Oviparous, distinct pairing possibly like other members of the same family (Ref. 205). In great demand due to its medicinal value.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Distribution

Asia: Pakistan and Sri Lanka to Myanmar.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Range Description

Heteropneustes fossilis is recorded from South and Southeast Asia: Pakistan, India, Sri Lanka, Nepal, Bangladesh, Myanmar, Thailand and Laos (Eschmeyer and Fricke 2009). It is introduced in Iran and Iraq. Records from India include the Andaman Island and Uttar Pradesh (Dehra Dun, Nainital).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Southern Asia: Iran (introduced), Iraq (introduced), Pakistan, India, Sri Lanka, Nepal, Bangladesh, Myanmar, Thailand and Laos.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Physical Description

Size

Maximum size: 300 mm TL
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Max. size

30.0 cm TL (male/unsexed; (Ref. 6028))
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Ecology

Habitat

Indus River Demersal Habitat

This taxon is one of the native demersal fish taxa that are found in the Indus River system. Major tributaries of the Indus rise in the Himalayan Mountains and the Hindu Kush; these influent rivers include the Chenab, Jhelum, Ravi and Sutlej. The Indus mainstem rises on the Tibetan Plateau and flows generally westward.

Generally the Indus sustains slower velocities with a wider channel as the river approaches its delta on the Arabian Sea. The Indus transports massive amounts of silt generated by human disturbances in its watershed as well as the torrential monsoonal rain events. Water quality issues in the Indus Basin have historically been dominated by sediment loading in a watershed which is subject to high natural erosivity, and early disturbance by sedentary agriculture on the floodplains and valleys. Beginning in the twentieth century, water pollution has been aggravated by massive water withdrawals for agriculture that have then concentrated pollutants.

The Green Revolution has exacerbated water pollution by considerable additions of nitrate to promote crop growth. Other aggravating factors have included increasing amounts of herbicides and pesticides, as pressures to increase crop production expand. Flow of the perennial Indus is dominated by: (a) meltwaters from the Tibetan icefield, the third largest ice sheet formation in the world; (b) snowfall and snowmelt from higher elevation of the watershed; and (c) episodic monsoonal rains that lead to periodic flooding in the basin.

Some of the arge native demersal fish associates in the Indus Basin are the 70 centimetre (cm) scaly osman (Diptychus maculatus), the 30 cm reba (Bangana ariza), the 30 cm Indus snowtrout (Ptychobarbus conirostris), the 30 cm Kunar snowtrout (Schizothorax labiatus), the 35 cm false osman (Schizopygopsis stoliczkai), the 47 cm Chirruh snowtrout (Schizothorax esocinus), and the 40 cm Sattar snowtrout (Schizopyge curvifrons).

Creative Commons Attribution 3.0 (CC BY 3.0)

© C.Michael Hogan

Supplier: C. Michael Hogan

Trusted

Article rating from 2 people

Average rating: 5.0 of 5

Environment

demersal; freshwater; brackish; pH range: 6.0 - 8.0; dH range: 30
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Habitat and Ecology

Habitat and Ecology
Inhabits freshwater, rarely brackish waters. This is primarily a fish of ponds, ditches, bheels, swamps and marshes, but it is sometimes found in muddy rivers. It is able to tolerate slightly brackish water. Its air-breathing apparatus enables it to exist in almost any kind of water. Generally, during the dry season singi lives in semiliquid and semi-dry mud, and even when the mud dries up they take their bodies to the bottom of fissures and crevices formed by the cracking mud. Fertilised eggs are adhesive, demersal and spherical in form.

Systems
  • Freshwater
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Depth range based on 1 specimen in 1 taxon.

Environmental ranges
  Depth range (m): 1 - 1
 
Note: this information has not been validated. Check this *note*. Your feedback is most welcome.
Public Domain

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Trophic Strategy

Found mainly in ponds, ditches, swamps and marshes, but sometimes occurs in muddy rivers. Can tolerate slightly brackish water. Omnivorous. Breeds in confined waters during the monsoon months, but can breed in ponds, derelict ponds and ditches when sufficient rain-water accumulates.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Diseases and Parasites

Yellow Grub. Parasitic infestations (protozoa, worms, etc.)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Pseudocaryophyllaeus Infestation 1. Parasitic infestations (protozoa, worms, etc.)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Pseudocaryophyllaeus Disease. Parasitic infestations (protozoa, worms, etc.)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Procamallanus Infection 6. Parasitic infestations (protozoa, worms, etc.)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Procamallanus Infection 5. Parasitic infestations (protozoa, worms, etc.)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Procamallanus Infection 1. Parasitic infestations (protozoa, worms, etc.)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Procamallanus Disease. Parasitic infestations (protozoa, worms, etc.)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Procamallanus Disease 2. Parasitic infestations (protozoa, worms, etc.)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Philopinna Disease. Parasitic infestations (protozoa, worms, etc.)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Palaeorchis Disease. Parasitic infestations (protozoa, worms, etc.)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Orientocreadium Infestation. Parasitic infestations (protozoa, worms, etc.)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Opegaster Infestation 2. Parasitic infestations (protozoa, worms, etc.)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Neopecoelina Infestation. Parasitic infestations (protozoa, worms, etc.)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Neopecoelina Disease. Parasitic infestations (protozoa, worms, etc.)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Macvicaria Infestation 2. Parasitic infestations (protozoa, worms, etc.)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Macrolecithus Disease. Parasitic infestations (protozoa, worms, etc.)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Lytocestus Disease (Lytocestus sp.). Parasitic infestations (protozoa, worms, etc.)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Lernaeocera Disease (Lernaeocera sp.). Parasitic infestations (protozoa, worms, etc.)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Intestinal Ligulosis. Parasitic infestations (protozoa, worms, etc.)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Gnathostoma Infestation. Parasitic infestations (protozoa, worms, etc.)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Genarchopsis Infestation 2. Parasitic infestations (protozoa, worms, etc.)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Fish louse Infestation 1. Parasitic infestations (protozoa, worms, etc.)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Eumasenia Disease. Parasitic infestations (protozoa, worms, etc.)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Euclinostomum Infestation. Parasitic infestations (protozoa, worms, etc.)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Euclinostomum Disease. Parasitic infestations (protozoa, worms, etc.)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Dactylogyrus Gill Flukes Disease. Parasitic infestations (protozoa, worms, etc.)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Contracaecum Disease. Parasitic infestations (protozoa, worms, etc.)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Clinostomum Infestation (metacercaria). Parasitic infestations (protozoa, worms, etc.)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Bialovarium Disease. Parasitic infestations (protozoa, worms, etc.)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Ascaridia Disease. Parasitic infestations (protozoa, worms, etc.)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Aphallus Disease. Parasitic infestations (protozoa, worms, etc.)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Allocreadium Infestation 7. Parasitic infestations (protozoa, worms, etc.)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Allocreadium Infestation 1. Parasitic infestations (protozoa, worms, etc.)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Life History and Behavior

Life Cycle

Eggs are deposited in a depression usually excavated by both parents in mud, in shallow water. Parents guard the eggs and young until they can fend for themselves which lasts for about one month (Ref. 6028).
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Heteropneustes fossilis

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There is 1 barcode sequence available from BOLD and GenBank.   Below is the sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen.  Other sequences that do not yet meet barcode criteria may also be available.

GTGACGATCACGCGCTGATTTTTCTCAACCAACCATAAAGACATTGGCACCCTCTACCTAGTATTTGGTGCCTGAGCCGGAATAGTCGGCACAGCCCTTAGCTTACTTATCCGGGCAGAATTAGCACAACCTGGTGCTCTACTGGGTGATGACCAAATTTATAACGTTATTGTTACTGCTCACGCATTCGTAATAATTTTCTTTATAGTAATACCAATTATGATTGGAGGCTTCGGAAACTGACTAGTACCCCTAATGATTGGAGCCCCTGATATAGCATTTCCACGTATGAATAACATAAGCTTCTGACTACTTCCACCATCTTTCCTACTACTGCTTGCATCTTCTGGAGTTGAAGCGGGGGCAGGAACAGGATGAACAGTGTATCCACCTCTTGCTGGGAATCTTGCACATGCTGGAGCCTCAGTAGATTTAACCATTTTCTCCCTACACTTAGCAGGTGTCTCATCTATTCTAGCATCTATTAATTTTATTACTACTATTATTAACATGAAACCCCCAGCCATCTCACAATATCAAACACCACTATTTGTTTGATCAGTGTTAATTACAGCCGTACTACTACTACTCTCCCTACCTGTACTAGCCGCTGGAATTACCATACTACTAACTGACCGAAATCTAAACACTACATTCTTTGACCCCGCAGGAGGTGGAGACCCCATTCTCTACCAACATCTCTTCTGATTCTTCGGACACCCAGAAGTATACATTCTAATTTTACCTGGCTTTGGAATAATTTCTCACATCGTAGCCTACTATTCCGGTAAAAAAGAACCGTTTGGGTACATGGGAATAGTGTGAGCCATAATAGCAATTGGCCTTCTAGGCTTCATTGTGTGAGCCCATCACATGTTTACGGTTGGTATGGATGTAGACACTCGAGCATATTTTACATCCGCAACAATAATTATCGCAATTCCAACAGGAGTAAAAGTATTTAGCTGACTAGCCACCCTACATGGAGGATCAATTAAATGAGAAACTCCCATGCTATGGGCCCTAGGGTTCATCTTCCTATTTACAGTTGGTGGACTAACTGGTATTATACTAGCCAACTCATCACTAGACATCATACTACACGACACCTATTATGTAGTAGCCCATTTCCACTATGTACTATCAATAGGAGCCGTGTTTGCTATTATAGGAGCTATCGTCCACTGATTCCCATTATTTACAGGATATACAATACACGATACTTGAACAAAAATTCATTTTGGAACAATATTCCTAGGCGTAAACCTCACTTTCTTCCCACAACACTTCCTTGGTTTAGCAGGAATGCCACGACGATACTCAGACTACCCAGACGCCTATTCACTATGAAACATTGTCTCCTCTATCGGCTCAATAGTATCAATAGTAGCAGTCGTAATATTCTTATTTATTCTATGAGAAGCATTCGCTGCCAAACGAGAAGTACTATCTGTCGAATTAACTTCCACAAACGCAGAGTGACTTCACGGATGTCCACCACCATATCACACATTTGAAGAACCTGCCTTCGTTCAGGTACAAACAAACTAA
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Statistics of barcoding coverage: Heteropneustes fossilis

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 15
Specimens with Barcodes: 26
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Conservation

Conservation Status

IUCN Red List Assessment


Red List Category
LC
Least Concern

Red List Criteria

Version
3.1

Year Assessed
2010

Assessor/s
Jha, B.R. & Rayamajhi, A.

Reviewer/s
Vishwanath, W., Dahanukar, N. & Molur, S.

Contributor/s
Molur, S.

Justification
Heteropneustes fossilis has a very wide range (Pakistan, India, Sri Lanka, Nepal, Bangladesh, Myanmar, Thailand and Laos) and has been introduced elsewhere. Whilst it is heavily utilised for food and for medicine in many parts of its range, and it may be threatened by over exploitation and habitat loss and degradation (especially from pollution and dams), it is considered Least Concern at present.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Population

Population
It is a commonly occurring species throughout its range. It is also cultivated in some parts of its range; fishermen stock tanks with singhi during the rainy season.

Population Trend
Stable
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Threats

Least Concern (LC)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Major Threats

Habitat destruction and conversion, pollution, over-exploitation, disease and effect of climate change have been reported from almost all of its range. However, the species does not seem to be affected by any of these threats.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Management

Conservation Actions

Conservation Actions

No specific conservation effort and priority to this species. Some populations are automatically protected by being within protected areas of its range. Some small scale aquaculture is reported mainly for its consumptive use rather than for its conservation.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Relevance to Humans and Ecosystems

Benefits

Importance

fisheries: highly commercial; aquaculture: commercial; aquarium: commercial
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Wikipedia

Heteropneustes fossilis

Heteropneustes fossilis is a species of airsac catfish. Commonly known as Asian Stinging catfish or fossil cat. it found in India, Pakistan, Nepal, Sri Lanka, Thailand and Myanmar. In Sri Lanka, this fish is called Hunga[1] by the Sinhala speaking community, in India its called singhi. It is found in South India in the state of Kerala, and it is locally called as kaari (Malayalam: കാരി).

H. fossilis is found mainly in ponds, ditches, swamps and marshes, but sometimes occurs in muddy rivers. It can tolerate slightly brackish water. It is omnivorous. This species breeds in confined waters during the monsoon months, but can breed in ponds, derelict ponds, and ditches when sufficient rain-water accumulates. It is in great demand due to its medicinal value.[2]

Stinging catfish is able to deliver a painful sting to humans. Poison that can emanate from a gland on the pectoral fin spine and has been known to be extremely painful.

This species grows to a length of 30 centimetres (12 in) TL and is an important component of local commercial fisheries. It is also farmed and is found in the aquarium trade.[2]

References

  1. ^ List of Freshwater Fish of Sri Lanka
  2. ^ a b Froese, Rainer, and Daniel Pauly, eds. (2011). "Heteropneustes fossilis" in FishBase. December 2011 version.
Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

 

Source: Wikipedia

Unreviewed

Article rating from 0 people

Average rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!