Overview

Comprehensive Description

Biology

Adults found mainly in ponds, ditches, swamps and marshes, but sometimes occur in muddy rivers. Can tolerate slightly brackish water. Omnivorous. Breed in confined waters during the monsoon months, but can breed in ponds, derelict ponds and ditches when sufficient rain-water accumulates. Oviparous, distinct pairing possibly like other members of the same family (Ref. 205). In great demand due to its medicinal value.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Distribution

Range Description

Heteropneustes fossilis is recorded from South and Southeast Asia: Pakistan, India, Sri Lanka, Nepal, Bangladesh, Myanmar, Thailand and Laos (Eschmeyer and Fricke 2009). It is introduced in Iran and Iraq. Records from India include the Andaman Island and Uttar Pradesh (Dehra Dun, Nainital).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Asia: Pakistan and Sri Lanka to Myanmar.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Southern Asia: Iran (introduced), Iraq (introduced), Pakistan, India, Sri Lanka, Nepal, Bangladesh, Myanmar, Thailand and Laos.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Physical Description

Size

Maximum size: 300 mm TL
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Max. size

30.0 cm TL (male/unsexed; (Ref. 6028))
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Ecology

Habitat

Habitat and Ecology

Habitat and Ecology
Inhabits freshwater, rarely brackish waters. This is primarily a fish of ponds, ditches, bheels, swamps and marshes, but it is sometimes found in muddy rivers. It is able to tolerate slightly brackish water. Its air-breathing apparatus enables it to exist in almost any kind of water. Generally, during the dry season singi lives in semiliquid and semi-dry mud, and even when the mud dries up they take their bodies to the bottom of fissures and crevices formed by the cracking mud. Fertilised eggs are adhesive, demersal and spherical in form.

Systems
  • Freshwater
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Environment

demersal; freshwater; brackish; pH range: 6.0 - 8.0; dH range: 30
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Depth range based on 1 specimen in 1 taxon.

Environmental ranges
  Depth range (m): 1 - 1
 
Note: this information has not been validated. Check this *note*. Your feedback is most welcome.

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Trophic Strategy

Found mainly in ponds, ditches, swamps and marshes, but sometimes occurs in muddy rivers. Can tolerate slightly brackish water. Omnivorous. Breeds in confined waters during the monsoon months, but can breed in ponds, derelict ponds and ditches when sufficient rain-water accumulates.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Partner Web Site: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Diseases and Parasites

Yellow Grub. Parasitic infestations (protozoa, worms, etc.)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Pseudocaryophyllaeus Infestation 1. Parasitic infestations (protozoa, worms, etc.)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Pseudocaryophyllaeus Disease. Parasitic infestations (protozoa, worms, etc.)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Procamallanus Infection 6. Parasitic infestations (protozoa, worms, etc.)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Procamallanus Infection 5. Parasitic infestations (protozoa, worms, etc.)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Procamallanus Infection 1. Parasitic infestations (protozoa, worms, etc.)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Procamallanus Disease. Parasitic infestations (protozoa, worms, etc.)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Procamallanus Disease 2. Parasitic infestations (protozoa, worms, etc.)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Philopinna Disease. Parasitic infestations (protozoa, worms, etc.)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Palaeorchis Disease. Parasitic infestations (protozoa, worms, etc.)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Orientocreadium Infestation. Parasitic infestations (protozoa, worms, etc.)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Opegaster Infestation 2. Parasitic infestations (protozoa, worms, etc.)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Neopecoelina Infestation. Parasitic infestations (protozoa, worms, etc.)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Neopecoelina Disease. Parasitic infestations (protozoa, worms, etc.)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Macvicaria Infestation 2. Parasitic infestations (protozoa, worms, etc.)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Macrolecithus Disease. Parasitic infestations (protozoa, worms, etc.)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Lytocestus Disease (Lytocestus sp.). Parasitic infestations (protozoa, worms, etc.)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Lernaeocera Disease (Lernaeocera sp.). Parasitic infestations (protozoa, worms, etc.)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Intestinal Ligulosis. Parasitic infestations (protozoa, worms, etc.)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Gnathostoma Infestation. Parasitic infestations (protozoa, worms, etc.)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Genarchopsis Infestation 2. Parasitic infestations (protozoa, worms, etc.)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Fish louse Infestation 1. Parasitic infestations (protozoa, worms, etc.)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Eumasenia Disease. Parasitic infestations (protozoa, worms, etc.)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Euclinostomum Infestation. Parasitic infestations (protozoa, worms, etc.)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Euclinostomum Disease. Parasitic infestations (protozoa, worms, etc.)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Dactylogyrus Gill Flukes Disease. Parasitic infestations (protozoa, worms, etc.)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Contracaecum Disease. Parasitic infestations (protozoa, worms, etc.)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Clinostomum Infestation (metacercaria). Parasitic infestations (protozoa, worms, etc.)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Bialovarium Disease. Parasitic infestations (protozoa, worms, etc.)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Ascaridia Disease. Parasitic infestations (protozoa, worms, etc.)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Aphallus Disease. Parasitic infestations (protozoa, worms, etc.)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Allocreadium Infestation 7. Parasitic infestations (protozoa, worms, etc.)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Allocreadium Infestation 1. Parasitic infestations (protozoa, worms, etc.)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Life History and Behavior

Life Cycle

Eggs are deposited in a depression usually excavated by both parents in mud, in shallow water. Parents guard the eggs and young until they can fend for themselves which lasts for about one month (Ref. 6028).
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Heteropneustes fossilis

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There is 1 barcode sequence available from BOLD and GenBank.

Below is the sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.

See the BOLD taxonomy browser for more complete information about this specimen.

Other sequences that do not yet meet barcode criteria may also be available.

GTGACGATCACGCGCTGATTTTTCTCAACCAACCATAAAGACATTGGCACCCTCTACCTAGTATTTGGTGCCTGAGCCGGAATAGTCGGCACAGCCCTTAGCTTACTTATCCGGGCAGAATTAGCACAACCTGGTGCTCTACTGGGTGATGACCAAATTTATAACGTTATTGTTACTGCTCACGCATTCGTAATAATTTTCTTTATAGTAATACCAATTATGATTGGAGGCTTCGGAAACTGACTAGTACCCCTAATGATTGGAGCCCCTGATATAGCATTTCCACGTATGAATAACATAAGCTTCTGACTACTTCCACCATCTTTCCTACTACTGCTTGCATCTTCTGGAGTTGAAGCGGGGGCAGGAACAGGATGAACAGTGTATCCACCTCTTGCTGGGAATCTTGCACATGCTGGAGCCTCAGTAGATTTAACCATTTTCTCCCTACACTTAGCAGGTGTCTCATCTATTCTAGCATCTATTAATTTTATTACTACTATTATTAACATGAAACCCCCAGCCATCTCACAATATCAAACACCACTATTTGTTTGATCAGTGTTAATTACAGCCGTACTACTACTACTCTCCCTACCTGTACTAGCCGCTGGAATTACCATACTACTAACTGACCGAAATCTAAACACTACATTCTTTGACCCCGCAGGAGGTGGAGACCCCATTCTCTACCAACATCTCTTCTGATTCTTCGGACACCCAGAAGTATACATTCTAATTTTACCTGGCTTTGGAATAATTTCTCACATCGTAGCCTACTATTCCGGTAAAAAAGAACCGTTTGGGTACATGGGAATAGTGTGAGCCATAATAGCAATTGGCCTTCTAGGCTTCATTGTGTGAGCCCATCACATGTTTACGGTTGGTATGGATGTAGACACTCGAGCATATTTTACATCCGCAACAATAATTATCGCAATTCCAACAGGAGTAAAAGTATTTAGCTGACTAGCCACCCTACATGGAGGATCAATTAAATGAGAAACTCCCATGCTATGGGCCCTAGGGTTCATCTTCCTATTTACAGTTGGTGGACTAACTGGTATTATACTAGCCAACTCATCACTAGACATCATACTACACGACACCTATTATGTAGTAGCCCATTTCCACTATGTACTATCAATAGGAGCCGTGTTTGCTATTATAGGAGCTATCGTCCACTGATTCCCATTATTTACAGGATATACAATACACGATACTTGAACAAAAATTCATTTTGGAACAATATTCCTAGGCGTAAACCTCACTTTCTTCCCACAACACTTCCTTGGTTTAGCAGGAATGCCACGACGATACTCAGACTACCCAGACGCCTATTCACTATGAAACATTGTCTCCTCTATCGGCTCAATAGTATCAATAGTAGCAGTCGTAATATTCTTATTTATTCTATGAGAAGCATTCGCTGCCAAACGAGAAGTACTATCTGTCGAATTAACTTCCACAAACGCAGAGTGACTTCACGGATGTCCACCACCATATCACACATTTGAAGAACCTGCCTTCGTTCAGGTACAAACAAACTAA
-- end --

Download FASTA File

Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Heteropneustes fossilis

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 15
Specimens with Barcodes: 26
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Conservation

Conservation Status

IUCN Red List Assessment


Red List Category
LC
Least Concern

Red List Criteria

Version
3.1

Year Assessed
2010

Assessor/s
Jha, B.R. & Rayamajhi, A.

Reviewer/s
Vishwanath, W., Dahanukar, N. & Molur, S.

Contributor/s
Molur, S.

Justification
Heteropneustes fossilis has a very wide range (Pakistan, India, Sri Lanka, Nepal, Bangladesh, Myanmar, Thailand and Laos) and has been introduced elsewhere. Whilst it is heavily utilised for food and for medicine in many parts of its range, and it may be threatened by over exploitation and habitat loss and degradation (especially from pollution and dams), it is considered Least Concern at present.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Population

Population
It is a commonly occurring species throughout its range. It is also cultivated in some parts of its range; fishermen stock tanks with singhi during the rainy season.

Population Trend
Stable
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Threats

Major Threats

Habitat destruction and conversion, pollution, over-exploitation, disease and effect of climate change have been reported from almost all of its range. However, the species does not seem to be affected by any of these threats.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Least Concern (LC)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Management

Conservation Actions

Conservation Actions

No specific conservation effort and priority to this species. Some populations are automatically protected by being within protected areas of its range. Some small scale aquaculture is reported mainly for its consumptive use rather than for its conservation.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Relevance to Humans and Ecosystems

Benefits

Importance

fisheries: highly commercial; aquaculture: commercial; aquarium: commercial
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Wikipedia

Heteropneustes fossilis

The Asian stinging catfish or fossil cat, Heteropneustes fossilis, is a species of airsac catfish found in India, Bangladesh, Pakistan, Nepal, Sri Lanka, Thailand, and Myanmar. In India in the state of Kerala it is locally called as kadu (Malayalam:kadu ). It is highly preferred in Assam and locally known as xingi. In Bangladesh this fish is called Shing Mach,[1] In Sri Lanka, this fish is called hunga[2] by the Sinhala-speaking community.

H. fossilis is found mainly in ponds, ditches, swamps, and marshes, but sometimes occurs in muddy rivers. It can tolerate slightly brackish water. It is omnivorous. This species breeds in confined waters during the monsoon months, but can breed in ponds, derelict ponds, and ditches when sufficient rain water accumulates. It is in great demand due to its medicinal value.[3]

The stinging catfish is able to deliver a painful sting to humans. Poison from a gland on its pectoral fin spine has been known to be extremely painful.

This species grows to a length of 30 cm (12 in) TL and is an important component of local commercial fisheries. It is also farmed and found in the aquarium trade.[3]

References[edit]

  1. ^ [1],
  2. ^ List of Freshwater Fish of Sri Lanka
  3. ^ a b Froese, Rainer and Pauly, Daniel, eds. (2011). "Heteropneustes fossilis" in FishBase. December 2011 version.


Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

Source: Wikipedia

Unreviewed

Article rating from 0 people

Default rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!