Overview

Comprehensive Description

Biology

Occurs in clear water around coral reefs. Feeds on sponges, alcyonarians, tunicates, and shrimp. Uncommon and wary (Ref. 9710). Consumed fresh, generally roasted (Ref. 5217).
  • Smith-Vaniz, W.F., B.B. Collette and B.E. Luckhurst 1999 Fishes of Bermuda: history, zoogeography, annotated checklist, and identification keys. American Society of Ichthyologists and Herpetologists Special Publication No. 4. 424 p. (Ref. 35505)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Distribution

Western Atlantic: New Jersey, USA and Bermuda to Brazil, including the Caribbean and Antilles. Absent from the Gulf of Mexico.
  • North-West Atlantic Ocean species (NWARMS)
Creative Commons Attribution 3.0 (CC BY 3.0)

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Western Atlantic.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Western Atlantic: New Jersey, USA and Bermuda to Brazil, including the Caribbean and Antilles. Absent from the Gulf of Mexico.
  • Robins, C.R. and G.C. Ray 1986 A field guide to Atlantic coast fishes of North America. Houghton Mifflin Company, Boston, U.S.A. 354 p. (Ref. 7251)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Physical Description

Size

Max. size

50.0 cm TL (male/unsexed; (Ref. 36453))
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Diagnostic Description

Bold pattern of hexagons outlined by narrow dark lines; centers and areas between hexagons pale (Ref. 26938). Purplish blue on sides and ventrally (Ref. 13442).
  • Smith, C.L. 1997 National Audubon Society field guide to tropical marine fishes of the Caribbean, the Gulf of Mexico, Florida, the Bahamas, and Bermuda. Alfred A. Knopf, Inc., New York. 720 p. (Ref. 26938)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Ecology

Habitat

Environment

reef-associated; marine; depth range 3 - 80 m (Ref. 9710)
  • Lieske, E. and R. Myers 1994 Collins Pocket Guide. Coral reef fishes. Indo-Pacific & Caribbean including the Red Sea. Haper Collins Publishers, 400 p. (Ref. 9710)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Depth range based on 23 specimens in 1 taxon.
Water temperature and chemistry ranges based on 18 samples.

Environmental ranges
  Depth range (m): 13 - 100
  Temperature range (°C): 22.090 - 27.517
  Nitrate (umol/L): 0.435 - 2.736
  Salinity (PPS): 34.984 - 37.096
  Oxygen (ml/l): 4.223 - 4.706
  Phosphate (umol/l): 0.097 - 0.282
  Silicate (umol/l): 1.328 - 2.517

Graphical representation

Depth range (m): 13 - 100

Temperature range (°C): 22.090 - 27.517

Nitrate (umol/L): 0.435 - 2.736

Salinity (PPS): 34.984 - 37.096

Oxygen (ml/l): 4.223 - 4.706

Phosphate (umol/l): 0.097 - 0.282

Silicate (umol/l): 1.328 - 2.517
 
Note: this information has not been validated. Check this *note*. Your feedback is most welcome.

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Trophic Strategy

Occurs in clear water around coral reefs. Feeds on sponges, alcyonarians, tunicates, and shrimp. Uncommon and wary (Ref. 9710).
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Partner Web Site: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Acanthostracion polygonius

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 2 barcode sequences available from BOLD and GenBank.

Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.

See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

CCTTTATTTAGTATTTGGTGCTTGAGCCGGAATAGTAGGAACAGCCCTAAGCCTACTCATCCGAGCAGAACTAAGCCAACCAGGCGCCCTTCTTGGGGACGATCAGATTTATAATGTTATCGTCACAGCGCATGCATTCGTAATAATTTTCTTTATAGTAATACCAATTATAATTGGAGGGTTTGGAAACTGATTAGTACCACTAATAATTGGAGCCCCTGATATAGCATTCCCACGTATAAACAACATAAGCTTCTGACTCCTCCCTCCCTCCTTCCTTCTTCTCCTAGCTTCATCAGGAGTTGAAGCAGGTGCTGGGACAGGCTGAACAGTCTACCCACCCCTAGCGGGCAATCTAGCTCACGCAGGAGCATCCGTTGACTTAACTATCTTCTCACTTCATCTAGCTGGGGTTTCCTCAATTCTAGGGGCCATTAATTTTATCACTACTATTATTAACATAAAACCCCCCGCTATCTCCCAATATCAAACACCCCTGTTTGTTTGAGCCGTCTTAATTACTGCTGTACTTCTCCTCTTATCACTACCAGTTCTTGCTGCTGGCATTACAATACTCCTTACAGATCGAAACTTAAATACCACTTTCTTTGACCCCGCAGGAGGAGGAGATCCAATCCTTTACCAACA
-- end --

Download FASTA File

Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Acanthostracion polygonius

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 3
Specimens with Barcodes: 6
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Conservation

Threats

Not Evaluated
  • IUCN 2006 2006 IUCN red list of threatened species. www.iucnredlist.org. Downloaded July 2006.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Relevance to Humans and Ecosystems

Benefits

Importance

fisheries: commercial; aquarium: commercial
  • Sadovy, Y. 1992 A preliminary assessment of the marine aquarium export trade in Puerto Rico. Proceedings of the Seventh International Coral Reef Symposium, Guam, Vol. 2, p. 1014-1021. (Ref. 12090)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Wikipedia

Honeycomb cowfish

Acanthostracion polygonius cowfish

The honeycomb cowfish, Acanthostracion polygonius, belongs to the Ostraciidae family and is closely related to boxfish and trunkfish.

References[edit]

Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

Source: Wikipedia

Unreviewed

Article rating from 0 people

Default rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!