Overview

Comprehensive Description

Biology

Like C. boenak, it prefers shallow dead or silty reefs and this may account for the primarily continental distributions of these two species.
  • Heemstra, P.C. and J.E. Randall 1993 FAO Species Catalogue. Vol. 16. Groupers of the world (family Serranidae, subfamily Epinephelinae). An annotated and illustrated catalogue of the grouper, rockcod, hind, coral grouper and lyretail species known to date. Rome: FAO. FAO Fish. Synop. 125(16):382 p. (Ref. 5222)   http://www.fishbase.org/references/FBRefSummary.php?id=5222&speccode=12 External link.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Distribution

Indo-West Pacific: western India to Philippines, north to southern Japan (Honshu), south to northern Australia. 'Epinephelus formosus' from Madagascar (Ref. 6457), Réunion and Mauritius (Ref. 6458) are probably based on misidentifications of Cephalopholis polleni. Confused with Cephalopholis boenak.
  • Heemstra, P.C. and J.E. Randall 1993 FAO Species Catalogue. Vol. 16. Groupers of the world (family Serranidae, subfamily Epinephelinae). An annotated and illustrated catalogue of the grouper, rockcod, hind, coral grouper and lyretail species known to date. Rome: FAO. FAO Fish. Synop. 125(16):382 p. (Ref. 5222)   http://www.fishbase.org/references/FBRefSummary.php?id=5222&speccode=12 External link.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Range Description

Cephalopholis formosa is an Indo-West Pacific species distributed from western India to the Philippines, north to southern Japan (Honshu), and south to northern Australia. 'Epinephelus formosus' from Madagascar, Réunion and Mauritius are probably based on mis-identifications of Cephalopholis polleni. The species is confused with Cephalopholis boenak.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Mozambique
Creative Commons Attribution 3.0 (CC BY 3.0)

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Eastern Indian Ocean, Western Pacific: India east to Phippines, north to southern Japan, south to northern Australia.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Physical Description

Morphology

Dorsal spines (total): 9; Dorsal soft rays (total): 15 - 17; Analspines: 3; Analsoft rays: 7 - 8
  • Heemstra, P.C. and J.E. Randall 1993 FAO Species Catalogue. Vol. 16. Groupers of the world (family Serranidae, subfamily Epinephelinae). An annotated and illustrated catalogue of the grouper, rockcod, hind, coral grouper and lyretail species known to date. Rome: FAO. FAO Fish. Synop. 125(16):382 p. (Ref. 5222)   http://www.fishbase.org/references/FBRefSummary.php?id=5222&speccode=12 External link.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Size

Maximum size: 340 mm TL
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Max. size

34.0 cm TL (male/unsexed; (Ref. 4787))
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Ecology

Habitat

Environment

reef-associated; non-migratory; marine; depth range 10 - 30 m
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Habitat and Ecology

Habitat and Ecology
Cephalopholis formosa is a reef-associated species that prefers shallow (10 to 30 m) dead or silty reefs. This may account for the primarily continental distributions of this species and C. boenak. Within this range it generally doesn’t occur around oceanic islands and atolls (except the Lakshadweeps).

No detailed biological information is available, but the maximum recorded size is 34 cm TL.

Systems
  • Marine
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Depth range based on 11 specimens in 1 taxon.
Water temperature and chemistry ranges based on 8 samples.

Environmental ranges
  Depth range (m): 2 - 51
  Temperature range (°C): 27.271 - 28.885
  Nitrate (umol/L): 0.000 - 1.522
  Salinity (PPS): 32.182 - 34.498
  Oxygen (ml/l): 4.223 - 4.523
  Phosphate (umol/l): 0.128 - 0.350
  Silicate (umol/l): 3.511 - 6.656

Graphical representation

Depth range (m): 2 - 51

Temperature range (°C): 27.271 - 28.885

Nitrate (umol/L): 0.000 - 1.522

Salinity (PPS): 32.182 - 34.498

Oxygen (ml/l): 4.223 - 4.523

Phosphate (umol/l): 0.128 - 0.350

Silicate (umol/l): 3.511 - 6.656
 
Note: this information has not been validated. Check this *note*. Your feedback is most welcome.
Public Domain

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Depth: 10 - 30m.
From 10 to 30 meters.

Habitat: reef-associated.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Trophic Strategy

Occurs in inshore waters of the continental shelf (Ref. 75154).
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Cephalopholis formosa

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 2 barcode sequences available from BOLD and GenBank.  Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

CCTTTATCTAGTCTTCGGTGCCTGGGCCGGTATAGTAGGGACAGCACTTAGCCTGCTAATCCGAGCTGAATTGAGCCAACCAGGTGCTCTACTGGGCGATGATCAAATTTATAATGTTATCGTTACAGCACATGCTTTCGTAATAATTTTCTTTATAGTAATACCAATTATGATTGGTGGTTTCGGAAACTGACTTATTCCACTGATAATTGGTGCCCCCGACATAGCTTTCCCCCGGATAAACAACATGAGCTTTTGACTCCTGCCTCCATCTTTCTTGCTCCTGCTAGCCTCATCTGGGGTAGAAGCAGGTGCGGGTACTGGCTGAACAGTCTACCCTCCCCTAGCCGGTAACCTAGCCCATGCAGGTGCTTCTGTTGATTTAACAATCTTTTCACTGCATTTAGCAGGTATTTCATCAATTCTAGGAGCAATTAACTTTATCACAACCATTATTAACATAAAACCTCCAGCCATCTCCCAGTATCAAACACCCCTATTTGTATGAGCTGTATTAATTACAGCTGTTCTCCTCCTTCTTTCCCTCCCTGTTCTCGCTGCAGGTATTACAATGCTTCTAACTGATCGAAACCTGAACACCACCTTCTTTGACCCAGCTGGTGGAGGAGACCCAATTCTTTACCAGCATCTG
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Statistics of barcoding coverage: Cephalopholis formosa

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 6
Specimens with Barcodes: 11
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Conservation

Conservation Status

IUCN Red List Assessment


Red List Category
LC
Least Concern

Red List Criteria

Version
3.1

Year Assessed
2008

Assessor/s
Pollard, D., Heemstra, P.C., Myers, R. & Fennessy, S.

Reviewer/s
Sadovy, Y. & Moss, K. (Grouper and Wrasse Red List Authority)

Contributor/s

Justification
Cephalopholis formosa is assessed as Least Concern as it is regarded as too small to be targeted in commercial fisheries, and for this reason it is probably of little interest or importance as a marketable food fish. It is, however, probably taken incidentally in local artisinal and subsistence fisheries, and can be caught by hook and line, and in traps and trawls. No specific threats to its populations are known. It tolerates at least moderate habitat disturbance.

This species was recently moved from the Data Deficient list to the Least Concern list for the Northern Territory (NT) (Australia) by the NT Government, on advice from NT Fisheries and the NT Museum, because it was found to be generally common in NT waters.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Population

Population
The population status of Cephalopholis formosa is unknown, but the species is apparently relatively common, for example, in western India (Sluka and Lazarus, unpub.). There are, however, no known separate fisheries statistics.

Population Trend
Unknown
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Threats

Least Concern (LC)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Major Threats
Cephalopholis formosa is threatened with overfishing through incidental catch.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Management

Conservation Actions

Conservation Actions
Cephalopholis formosa occurs in marine protected areas throughout its range. No other known actions are reported for this species.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Relevance to Humans and Ecosystems

Benefits

Importance

fisheries: subsistence fisheries
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Wikipedia

Cephalopholis formosa


A Grouper from the Indo-West Pacific that occasionally makes its way into the aquarium trade. It grows to a size of 34cm in length.

References


Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

 

Source: Wikipedia

Unreviewed

Article rating from 0 people

Average rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!