Articles on this page are available in 1 other language: Chinese (Simplified) (4) (learn more)

Overview

Brief Summary

Biology

Humphead wrasses are extremely long-lived, known to survive for at least 30 years, and taking around five to seven years to reach sexual maturity (5). Adults are usually solitary, spending the day roaming the reef and returning to particular caves or ledges to rest at night (2). Very little is known about these fish; adult females are able to change sex but the triggers for this development are not known (5). Pairs spawn together as part of a larger mating group that may consist of over 100 individuals. The planktonic eggs are released into the water and once the larvae have hatched they will settle out on the substrate (5). Using their tough teeth, these fish are able to consume hard-shelled species such as molluscs, echinoderms and crustaceans (5). They are one of the few predators of species that destroy coral reefs, such as the infamous crown of thorns starfish (Acanthaster planci) (2).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Description

The humphead or Napoleon wrasse is one of the largest reef fishes in the world and is the largest member of the wrasse family (Labridae) (4). The enormous size of adult fish is made even more imposing by the prominent hump that develops on their forehead, from which they earn their common name (2). Mature adults also have thick lips; juveniles can be identified by their pale greenish colour and two black lines running behind the eye (2).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Comprehensive Description

Biology

Inhabit steep outer reef slopes, channel slopes, and lagoon reefs (Ref. 1602). Benthopelagic at 2-60 m (Ref. 58302). Usually solitary but may occur in pairs. Juveniles are encountered in coral-rich areas of lagoon reefs, where staghorn Acropora corals abound (Ref. 1602); also in algae reefs or seagrasses (Ref. 48636, 41878). Adults rove across the reefs by day and rest in reef caves and under coral ledges at night (Ref. 31343). Primary food are mollusks, fishes, sea urchins, crustaceans, and other invertebrates. One of the few predators of toxic animals such as sea hares, boxfishes and crown-of-thorns starfish (Ref. 1602). Oviparous, distinct pairing during breeding (Ref. 205). Found in Hong Kong live fish markets (Ref. 27253).
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Distribution

Red Sea, Indo-West Pacific: East Africa, Madagascar and Mascarenes east to Tuamotu Archipelago, north to Ryukyu Islands, south to New Caledonia; waifs at Hawaiian Islands.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Indo-Pacific: Red Sea to South Africa (Ref. 35918) and to the Tuamoto Islands, north to the Ryukyu Islands, south to New Caledonia. Formerly known as Vulnerable (A1d+2cd) (Y. Sadovy) but now listed as Endangered in IUCN 2004 and listed in Appendix II of CITES.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Range

This species is found throughout the Indo-Pacific Oceans, from the Red Sea and the coast of east Africa to the central Pacific, south from Japan to New Caledonia (5).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Physical Description

Morphology

Dorsal spines (total): 9; Dorsal soft rays (total): 10; Analspines: 3; Analsoft rays: 8
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Size

Maximum size: 2290 mm SL
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Max. size

229 cm SL (male/unsexed; (Ref. 9823)); max. published weight: 191.0 kg (Ref. 9710); max. reported age: 32 years (Ref. 51676)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Diagnostic Description

Description

Inhabits steep outer reef slopes, channel slopes, and on lagoon reefs from 2 to at least 60 m (Ref. 1602). Usually solitary but may occur in pairs (Ref. 1602). Juveniles are encountered in coral-rich areas of lagoon reefs, where staghorn @Acropora@ corals abound (Ref. 1602). Primary food are molluscs, fishes, sea urchins, crustaceans, and other invertebrates. One of the few predators of toxic animals such as sea hares, boxfishes and crown- of- thorns starfish (Ref. 1602).
translation missing: en.license_cc_by_4_0

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Adults of this species develop thick lips and a prominent bulbous hump on the forehead. Juveniles pale greenish with elongate dark spots on scales tending to form bars; 2 black lines posteriorly from eye (Ref. 4392).
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Ecology

Habitat

Depth range based on 35 specimens in 1 taxon.
Water temperature and chemistry ranges based on 29 samples.

Environmental ranges
  Depth range (m): 1.5 - 56
  Temperature range (°C): 25.709 - 28.973
  Nitrate (umol/L): 0.046 - 1.251
  Salinity (PPS): 34.379 - 35.312
  Oxygen (ml/l): 4.438 - 4.727
  Phosphate (umol/l): 0.121 - 0.214
  Silicate (umol/l): 0.567 - 4.407

Graphical representation

Depth range (m): 1.5 - 56

Temperature range (°C): 25.709 - 28.973

Nitrate (umol/L): 0.046 - 1.251

Salinity (PPS): 34.379 - 35.312

Oxygen (ml/l): 4.438 - 4.727

Phosphate (umol/l): 0.121 - 0.214

Silicate (umol/l): 0.567 - 4.407
 
Note: this information has not been validated. Check this *note*. Your feedback is most welcome.
All rights reserved

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Depth: 1 - 60m.
From 1 to 60 meters.

Habitat: reef-associated. Inhabits steep outer reef slopes, channel slopes, and lagoon reefs (Ref. 1602). Usually solitary but may occur in pairs (Ref. 1602). Juveniles are encountered in coral-rich areas of lagoon reefs, where staghorn @Acropora@ corals abound (Ref. 1602). Primary food are molluscs, fishes, sea urchins, crustaceans, and other invertebrates. One of the few predators of toxic animals such as sea hares, boxfishes and crown-of-thorns starfish (Ref. 1602).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Environment

reef-associated; marine; depth range 1 - 100 m (Ref. 58652)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Depth range based on 35 specimens in 1 taxon.
Water temperature and chemistry ranges based on 29 samples.

Environmental ranges
  Depth range (m): 1.5 - 56
  Temperature range (°C): 25.709 - 28.973
  Nitrate (umol/L): 0.046 - 1.251
  Salinity (PPS): 34.379 - 35.312
  Oxygen (ml/l): 4.438 - 4.727
  Phosphate (umol/l): 0.121 - 0.214
  Silicate (umol/l): 0.567 - 4.407

Graphical representation

Depth range (m): 1.5 - 56

Temperature range (°C): 25.709 - 28.973

Nitrate (umol/L): 0.046 - 1.251

Salinity (PPS): 34.379 - 35.312

Oxygen (ml/l): 4.438 - 4.727

Phosphate (umol/l): 0.121 - 0.214

Silicate (umol/l): 0.567 - 4.407
 
Note: this information has not been validated. Check this *note*. Your feedback is most welcome.

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Associated with coral reefs; adults inhabit the outer reef slopes and drop-offs, showing fidelity for particular sites, whilst juveniles are usually found amongst thickets of living staghorn coral (Acropora spp.) (5).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Trophic Strategy

Inhabit steep outer reef slopes, channel slopes, and lagoon reefs. Usually solitary but may occur in pairs. Juveniles are encountered in coral-rich areas of lagoon reefs, where staghorn Acropora corals abound (Ref. 1602, 58534). Adults rove across the reefs by day and rest in reef caves and under coral ledges at night (Ref. 31343). Primary food are molluscs, fishes, sea urchins, crustaceans, and other invertebrates (Ref. 1602).
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Partner Web Site: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Diseases and Parasites

Fish Leech Infestation (Hirudinea sp.). Parasitic infestations (protozoa, worms, etc.)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Life History and Behavior

Life Cycle

Oviparous, distinct pairing during breeding (Ref. 205).
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Cheilinus undulatus

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 3 barcode sequences available from BOLD and GenBank.

Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.

See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

CCTTTACCTTGTATTCGGTGCCTGAGCCGGCATAGTAGGCACTGCCCTAAGCCTGCTTATCCGGGCAGAACTTAGCCAGCCAGGTGCTCTTCTCGGAGACGATCAGATTTACAATGTCATCGTTACGGCCCACGCCTTCGTTATAATCTTCTTTATAGTAATACCAATCATGATCGGTGGCTTCGGAAACTGGCTAATCCCCCTTATGATCGGTGCCCCAGACATAGCCTTCCCCCGAATGAATAACATGAGTTTCTGACTCCTACCTCCTTCCTTCCTGCTTCTCCTTGCCTCCTCTGGTGTGGAAGCGGGAGCTGGGACCGGTTGGACAGTCTACCCTCCGCTAGCTGGAAACTTAGCTCACGCAGGCGCGTCTGTAGATCTCACAATCTTTTCCCTTCATCTAGCCGGGATCTCTTCCATCCTAGGAGCCATCAACTTTATTACAACTATTATTAACATGAAACCTCCAGCTATTACTCAATACCAAACACCTCTATTCGTGTGGGCCGTCCTAATTACAGCAGTTTTACTTCTTCTCTCCCTTCCTGTGCTCGCCGCCGGCATTACAATACTTTTAACAGACCGAAATCTAAACACCACTTTCTTCGACCCAGCAGGGGGAGGAGACCCAATCCTCTACCAACACTTATNN
-- end --

Download FASTA File

Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Cheilinus undulatus

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 5
Specimens with Barcodes: 10
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Conservation

Conservation Status

Status

Classified as Endangered (EN) on the IUCN Red List (1), and listed on Appendix II of CITES (3).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Threats

Endangered (EN) (A2bd+3bd), IUCN Grouper and Wrasse Specialist Group
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Although the humphead wrasse has a widespread distribution, it has never been common in its range and recent reports have revealed a worrying decline in numbers. Its life history characteristics make this species extremely vulnerable to exploitation and the population can only sustain light levels of fishing (5). Traditionally, the flesh of this fish has been highly prized and more recently this species has become one of the most highly sought species of the Live Reef Food Fish Trade (LRFFT), a luxury food industry that has undergone an increase in popularity in many eastern Asian countries (4). Humphead wrasse can fetch up to US $100 per kilogram at retail in Hong Kong (4), and as their numbers dwindle the rarity of the species is likely to increase the price (5). Cyanide is typically used to catch fish for this trade because live fish are difficult to take any other way; a practice that devastates coral reefs (5).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Management

Conservation

Little is known of the biology and distribution of the humphead wrasse and more data are urgently needed to understand the scale of the threats faced by current populations, and to implement effective conservation programmes (4). The World Conservation Union's (IUCN) Groupers & Wrasse Species Specialist Group is working to collect this all-important data and to raise awareness of the issues involved throughout the region (4). The species is partially protected in areas of Australia, the Philippines, the Maldives and Palau and was proposed for inclusion in Appendix II of the Convention on International Trade in Endangered Species (CITES) in November 2002 (4). Trade restrictions are particularly important, as this species cannot be hatchery reared and all individuals in trade come from wild populations (6).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Relevance to Humans and Ecosystems

Benefits

Importance

fisheries: minor commercial; aquaculture: commercial; gamefish: yes; aquarium: commercial; price category: very high; price reliability: very questionable: based on ex-vessel price for species in this family
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Wikipedia

Humphead wrasse

The humphead wrasse, Cheilinus undulatus, is a species of wrasse mainly found on coral reefs in the Indo-Pacific region. It is also known as the Māori wrasse, Napoleon wrasse, Napoleon fish, Napoleonfish; and so mei 蘇眉 (Cantonese), mameng (Filipino), and merer in the Pohnpeian language of the Caroline Islands.[2]


Common Name[edit]

Humphead wrasse

Habitat[edit]

Salt water

Dispersion[edit]

Thai Sea Boundary

Utilization[edit]

Fishery: Small Trading; Aquaculture: Trade; Game: Fishing; Aquarium: Trade

Description[edit]

Napoleon fish, Blue Corner, Palau.jpg

The humphead wrasse is the largest living member of the family Labridae, with males reaching 6 ft (2 m) in length, while females rarely exceed about 3 ft (1 m). It has thick, fleshy lips, and a hump forms on its head above the eyes, becoming more prominent as the fish ages, hence its name. Males range from a bright electric blue to pale green, a purplish blue, or a relatively dull blue/green. Juveniles and females are red-orange above, and red-orange to white below. Some males grow very large, with one unconfirmed report of a humphead wrasse that was 7.75 ft (2.29 m) long and weighed 420 lbs (190.5 kg).

Ecology[edit]

Napoleon fish diving in the Red Sea
A humphead wrasse at the water's surface on the Great Barrier Reef

Adults are commonly found on steep coral reef slopes, channel slopes, and lagoon reefs in water 3 to 330 ft (1–100 m) deep. They are very opportunistic predators, preying primarily on crustaceans, mollusks (particularly gastropods), fish, and echinoderms. They are one of the few predators of toxic animals such as the sea hare Aplysia and Napolian Junior Ostraciidae and have even been reported preying on crown-of-thorns starfish.[3] This species actively selects branching hard and soft corals and seagrasses at settlement. Juveniles tend to prefer a more cryptic existence in areas of dense branching corals, bushy macroalgae, or seagrasses, while larger individuals and adults prefer to occupy limited home ranges in more open habitat on the edges of reefs, channels, and reef passes. The species is most often observed in solitary male-female pairs, or groups of two to seven individuals.

Gallery[edit]

Reproduction[edit]

Individuals become sexually mature at four to six years, and females are known to live for around 50 years, whereas males live a slightly shorter 45 years. Humphead wrasses are protogynous hermaphrodites, with some members of the population becoming male at about 9 years old[4] The factors that control the timing of sex change are not yet known. Adults move to the down-current end of the reef and form local spawning aggregations (they concentrate to spawn) at certain times of the year.

Conservation[edit]

The humphead wrasse is long-lived, but has a very slow breeding rate. Its numbers have declined due to a number of threats, including:

  1. Intensive and species-specific removal in the live reef food fish trade throughout its core range in South-East Asia [5]
  2. Spearfishing at night with SCUBA gear
  3. Destructive fishing techniques, including sodium cyanide and dynamite
  4. Habitat loss and degradation
  5. Juveniles being taken from the wild and raised or “cultured” in floating net cages until saleable size
  6. A developing export market for juvenile humphead wrasse for the marine aquarium trade
  7. Lack of coordinated, consistent national and regional management
  8. Illegal, unregulated, or unreported fisheries

The fish is listed on the IUCN Red list as Endangered and on Appendix II of CITES.[5]

The species has historically been fished commercially in northern Australia, but has been protected in Queensland since 2003 and Western Australia since 1998.[5]

In Guangdong Province, southern mainland China, permits are required for the sale of this species; Indonesia allows fishing only for research, mariculture, and licensed artisanal fishing; the Maldives instituted an export ban in 1995; Papua New Guinea prohibits export of fish over 2 ft (65 cm) total length; and Niue has banned all fishing for this species.

The humphead wrasse is a U.S. National Marine Fisheries Service Species of Concern. Species of Concern are those species about which the NMFS, has some concerns regarding status and threats, but for which insufficient information is available to indicate a need to list the species under the Endangered Species Act.

See also[edit]

References[edit]

  1. ^ Russell, B. (Grouper & Wrasse Specialist Group) 2004. Cheilinus undulatus. In: IUCN 2013. IUCN Red List of Threatened Species. Version 2013.1. <www.iucnredlist.org>. Downloaded on 02 November 2013.
  2. ^ http://www.trussel2.com/pnp/pnp-m.htm
  3. ^ Randall, J.E., et al. (1978). Food habits of the giant humphead wrasse, Cheilinus undulatus (Labridae). Env. Biol. Fish 3:235-238
  4. ^ Choat, J. H., et al. (2006). Age structure and growth in a large teleost, Cheilinus undulatus, with a review of size distribution in labrid fishes. Mar Ecol Prog Ser 318:237-246.
  5. ^ a b c Bray, Dianne. "Humphead Maori Wrasse, Cheilinus undulatus". Fishes of Australia. Retrieved 29 September 2014. 
Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

Source: Wikipedia

Unreviewed

Article rating from 0 people

Default rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!