Overview

Brief Summary

Biology

Humphead wrasses are extremely long-lived, known to survive for at least 30 years, and taking around five to seven years to reach sexual maturity (5). Adults are usually solitary, spending the day roaming the reef and returning to particular caves or ledges to rest at night (2). Very little is known about these fish; adult females are able to change sex but the triggers for this development are not known (5). Pairs spawn together as part of a larger mating group that may consist of over 100 individuals. The planktonic eggs are released into the water and once the larvae have hatched they will settle out on the substrate (5). Using their tough teeth, these fish are able to consume hard-shelled species such as molluscs, echinoderms and crustaceans (5). They are one of the few predators of species that destroy coral reefs, such as the infamous crown of thorns starfish (Acanthaster planci) (2).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Description

The humphead or Napoleon wrasse is one of the largest reef fishes in the world and is the largest member of the wrasse family (Labridae) (4). The enormous size of adult fish is made even more imposing by the prominent hump that develops on their forehead, from which they earn their common name (2). Mature adults also have thick lips; juveniles can be identified by their pale greenish colour and two black lines running behind the eye (2).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Comprehensive Description

Biology

Inhabit steep outer reef slopes, channel slopes, and lagoon reefs (Ref. 1602). Benthopelagic at 2-60 m (Ref. 58302). Usually solitary but may occur in pairs. Juveniles are encountered in coral-rich areas of lagoon reefs, where staghorn Acropora corals abound (Ref. 1602); also in algae reefs or seagrasses (Ref. 48636, 41878). Adults rove across the reefs by day and rest in reef caves and under coral ledges at night (Ref. 31343). Primary food are mollusks, fishes, sea urchins, crustaceans, and other invertebrates. One of the few predators of toxic animals such as sea hares, boxfishes and crown-of-thorns starfish (Ref. 1602). Oviparous, distinct pairing during breeding (Ref. 205). Found in Hong Kong live fish markets (Ref. 27253).
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Distribution

Red Sea, Indo-West Pacific: East Africa, Madagascar and Mascarenes east to Tuamotu Archipelago, north to Ryukyu Islands, south to New Caledonia; waifs at Hawaiian Islands.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Indo-Pacific: Red Sea to South Africa (Ref. 35918) and to the Tuamoto Islands, north to the Ryukyu Islands, south to New Caledonia. Formerly known as Vulnerable (A1d+2cd) (Y. Sadovy) but now listed as Endangered in IUCN 2004 and listed in Appendix II of CITES.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Range Description

The Humphead Wrasse is widely distributed on coral reefs and inshore habitats throughout much of the tropical Indo-Pacific, from western Indian Ocean and Red Sea to southern Japan, New Caledonia and into the central Pacific Ocean (follow link below for a distribution map). In Australia, it occurs on offshore reefs of north-western Australia and the Great Barrier Reef (Pogonoski et al. 2002). It is rare in the southern part of the Great Barrier Reef in the Capricorn-Bunker Group (Russell 1983) and at Middleton and Elizabeth Reef (Gill and Reader 1992). This species appears to occur predominantly at depths of less than 100 m. It is not known from the Hawaiian Islands, Johnston Island, Easter Island, Pitcairn Is., Rapa or Lord Howe Islands, Kermadec or Australes Is., and evidently does not occur in the Gulf of Oman, the Persian Gulf, Reunion Is., Mauritius or Rodrigues Is.

Adults are known to occur largely on outer reef areas, often in association with channels and passes. Spawning aggregation sites have been reported from outer reef areas.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Aldabra, Chagos, Djibouti, Mozambique, Red Sea, Seychelles, Somalia
Creative Commons Attribution 3.0 (CC BY 3.0)

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Range

This species is found throughout the Indo-Pacific Oceans, from the Red Sea and the coast of east Africa to the central Pacific, south from Japan to New Caledonia (5).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Physical Description

Morphology

Dorsal spines (total): 9; Dorsal soft rays (total): 10; Analspines: 3; Analsoft rays: 8
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Size

Maximum size: 2290 mm SL
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Max. size

229 cm SL (male/unsexed; (Ref. 9823)); max. published weight: 191.0 kg (Ref. 9710); max. reported age: 32 years (Ref. 51676)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Diagnostic Description

Adults of this species develop thick lips and a prominent bulbous hump on the forehead. Juveniles pale greenish with elongate dark spots on scales tending to form bars; 2 black lines posteriorly from eye (Ref. 4392).
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Description

Inhabits steep outer reef slopes, channel slopes, and on lagoon reefs from 2 to at least 60 m (Ref. 1602). Usually solitary but may occur in pairs (Ref. 1602). Juveniles are encountered in coral-rich areas of lagoon reefs, where staghorn @Acropora@ corals abound (Ref. 1602). Primary food are molluscs, fishes, sea urchins, crustaceans, and other invertebrates. One of the few predators of toxic animals such as sea hares, boxfishes and crown- of- thorns starfish (Ref. 1602).
Creative Commons Attribution 3.0 (CC BY 3.0)

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Ecology

Habitat

Depth: 1 - 60m.
From 1 to 60 meters.

Habitat: reef-associated. Inhabits steep outer reef slopes, channel slopes, and lagoon reefs (Ref. 1602). Usually solitary but may occur in pairs (Ref. 1602). Juveniles are encountered in coral-rich areas of lagoon reefs, where staghorn @Acropora@ corals abound (Ref. 1602). Primary food are molluscs, fishes, sea urchins, crustaceans, and other invertebrates. One of the few predators of toxic animals such as sea hares, boxfishes and crown-of-thorns starfish (Ref. 1602).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Environment

reef-associated; marine; depth range 1 - 100 m (Ref. 58652)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Habitat and Ecology

Habitat and Ecology
In one study, small post-settlement humphead wrasses were found in a species of seagrass (Enhalys acoroides), four species of hard coral (three Acropora spp. and Porites cylindricus), and in the soft coral Sarcophyton sp. (branching form; M.A. Tupper, pers. comm.). After settlement, juveniles and adults live associated with reef or near-reef habitats of seagrass beds and mangrove areas, with juveniles typically inshore and the largest individuals found in deeper waters of outer reefs or lagoons (Myers 1999). Juveniles of 3–20 cm TL, and larger, occur in coral-rich areas of lagoon reefs, particularly among live thickets of staghorn, Acropora spp. corals, in seagrass beds, murky outer river areas with patch reefs, shallow sandy areas adjacent to coral reef lagoons, and mangrove and seagrass areas inshore (Randall 1955, Randallet al. 1978, Myers 1999, J.H. Choat, pers. comm.). Recruitment patterns may vary considerably between years (M.A. Tupper, unpublished data). Adults are more common offshore than inshore, their presumed preferred habitat being steep outer reef slopes, reef drop-offs, reef tops, channel slopes, reef passes, and lagoon reefs to at least 100 m. They are usually found in association with well-developed coral reefs (Vivien 1973, Randall et all. 1978, Winterbottom et al. 1989, Allen and Swainston 1992, Sluka 2000). Typically they are solitary or paired, but have also been noted in groups of 3–7 individuals (Donaldson 1995). They appear to be somewhat sedentary in that the same individuals, indentifiable by distinct natural markings, may be seen along the same stretch of reef for extended periods. Indeed, many commercial dive sites have their ‘resident’ Humphead Wrasse, a favoured species for divers. Natural densities are evidently never high, even in presumed preferred habitats. For example, in unfished or lightly fished areas, densities may range from two to rarely more than 10–20 individuals per 10,000 m² of suitable reef. In fished areas, however, densities are typically lower by tenfold or more, and in some places fish no longer appear to be present.

Accounts of reproductive activity in the field reveal that, depending on location, this species spawns between several and all months of the year, in small or large groupings, that spawning coincides with certain phases of the tidal cycle, and that groups of spawning fish can form daily, at a range of different reef types. Spawning areas and aggregated adults have been noted regularly along specific sections of reef, sometimes associated with no obvious topographical features, sometimes close to the shelf edge on outer reefs, or adjacent to exposed reef passes near fairly steep drop-offs, or on mid-shelf (unspecified) reefs (P.L. Colin, J.H. Choat, R. Hamilton, S. Oakley, pers. comms.). The species is evidently a daily spawner that probably does not migrate far to its spawning site(s), spawning for extended periods each year, i.e., a ‘resident’ spawner (Domeier and Colin 1997, P.L. Colin, pers. comm.): groups of up to 150 fish were observed in Palau along the shelf edge in a loose aggregation.

Probable spawning aggregations have also been noted on Australia’s Great Barrier Reef (GBR), Fiji, New Caledonia, and in the Solomon Islands. Although spawning was not always observed, aggregated fish were ripe, or exhibiting behaviour likely associated with spawning. On the GBR, aggregations of up to 10 large males and 20–50 smaller fish (35–95 cm TL) were noted (J.H. Choat, pers. comm.). GBR aggregations from the Ribbon Reefs and north of Jewell Reef, once noted to include hundreds of fish, are no longer known at the same sites (Johannes and Squire 1988, L. Squire, pers. comm.).

The longevity of this species is up to at least 32 years, with females outliving the males (the oldest female recorded was 32 years), and sexual maturity is reached at about eight years of age (Choat in Pogonosky et al. 2002). Histological studies show that sexual maturation is reached at a size of between 40 cm and 60 cm total length (Sadovy, unpublished data). This species is thought to be a protogynous hermaphrodite, with sex reversal occurring at about 15 years of age (Choat in Pogonosky et al. 2002). At a total length of approximately 111 cm (Lau and Li 2000). Males grow very rapidly (Choat in Pogonosky et al. 2002).

It feeds on a variety of molluscs, fishes, sea urchins, crustaceans and other invertebrates (Randall et al. 1997).

Systems
  • Marine
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Depth range based on 35 specimens in 1 taxon.
Water temperature and chemistry ranges based on 29 samples.

Environmental ranges
  Depth range (m): 1.5 - 56
  Temperature range (°C): 25.709 - 28.973
  Nitrate (umol/L): 0.046 - 1.251
  Salinity (PPS): 34.379 - 35.312
  Oxygen (ml/l): 4.438 - 4.727
  Phosphate (umol/l): 0.121 - 0.214
  Silicate (umol/l): 0.567 - 4.407

Graphical representation

Depth range (m): 1.5 - 56

Temperature range (°C): 25.709 - 28.973

Nitrate (umol/L): 0.046 - 1.251

Salinity (PPS): 34.379 - 35.312

Oxygen (ml/l): 4.438 - 4.727

Phosphate (umol/l): 0.121 - 0.214

Silicate (umol/l): 0.567 - 4.407
 
Note: this information has not been validated. Check this *note*. Your feedback is most welcome.
Public Domain

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Associated with coral reefs; adults inhabit the outer reef slopes and drop-offs, showing fidelity for particular sites, whilst juveniles are usually found amongst thickets of living staghorn coral (Acropora spp.) (5).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Trophic Strategy

Inhabit steep outer reef slopes, channel slopes, and lagoon reefs. Usually solitary but may occur in pairs. Juveniles are encountered in coral-rich areas of lagoon reefs, where staghorn Acropora corals abound (Ref. 1602, 58534). Adults rove across the reefs by day and rest in reef caves and under coral ledges at night (Ref. 31343). Primary food are molluscs, fishes, sea urchins, crustaceans, and other invertebrates (Ref. 1602).
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Diseases and Parasites

Fish Leech Infestation (Hirudinea sp.). Parasitic infestations (protozoa, worms, etc.)
  • Koesharyani, I., D. Roza, K. Mahardika, F. Johnny, [N.] Zafran and K. Yuasa 2001 Manual for fish disease diagnosis: Marine fish and crustacean diseases in Indonesia. Gondol Research Station for Coastal Fisheries, Central Research Institute for Fisheries, Agency for Agricultural Research and Development and Japan International Cooperation Agency, Indonesia. 57 p. (Ref. 48690)   http://www.fishbase.org/references/FBRefSummary.php?id=48690&speccode=80 External link.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Life History and Behavior

Life Cycle

Oviparous, distinct pairing during breeding (Ref. 205).
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Cheilinus undulatus

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 3 barcode sequences available from BOLD and GenBank.  Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

CCTTTACCTTGTATTCGGTGCCTGAGCCGGCATAGTAGGCACTGCCCTAAGCCTGCTTATCCGGGCAGAACTTAGCCAGCCAGGTGCTCTTCTCGGAGACGATCAGATTTACAATGTCATCGTTACGGCCCACGCCTTCGTTATAATCTTCTTTATAGTAATACCAATCATGATCGGTGGCTTCGGAAACTGGCTAATCCCCCTTATGATCGGTGCCCCAGACATAGCCTTCCCCCGAATGAATAACATGAGTTTCTGACTCCTACCTCCTTCCTTCCTGCTTCTCCTTGCCTCCTCTGGTGTGGAAGCGGGAGCTGGGACCGGTTGGACAGTCTACCCTCCGCTAGCTGGAAACTTAGCTCACGCAGGCGCGTCTGTAGATCTCACAATCTTTTCCCTTCATCTAGCCGGGATCTCTTCCATCCTAGGAGCCATCAACTTTATTACAACTATTATTAACATGAAACCTCCAGCTATTACTCAATACCAAACACCTCTATTCGTGTGGGCCGTCCTAATTACAGCAGTTTTACTTCTTCTCTCCCTTCCTGTGCTCGCCGCCGGCATTACAATACTTTTAACAGACCGAAATCTAAACACCACTTTCTTCGACCCAGCAGGGGGAGGAGACCCAATCCTCTACCAACACTTATNN
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Statistics of barcoding coverage: Cheilinus undulatus

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 5
Specimens with Barcodes: 10
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Conservation

Conservation Status

IUCN Red List Assessment


Red List Category
EN
Endangered

Red List Criteria
A2bd+3bd

Version
3.1

Year Assessed
2004

Assessor/s
Russell, B. (Grouper & Wrasse Specialist Group)

Reviewer/s
Sadovy, Y. & Cornish, A. (Grouper & Wrasse Red List Authority)

Contributor/s

Justification
The Humphead Wrasse is widely distributed but is nowhere common, naturally. Densities rarely exceed 20 fish per hectare in the preferred habitats of outer reefs; more typically not more than 10. Wherever it is fished, even if only moderately, density quickly declines to 25% or less of peak densities recorded at no fishing – this is known from 24 different studies based on fishery-independent data from 11 range states (Sadovy et al. 2003). It appears to be extirpated from several edge of range locations (Sadovy et al. 2003). It is particularly heavily exploited (i.e., high levels of fishing pressure) at the centre of its range in southeastern Asia where its coral reef habitat is most abundant, and particularly in key supply countries for the live reef fish trade, Malaysia and Indonesia, and out of Palawan, its stronghold in the Philippines. In these countries all available fishery-dependent and trade-related data suggest declines over 10–15 years in exploited areas of 10–fold or more with fish now considered rare in areas where once it was common. Buyers of this fish are continually having to source new areas as numbers decline and the pattern of fishing reported is one typical of rapid serial depletions. Much of the capture in all major source countries for live fish are of small fish, mainly juveniles, according to all reliable accounts. Moreover, juveniles are the preferred size range for retailers of live Humphead Wrasse. Severe declines have also been noted nationally wherever the species is taken by speargun at night. Such is the concern for this species that it is one of the only reef fish protected by name (i.e., species name) across a range of countries. It is everywhere accessible to live fish catcher boats which can visit the most remote locations at will. Some spawning aggregations have been noted to decline or have disappeared in eastern Malaysia and Australia.

The total global catch of this species is estimated to be no more than 400 mt annually (Sadovy et al. 2003), yet despite this low volume, severe declines are noted in all places for which data are available and occurring very soon after fishing begins, reducing numbers by more than 50% (see country accounts and summary table) (both fishery-dependent and fishery-independent) and where management is not effective. Much of the trade is now in juvenile fish which is the preferred market size for live fish. It is severely reduced anywhere that it is fished unless a) it is effectively managed, b) there is no export trade or night spearfishing, and c) it is not included in marine protected areas. It is a species that appears to be highly conservation-dependent. There is no regional fishery management authority for this species and FAO does not collect data on it.

The listing of this species as Endangered is based on a population reduction of at least 50% over the last three generations (approximately 30 years) based on an index of abundance and actual or potential levels of exploitation (A2bd). The declines are predicted to continue or even accelerate because of the likely growth of the live fish export trade (A3bd).

This species can live at least 30 years (25 for males and 32 for females) and becomes sexually mature at six years (J.H. Choat, C.R. Davies, J. Ackerman and B.D. Mapstone, unpublished manuscript). This means that its generation time is expected to be in the order of 10 years and that the rate of intrinsic population increase is likely to be low; natural predators are few and natural mortality rate was determined to be 0.14 or less (J.H. Choat, C.R. Davies, J. Ackerman and B.D. Mapstone, unpublished manuscript). The species is particularly vulnerable because the bulk of the fishery for live fish, at least in east Malaysia, southwest Philippines and Indonesia (the major suppliers for the live reef fish trade and the centre of the species’ range) is selective for juvenile sized fish since this is the preferred size class for consumers and gains the highest prices. This selective fishery for animals below but close to the size of sexual maturation has the potential to severely reduce the reproductive capability of exploited populations. The species cannot be artificially cultured (i.e., hatchery produced) to relieve fishing pressure.

The declines are projected to continue or worsen in key source countries for live fish because:
a) The species is one of the two most highly valued fish, economically, in the luxury live reef fish trade on a per kg basis;
b) Of the probable intrinsic vulnerability of such a large and long-lived reef fish, that is also hermaphroditic with relatively few adult males, and an aggregation-spawner, to overfishing; and
c) In places where the species has declined but is still actively sought, fishers only find a few fish a month or a year, at most;
d) The projected growth in the live fish trade, especially into mainland China in the next few years.

Finally, despite regulations in many places, there is much illegal, unregulated and unmonitored trade, according to many verbal accounts by fishers and traders and there is no regional management authority actively engaged in managing this small fishery and FAO does not collect data on it. It only remains abundant where protected or not fished at all. Protective legislation in most places appears to be ineffective.

Follow the link below for a summary of the population data derived from fishery-indepent and fishery dependent sources.

History
  • 1996
    Vulnerable
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Status

Classified as Endangered (EN) on the IUCN Red List (1), and listed on Appendix II of CITES (3).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Population

Population
Abundance estimates on northern Queensland (Australia) reefs are 2.5–3.5 adults per 8000 m² (Choat in Pogonosky et al. 2002).

There are no data on total numbers of this fish globally. However, adults are largely limited to outer reef areas which are a small proportion of the total reef area within its distribution and, even in preferred habitats, densities are very low for a commercially exploited species (rarely > 10 fish per 10,000 square meter when not fished). It is considered uncommon to rare naturally. Nothing is known about the extent of subpopulations or degree of fragmentation but available suitable habitat is a major determinant of its distribution. Some edge of range extirpations are suspected.

The species is hermaphroditic, changing sex from female to male. The sex ratio of samples and fish observed in the field is female biased. Under IUCN criteria for mature individuals, there should be a correction made to factor in the sex bias which effectively reduces substantially the estimates of fish numbers included in this assessment.

Population Trend
Decreasing
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Threats

Endangered (EN) (A2bd+3bd), IUCN Grouper and Wrasse Specialist Group
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Major Threats
Threats include:

1) Intensive and species-specific removal for the live reef food fish export trade of a naturally uncommon and vulnerable species;
2) Readily accessible to spearfishing at night with SCUBA or hookah (i.e., compressed air) gear, and easy to catch with cyanide, or other poisons such as Derris trifoliata, due to predictable adult habitat and shallow depth range;
3) Lack of coordinated, consistent national and regional management largely due to limited management capacity and the sometime secretive nature of traders – in particular there is no relevant regional fishery management authority to address problems with this species;
4) Selective fishing, in particular the intensive take of juveniles for direct export sale and for grow-out (also referred to as ‘culture’ – the species cannot be hatchery reared; and
5) Illegal, unregulated, or unreported (IUU) fisheries (Donaldson and Sadovy 2001).

In addition, the species’ essential coral reef habitat is seriously threatened by human activity throughout the Indo-Pacific region. Destructive fishing practices, such as sodium cyanide use which stuns animals for capture and incidentally kills living coral, have been well documented and are spreading in the Indo-Pacific region (Barber and Pratt 1998, Burke et al. 2002, Bryant et al. 1998, Johannes and Riepen 1995). Despite its prohibition in many countries (including major exporters such as the Philippines and Indonesia), cyanide is still the preferred method for capturing certain live reef fish for international trade in some areas (Burke et al. 2002, Bryant et al. 1998, Johannes and Riepen 1995, Barber and Pratt 1998). Indeed, larger Humphead Wrasse are difficult to catch any other way, other than by night-time capture. When cyanide is applied, the fish often retreats into a crevice and becomes increasingly lethargic as the toxin reduces its ability to take up oxygen. Divers may break away the living coral to get access to the hiding area, and remove the fish to clean water where it will often recover for shipment or holding in net pens.

The most serious threat to this species is overfishing for the live fish export trade. They are mainly taken live for food – only rarely for the aquarium trade as far as can be determined. This species is long-lived and naturally uncommon, and if it is similar to other reef fishes of similar size and biology (e.g., sequential hermaphroditism; aggregation-spawner) it is expected to have low rates of replacement and therefore be particularly vulnerable to fishing pressure (Donaldson and Sadovy 2001). Moreover, being one of the largest of all reef fishes, they have few natural predators which means that fishing mortality may rapidly exceed natural mortality, possibly accounting for the rapid declines noted once fishing intensifies.

Although data are not available from throughout its range, wherever there are significant exports and no effective controls, fish numbers have declined substantially within a decade or less and exploitation rates are expected to continue, or more likely, intensify. There are few refuges for this species since live reef fish carriers have access to all reefs where it occurs and it does not extend into very deep water, probably little more than 60 m. Adults only occur in reasonable numbers where the fishery is effectively managed or where they occur in marine protected areas.

There has been speculation that Humphead Wrasse, and other reef fishes, can be cultured or "farmed" to meet international demand. However, it appears that the use of cultured fish may actually pose a threat to wild populations in certain circumstances since it does not involve hatchery production (not yet possible for this species and unlikely to be possible at commercial levels for many years according to experienced aquarist M.A. Rimmer, pers. comm.) but the grow-out of wild sourced juveniles.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Although the humphead wrasse has a widespread distribution, it has never been common in its range and recent reports have revealed a worrying decline in numbers. Its life history characteristics make this species extremely vulnerable to exploitation and the population can only sustain light levels of fishing (5). Traditionally, the flesh of this fish has been highly prized and more recently this species has become one of the most highly sought species of the Live Reef Food Fish Trade (LRFFT), a luxury food industry that has undergone an increase in popularity in many eastern Asian countries (4). Humphead wrasse can fetch up to US $100 per kilogram at retail in Hong Kong (4), and as their numbers dwindle the rarity of the species is likely to increase the price (5). Cyanide is typically used to catch fish for this trade because live fish are difficult to take any other way; a practice that devastates coral reefs (5).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Management

Conservation Actions

Conservation Actions
Australia
Western Australia – complete protection since May 1998 because stocks determined to be insufficient and susceptible to overfishing. From December 1st, 2003, Coral Reef Fin Fish Management Plan (for Queensland waters, including the Great Barrier Reef Marine Park) prohibited all take and possession of Humphead Wrasse, other than for limited educational purposes and public display.

China
Permits are required for the sale of this species in Guangzhou province, southern mainland China – for conservation purposes.

Indonesia
Fishing permitted if:
- Done by researcher (with research permit) for the purpose of scientific and mariculture development, as well as by artisanal fishers (with specific fishing permit).
- Allowable weights are 1 to 3 kg. Fish with weight less than 1 kg and more than 3 kg should be used for mariculture and/or freed to nature.
- Allowable fishing methods for catching humphead wrasse are hook and line, fish trap and gill net.
- With regards to artisanal fishers involve in fisheries business partnership, the fishers should sell the fish to its collector partners.
- Collector and exporters should develop a rearing and culturing facility in the collection site which is equipped with staff knowledgeable in reef fish culture.
- Provincial Fisheries Services much monitor, control and report on permits and volumes 3-monthly but no data were available despite multiple queries and are apparently not collected.

Maldives
All exports ofumphead Wrasse were banned in 1995, largely due to concern for recreational diving, a sector that values this species.

Niue
The interference, take, kill, or bringing to shore of the Humphead Wrasse is prohibited without written approval.

Palau
Illegal to fish, buy or sell humphead wrasse
Papua New Guinea
There is a 65 cm minimum size limit for exporting Humphead Wrasse but this does not prevent fishers from catching and holding smaller Humphead Wrasse in cages (culturing) until they attain 65 cm TL. All live fish operators are required to obtain licenses.

Philippines
Exports of all live fish are technically prohibited from throughout the Philippines but this part of the code is evidently not implemented. Until recently Humphead Wrasse could not be exported from Palawan with an exemption for the taking of small fish for mariculture. The Palawan regulation is pending reconsideration. There was much illegal movement of this species outside of Palawan for subsequent export.

This species is listed on CITES Appendix II.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Conservation

Little is known of the biology and distribution of the humphead wrasse and more data are urgently needed to understand the scale of the threats faced by current populations, and to implement effective conservation programmes (4). The World Conservation Union's (IUCN) Groupers & Wrasse Species Specialist Group is working to collect this all-important data and to raise awareness of the issues involved throughout the region (4). The species is partially protected in areas of Australia, the Philippines, the Maldives and Palau and was proposed for inclusion in Appendix II of the Convention on International Trade in Endangered Species (CITES) in November 2002 (4). Trade restrictions are particularly important, as this species cannot be hatchery reared and all individuals in trade come from wild populations (6).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Relevance to Humans and Ecosystems

Benefits

Importance

fisheries: minor commercial; aquaculture: commercial; gamefish: yes; aquarium: commercial; price category: very high; price reliability: very questionable: based on ex-vessel price for species in this family
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Wikipedia

Humphead wrasse

Napoleon fish, Blue Corner, Palau.jpg
Napoleon Fish diving in the Red Sea.
A Humphead Wrasse at the water's surface on the Great Barrier Reef.

The humphead wrasse (Cheilinus undulatus) is a wrasse that is mainly found in coral reefs in the Indo-Pacific region. It is also known as the Māori wrasse, Napoleon wrasse, Napoleon Fish, Napoleonfish; and "So Mei" 蘇眉 (Cantonese), "Mameng" (Filipino), and "Merer" in the Pohnpeian language of the Caroline Islands.[1]

Contents

Description [edit]

The humphead wrasse is the largest living member of the family Labridae, with males reaching 6 feet (2 m) in length, while females rarely exceed about 3 feet (1 m). It has thick, fleshy lips and a hump that forms on its head above the eyes, becoming more prominent as the fish ages. Males range from a bright electric blue to green, a purplish blue, or a relatively dull blue/green. Juveniles and females are red-orange above, and red-orange to white below. Some males grow very large, with one unconfirmed report of a Humphead Wrasse that was 7.75 feet (2.29 m) long and weighed 420 lbs (190.5 kg). An even larger specimen is described in Captain Jacques Y. Cousteau's "The Living Sea" as being "...twelve to fifteen feet long and seven to eight feet high." as was quoted by Dumas and Falco. (p. 74)

Ecology [edit]

Adults are commonly found on steep coral reef slopes, channel slopes, and lagoon reefs in water 3 to 330 feet (1–100 m) deep. They are very opportunistic predators preying primarily on crustaceans, mollusks - particularly gastropods- fish, echinoderms. They are one of the few predators of toxic animals such as the sea hare Aplysia and boxfish Ostraciidae and have even been reported preying on crown-of-thorns starfish.[2] This species actively selects branching hard and soft corals and seagrasses at settlement. Juveniles tend to prefer a more cryptic existence in areas of dense branching corals, bushy macroalgae or seagrasses, while larger individuals and adults prefer to occupy limited home ranges in more open habitat on the edges of reefs, channels, and reef passes. The species is most often observed in solitary male-female pairs, or groups of two to seven individuals.

Reproduction [edit]

Individuals become sexually mature at 5 to 7 years and females are known to live for around 30 years whereas males live a slightly shorter 25 years. Humphead wrasse are protogynous hermaphrodites, with some members of the population becoming male at approximately 9 years old[3] The factors that control the timing of sex change are not yet known. Adults move to the down-current end of the reef and form local spawning aggregations (they concentrate to spawn) at certain times of the year.

Conservation [edit]

The humphead wrasse is long lived, but has a very slow breeding rate. Its numbers have declined due to a number of threats. Threats include:

  1. Intensive and species-specific removal in the live reef food fish trade.
  2. Spearfishing at night with SCUBA gear.
  3. Destructive fishing techniques, including sodium cyanide and dynamite
  4. Habitat loss and degradation.
  5. Juveniles being taken from the wild and raised or “cultured” in floating net cages until saleable size.
  6. A developing export market for juvenile humphead wrasse for the marine aquarium trade
  7. Lack of coordinated, consistent national and regional management.
  8. Illegal, unregulated, or unreported (IUU) fisheries.

In December 2003, Australia prohibited all take and possession of humphead wrasse, other than for limited educational purposes and public display. In Guangdong province, southern mainland China, permits are required for the sale of this species; Indonesia allows fishing only for research, mariculture, and licensed artisanal fishing; the Maldives instituted an export ban in 1995; Papua New Guinea prohibits export of fish over 2 feet (65 cm) Total Length; and Niue has banned all fishing for this species.

The humphead wrasse is a U.S. National Marine Fisheries Service Species of Concern. Species of Concern are those species about which the U.S. Government’s National Oceanic and Atmospheric Administration, National Marine Fisheries Service, has some concerns regarding status and threats, but for which insufficient information is available to indicate a need to list the species under the U.S. Endangered Species Act(ESA).

See also [edit]

References [edit]

  1. ^ http://www.trussel2.com/pnp/pnp-m.htm
  2. ^ Randall, J.E., et al. (1978). Food habits of the giant humphead wrasse, Cheilinus undulatus (Labridae). Env. Biol. Fish 3:235-238
  3. ^ Choat, J. H., et al. (2006). Age structure and growth in a large teleost, cheilinus undulatus, with a review of size distribution in labrid fishes. Mar Ecol Prog Ser 318:237-246.
Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

 

Source: Wikipedia

Unreviewed

Article rating from 0 people

Average rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!