Articles on this page are available in 1 other language: Chinese (Simplified) (4) (learn more)

Overview

Comprehensive Description

Biology

Rare species. Inhabits deeper reefs.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Distribution

Indo-West Pacific: South Africa, western Mascarenes, East Coral Sea, Loyalty Islands, Rotuma, Fiji and Wake Atoll east to Pitcairn Group, north to Ryukyu and Ogasawara islands, Taiwan..
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Indian Ocean: South Africa, Reunion (Ref. 33390), Christmas Island (Ref. 30874). Western Pacific: Ogasawara Islands (Ref. 26066) and New Caledonia (Ref. 11897).
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Physical Description

Morphology

Dorsal spines (total): 12; Dorsal soft rays (total): 9; Analspines: 3; Analsoft rays: 5
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Size

Maximum size: 80 mm TL
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Max. size

8.0 cm TL (male/unsexed; (Ref. 4313))
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Diagnostic Description

With dark spots, especially on rear of body and rear fins (Ref. 4313).
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Ecology

Habitat

Environment

reef-associated; marine
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Depth range based on 44 specimens in 1 taxon.
Water temperature and chemistry ranges based on 23 samples.

Environmental ranges
  Depth range (m): 1 - 75
  Temperature range (°C): 22.368 - 28.709
  Nitrate (umol/L): 0.043 - 0.537
  Salinity (PPS): 34.132 - 35.538
  Oxygen (ml/l): 4.531 - 5.032
  Phosphate (umol/l): 0.108 - 0.284
  Silicate (umol/l): 0.829 - 4.892

Graphical representation

Depth range (m): 1 - 75

Temperature range (°C): 22.368 - 28.709

Nitrate (umol/L): 0.043 - 0.537

Salinity (PPS): 34.132 - 35.538

Oxygen (ml/l): 4.531 - 5.032

Phosphate (umol/l): 0.108 - 0.284

Silicate (umol/l): 0.829 - 4.892
 
Note: this information has not been validated. Check this *note*. Your feedback is most welcome.

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Statistics of barcoding coverage: Sebastapistes tinkhami

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 4
Specimens with Barcodes: 8
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Barcode data: Sebastapistes tinkhami

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 4 barcode sequences available from BOLD and GenBank.  Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

CACCCTATACCTAGTATTCGGTGCCTGAGCCGGAATAGTCGGCACCGCTCTAAGCCTTCTAATTCGAGCCGAGCTTAGCCAACCCGGCGCCTTACTGGGGGACGACCAGATTTACAATGTGATTGTTACAGCACATGCTTTCGTAATAATCTTTTTTATGGTTATACCAATCATAATTGGAGGGTTTGGAAACTGGCTTATCCCTCTTATAATTGGGGCCCCAGATATAGCCTTCCCCCGAATGAATAACATAAGCTTCTGACTGCTCCCTCCCTCCTTCCTCCTTCTCCTCGCCTCTTCTGGTGTCGAAGCGGGGGCTGGAACCGGTTGGACAGTCTACCCTCCCCTAGCCGGTAACCTGGCCCACGCCGGTGCCTCCGTGGACCTAACCATCTTCTCCCTTCACCTCGCAGGGATTTCATCAATTCTAGGGGCAATTAACTTCATCACCACTATCATTAATATAAAACCCCCTGCTATCTCACAGTATCAGACACCCCTATTCGTCTGAGCTGTTCTCATTACTGCCGTCCTTCTTCTGCTGTCCCTCCCTGTTCTTGCTGCCGGAATTACAATGCTACTCACAGACCGCAACCTGAACACTACTTTCTTCGACCCGGCAGGGGGCGGAGACCCTATTCTATACCAACATCT
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Conservation

Threats

Not Evaluated
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!