Articles on this page are available in 1 other language: Spanish (1) (learn more)

Overview

Brief Summary

Biology

Known for their spectacular schooling behaviour, the smooth hammerhead gathers into these large groups as juveniles, but as adults they occur singly or in small groups. They hunt for bony fish, small sharks and stingrays and are known to be cannibalistic on occasion. When inshore, their diet consists mainly of skates and stingrays. Pinning their prey down with the hammer, the smooth hammerhead bites chunks from the wings of the stingray until it is immobilised. It is not unusual to see hammerheads with the barbs from stingrays implanted into their heads. In deeper waters they may also feed on crustaceans and cephalopods. In northern Europe, the smooth hammerhead eats mainly herring and bass, and in the Mediterranean, it is known to scavenge from longline fisheries. Other large shark species may prey on juvenile smooth hammerheads, but adults have no natural predators (2). The hammer-shaped head is thought to be a mechanism to spread out the ampullae of Lorenzini – sensory organs that detect electric currents, chemicals in the water, and temperature changes (6). During an 11 – 12 month gestation, the eggs of the smooth hammerhead hatch inside the female's body. The embryos are nourished by a yolk sac placenta and during the summer months, once the yolk sac has been used, between 20 and 40 young sharks hatch. Measuring just 0.5 m at birth, males and females reach maturity at 2.1 – 2.5 m and 2.7 m respectively (2). The smooth hammerhead migrates northward during the summer to find cooler water. When overheating, it can be seen swimming slowly at the surface with the dorsal fin out of the water (5).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Description

A member of a large and easily recognisable group of sharks, the smooth hammerhead can be distinguished from the other hammerhead species by the single notch in the centre of its hammer-shaped head. The eyes are located at either end of the hammer, and the particularly arched mouth is in line with the trail edge of the head (3). Olive-grey above and white below, the smooth hammerhead has a tall and sickle-shaped first dorsal fin and plain pectoral fins with black tips (4).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Comprehensive Description

Biology

Occurs inshore and well offshore (Ref. 5578), over continental and insular shelves (Ref. 244). Coastal, pelagic, and semi-oceanic, but often bottom associated at 1-139 m (Ref. 58302). Migrates northward in summer; young often in large aggregations of hundreds of individuals (Ref. 13562). Prefers to feed on small sharks, skates and stingrays, but also preys on bony fishes, shrimps, crabs, barnacles and cephalopods (Ref. 244). Viviparous (Ref. 50449). Regarded as being dangerous to people, though only few can be tentatively attributed to this species due to its occurrence in temperate waters (Ref. 244). Reported to cause poisoning (Ref. 4690). Caught occasionally by shark and tuna longline fisheries (Ref.58048). Meat utilized fresh, dried-salted, and possibly smoked for human consumption; liver oil for vitamins, fins for soup, hide for leather, and carcasses for fishmeal (Ref. 244). Used in Chinese medicine (Ref. 12166). Become sexually mature when 250 to 300 cm long. The female gives birth to 30 - 40 young (Ref. 35388).
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Description

Common names: hammerhead (English), shark (English), tiburón (Espanol), cornuda (Espanol)
 
Sphyrna zygaena (Linnaeus, 1758)


Smooth hammerhead,     Smooth hammerhead shark



A large hammerhead shark  with broad, narrow-blade lateral extensions on the head; width of hammer 26-29% of TL;  front margin of head broadly convex, with prominent side indentations, but no central indentation; front teeth blade-like, with 1 point, lower teeth straight, upper teeth oblique, deeply notched on rear side, weakly serrate in adults; rear teeth like front teeth; nostrils short, before eyes on head plane; 5 gill slits, last one over front of pectoral fin; 2 dorsal fins, first moderately large and erect, its rear margin concave; second dorsal and pelvic fins low, rear edge of pelvic ~ straight; anal fin base ~ equal to base of second dorsal fin, its rear margin prominently notched; origin of second dorsal fin slightly behind origin of anal fin; transverse pit above tail base crescent shaped, a pit below tail base; tail fin strongly asymmetrical, notched under tip of top lobe, large lower lobe.

Dark olive to dark grey-brown on back and sides, white below; undersides of pectoral fin tips dusky.

Grows to 500 cm and 400kg; size at birth 50-61cm.



A coastal-pelagic and semi-oceanic hammerhead often sighted near the surface.

Depth: 0-200 m.

Circumglobal in tropical and temperate seas; in the eastern Pacific from California to Chile and the Galapagos and Malpelo. Most common in cooler temperate waters.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© Shorefishes of the tropical eastern Pacific online information system. www.stri.org/sftep

Source: Shorefishes of the Tropical Eastern Pacific Online Information System

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Distribution

Cosmopolitan in warm temperate seas, occasionally in tropical seas (including Mediterranean Sea, Black Sea, Madagascar, Mascarenes, Hawaiian Islands).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Azores Exclusive Economic Zone, Belgian Exclusive Economic Zone, Black Sea, European waters (ERMS scope), Greek Exclusive Economic Zone, Gulf of Maine, Haringvliet, Israeli part of the Mediterranean Sea - Eastern Basin, Madagascar, Mauritius, Mozambique, New Zealand Exclusive Economic Zone, North West Atlantic, Portuguese Exclusive Economic Zone, Seychelles, South Africa (country), Spanish Exclusive Economic Zone, United Kingdom Exclusive Economic Zone, Westhinder, Wimereux
Creative Commons Attribution 3.0 (CC BY 3.0)

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Widespread in temperate and tropical seas (Ref. 13562). Western Atlantic: Canada to the Virgin Islands; Brazil to Argentina. Eastern Atlantic: British Isles to Côte d'Ivoire, including the Mediterranean. Indo-Pacific: South Africa to Sri Lanka; southern Siberia to Viet Nam (Ref. 13562); southern Australia, New Zealand, and Hawaii (Ref. 13562). Eastern Pacific: northern California, USA to Chile.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Range Description

This shark is found in coastal and open ocean (Domingo in prep) temperate and tropical waters, with a wider range than other members of its family (Compagno in prep). The full extent of this species? range in tropical waters may be incompletely known at present, due to probably confusion with the more abundant Scalloped Hammerhead (S. lewini) (Compagno in prep).

Western Atlantic: From Nova Scotia to Florida, USA and Virgin Islands to southern Argentina (Compagno in prep, Domingo in prep, Last and Stevens 1994).

Eastern Atlantic: From the UK and as a vagrant in the North Sea, southwards, including the Mediterranean Sea, where has been reported as more common in the western basin (Buencuerpo et al. 1998), to Mauritania, Senegal, Cape Verde Islands, Guinea, Ivory Coast, and Angola (Compagno in prep, Last and Stevens 1994).

Indian Ocean: South Africa and southern Mozambique, Comoros Islands, southern India, Sri Lanka, and Australia (Western Australia, South Australia, Victoria, Tasmania) (Compagno in prep, Last and Stevens 1994).

Western Pacific: From Viet Nam (Gulf of Tonkin) to Japan and southern Russia in the Northwest Pacific. Australia (New South Wales), New Zealand, Lord Howe and Kermadec Islands in the Southwest Pacific (Compagno in prep, Last and Stevens 1994).

Eastern Pacific: From northern California, USA, to Gulf of California, Mexico, Panama, and from Ecuador to Chile, including Galapagos Islands (Compagno in prep, Last and Stevens 1994).

Also occurs off the Hawaiian Islands, USA and possibly off Samoa (Compagno in prep, Last and Stevens 1994).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Southern New England to northern Argentina, straying north to Massachusetts Bay and Nova Scotia.
Creative Commons Attribution 3.0 (CC BY 3.0)

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Widespread in the tropical to warm temperate belts of the Atlantic, the Pacific, and also found in the Indian Ocean. Has been found in southern New England, straying to Massachusetts Bay and as far as Halifax, Nova Scotia.
  • Bigelow, H. B. and Schroeder, W. C.,1953; Compagno, L. J. V., 1984; Compagno, L. J. V., D. A. Ebert and M. J. Smale, 1989; Last, P. R. and J. D. Stevens, 1994; Compagno, L. J. V. and V. H. Niem, 1998.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Gulf of Maine - CoML

Source: Gulf of Maine Area Census of Marine Life

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Depth

Depth Range (m): 0 (S) - 200 (S)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© Shorefishes of the tropical eastern Pacific online information system. www.stri.org/sftep

Source: Shorefishes of the Tropical Eastern Pacific Online Information System

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Zoogeography

See Map (including site records) of Distribution in the Tropical Eastern Pacific


 
Global Endemism: All species, TEP non-endemic, Circumtropical ( Indian + Pacific + Atlantic Oceans), "Transpacific" (East + Central &/or West Pacific), All Pacific (West + Central + East), East Pacific + Atlantic (East +/or West), Transisthmian (East Pacific + Atlantic of Central America), East Pacific + all Atlantic (East+West)

Regional Endemism: All species, Eastern Pacific non-endemic, Tropical Eastern Pacific (TEP) non-endemic, Continent + Island (s), Continent, Island (s)

Residency: Resident

Climate Zone: North Temperate (Californian Province &/or Northern Gulf of California), Northern Subtropical (Cortez Province + Sinaloan Gap), Northern Tropical (Mexican Province to Nicaragua + Revillagigedos), Equatorial (Costa Rica to Ecuador + Galapagos, Clipperton, Cocos, Malpelo), South Temperate (Peruvian Province )

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© Shorefishes of the tropical eastern Pacific online information system. www.stri.org/sftep

Source: Shorefishes of the Tropical Eastern Pacific Online Information System

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Range

The smooth hammerhead is widespread in temperate and tropical waters, including the Atlantic, Pacific and Indian Oceans and the Mediterranean and Black Seas. It migrates northward in search of cooler waters for the summer months (3).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Physical Description

Morphology

Dorsal spines (total): 0; Dorsal soft rays (total): 0; Analspines: 0; Analsoft rays: 0
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Size

Length max (cm): 500.0 (S)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© Shorefishes of the tropical eastern Pacific online information system. www.stri.org/sftep

Source: Shorefishes of the Tropical Eastern Pacific Online Information System

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Size

Maximum size: 4000 mm TL
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Max. size

500 cm TL (male/unsexed; (Ref. 35388)); max. published weight: 400.0 kg (Ref. 9987)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

to 500 cm. TL; max.weight: 400 kg.
  • Bigelow, H. B. and Schroeder, W. C.,1953; Compagno, L. J. V., 1984; Compagno, L. J. V., D. A. Ebert and M. J. Smale, 1989; Last, P. R. and J. D. Stevens, 1994; Compagno, L. J. V. and V. H. Niem, 1998.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Gulf of Maine - CoML

Source: Gulf of Maine Area Census of Marine Life

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Diagnostic Description

A large hammerhead with a notch at the center of head; 1st dorsal fin moderately high, 2nd dorsal and pelvic fins low (Ref. 5578). Olive-grey or dark grey above, white below (Ref. 5578). Fins nearly plain, dusky or blackish tipped (Ref. 13562).
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Description

Coastal-pelagic and semi-oceanic. Often found in shallow water over the continental and insular shelves. Enters tropical waters during the winter (Ref. 9710). Feeds chiefly on fish and crustaceans but stingrays serves as a major diet in the warm waters (Ref. 2858). Juveniles live near the coasts. Fast-moving (Ref. 5213). Reported to cause poisoning (Ref. 4690). Meat utilized fresh, dried salted, and possibly smoked for human consumption, liver oil for vitamins, fins for soup, hide for leather and carcasses for fishmeal.
Creative Commons Attribution 3.0 (CC BY 3.0)

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Ecology

Habitat

Depth: 0 - 200m.
Recorded at 200 meters.

Habitat: benthopelagic.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Environment

pelagic-oceanic; oceanodromous (Ref. 13562); brackish; marine; depth range 0 - 200 m (Ref. 5578), usually 0 - 20 m (Ref. 55303)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Habitat and Ecology

Habitat and Ecology
The large majority of the information for this section is taken from Simpfendorfer (2005).

The Smooth Hammerhead is a coastal-pelagic and semi-oceanic and occurs on the continental shelf, to 200 m depth (Ebert 2003). Smale (1991) reported that large individuals were commonly found over deep reefs on the edge of the continental shelf. The species has also been observed in freshwater in Indian River, Florida, USA (G. Burgess pers. comm.) and in the Rio de la Plata estuary in Uruguay (Doño 2008, Domingo in prep.). In the demersal gillnet fishery in southern Western Australia, juvenile S. zygaena are caught on the bottom in depths from the shore to at least 60 m (C. Simpfendorfer pers. comm.). Compagno (in prep.) reports that this species occurs at or near the surface in the East China Sea, whereas S. mokarran and S. lewini range into deeper water in this area. The nursery habitat of this species is smooth sandy substrate in shallow waters, down to depths of 10m. Large schools of juvenile S. zygaena have been reported from off South Africa (Bass et al. 1975). Off southern Brazil in South America, S. zygaena occurs at depths of 10?100 m (Kotas 2004, Vooren et al. 2005). Nursery areas and juveniles have been reported in coastal waters off Uruguay from mid-Rio de la Plata to the Atlantic Ocean bordering with Brazilian waters from November to March at temperatures of 16?23°C and salinities of 12?27 ups (Doño 2008, Domingo in prep.).

There are only limited published biological data on S. zygaena, despite its widespread occurrence. Compagno (1984, in prep.) reported that the species reaches a maximum size of 370?400 cm total length (TL). Stevens (1984) reported that off the east coast of Australia males mature at about 250?260 cm TL and females at about 265 cm TL. Castro and Mejuto (1995) reported gravid females between 220 and 255 cm fork length (FL), but gave no relationship between fork and total length. Bass et al. (1975) reported a female S. zygaena from South Africa that appeared to have recently mated in February and another female caught in November that contained full-term embryos. Stevens (1984) reported that off the east coast of Australia parturition occurs between January and March, with ovulation at about the same time. The gestation period off eastern Australia would appear to be 10?11 months. Castro and Mejuto (1995) reported 21 gravid females with a mean litter size of 33.5 from the waters of western Africa. Off eastern Australia Stevens (1975) reported litter sizes between 20?49 (mean 32). The sex ratio of embryos is 1:1 (Stevens 1984, Castro and Mejuto 1995). Compagno (1984, in prep) gave the size at birth as 50?61 cm. Smale (1991) and Doño (2008) reported juveniles with open umbilical scars from South Africa at sizes between 59 and 63 cm, and from Uruguay between 49 and 55 cm TL, respectively. Possible pupping grounds and nursery areas for this species include the northern Gulf of California and shallow coastal waters off southern Brazil and Uruguay (Vooren 1997, 1999, Vooren and Klippel 2005, Doño et al. in prep). In Uruguay pupping grounds and nursery areas were reported in coastal waters by Doño (2008).

Although maximum age has yet to be determined for this species, it is thought that the lifespan of the smooth hammerhead may be 20 years or longer (FLMNH 2008). Further information is required on the biology and life-history parameters of this species.

Squid and teleosts are the most common prey. Based on specimens caught by recreational anglers off New South Wales, Australia, Stevens (1984) reported that 76% of specimens with food in their stomachs contained squid and 54% teleosts. For S. zygaena less than 2 m in length from the waters off South Africa, Smale (1991) reported that the diet was dominated by inshore squid (mostly Loligo v. reynaudii), with teleosts such as Hake, Horse Mackerel and Ribbonfish also important. Crustaceans and elasmobranchs have also been reported from stomach analyses (Bass et al. 1975, Compagno 1984, Smale 1991, Last and Stevens 1994). Compagno (1984) reported that sharks and rays were a favoured food, presumably of larger specimens. However, of 145 S. zygaena from South Africa examined by Dudley and Cliff (1993) only 0.7% contained elasmobranch prey.

Systems
  • Marine
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

found in shallow coastal waters; enters bays
Creative Commons Attribution 3.0 (CC BY 3.0)

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

nektonic
Creative Commons Attribution 3.0 (CC BY 3.0)

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Depth range based on 198 specimens in 1 taxon.
Water temperature and chemistry ranges based on 46 samples.

Environmental ranges
  Depth range (m): 0 - 2430
  Temperature range (°C): 3.050 - 22.758
  Nitrate (umol/L): 0.441 - 19.278
  Salinity (PPS): 34.213 - 36.255
  Oxygen (ml/l): 2.346 - 5.965
  Phosphate (umol/l): 0.215 - 1.546
  Silicate (umol/l): 1.104 - 23.567

Graphical representation

Depth range (m): 0 - 2430

Temperature range (°C): 3.050 - 22.758

Nitrate (umol/L): 0.441 - 19.278

Salinity (PPS): 34.213 - 36.255

Oxygen (ml/l): 2.346 - 5.965

Phosphate (umol/l): 0.215 - 1.546

Silicate (umol/l): 1.104 - 23.567
 
Note: this information has not been validated. Check this *note*. Your feedback is most welcome.
Public Domain

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Benthopelagic; brackish; marine. Depth range 0-200 m. Occurs inshore and well offshore, over continental and insular shelves. Migrates northward in summer; young often in large aggregations of hundreds of individuals.
  • Bigelow, H. B. and Schroeder, W. C.,1953; Compagno, L. J. V., 1984; Compagno, L. J. V., D. A. Ebert and M. J. Smale, 1989; Last, P. R. and J. D. Stevens, 1994; Compagno, L. J. V. and V. H. Niem, 1998.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Gulf of Maine - CoML

Source: Gulf of Maine Area Census of Marine Life

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Salinity: Marine, Marine Only

Inshore/Offshore: Offshore, In & Offshore, Inshore

Water Column Position: Mid Water, Near Bottom, Water column only

Habitat: Water column

FishBase Habitat: Bentho-Pelagic
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© Shorefishes of the tropical eastern Pacific online information system. www.stri.org/sftep

Source: Shorefishes of the Tropical Eastern Pacific Online Information System

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Preferring shallow waters, the smooth hammerhead in usually found inshore over continental shelves, or in bays and estuaries. It may also be found well offshore in deeper waters, particularly when migrating. The smooth hammerhead has also been seen in freshwater habitats such as the Indian River, along the coast of Florida, USA (2).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Migration

Oceanodromous. Migrating within oceans typically between spawning and different feeding areas, as tunas do. Migrations should be cyclical and predictable and cover more than 100 km.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Trophic Strategy

A carnivore (Ref. 9137).
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Feeds on small sharks, skates and stingrays, but also preys on bony fishes, shrimps, crabs, barnacles and cephalopods.
  • Bigelow, H. B. and Schroeder, W. C.,1953; Compagno, L. J. V., 1984; Compagno, L. J. V., D. A. Ebert and M. J. Smale, 1989; Last, P. R. and J. D. Stevens, 1994; Compagno, L. J. V. and V. H. Niem, 1998.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Gulf of Maine - CoML

Source: Gulf of Maine Area Census of Marine Life

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Feeding

Feeding Group: Carnivore

Diet: mobile benthic crustacea (shrimps/crabs), octopus/squid/cuttlefish, bony fishes, sharks/rays
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© Shorefishes of the tropical eastern Pacific online information system. www.stri.org/sftep

Source: Shorefishes of the Tropical Eastern Pacific Online Information System

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Life History and Behavior

Life Cycle

Viviparous, placental (Ref. 50449), with 20 to 50 young per litter (Ref. 6871)after a gestation period of 10-11 months (Ref.58048). Size at birth between 50-60 cm TL (Ref. 13562).
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Reproduction

Become sexually mature when 250 to 300 cm long. The female gives birth to 30 -40 young per litter . Size at birth between 50-60 cm. TL.
  • Bigelow, H. B. and Schroeder, W. C.,1953; Compagno, L. J. V., 1984; Compagno, L. J. V., D. A. Ebert and M. J. Smale, 1989; Last, P. R. and J. D. Stevens, 1994; Compagno, L. J. V. and V. H. Niem, 1998.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Gulf of Maine - CoML

Source: Gulf of Maine Area Census of Marine Life

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Egg Type: Live birth, No pelagic larva
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© Shorefishes of the tropical eastern Pacific online information system. www.stri.org/sftep

Source: Shorefishes of the Tropical Eastern Pacific Online Information System

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Sphyrna zygaena

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 23 barcode sequences available from BOLD and GenBank.  Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

CCTTTACCTAATTTTTGGTGCATGAGCAGGTATAGTTGGGACAGCCCTAAGTCTCTTAATTCGAGCTGAACTTGGGCAACCAGGATCTCTTCTAGGAGATGACCAGATTTATAATGTAATTGTAACCGCCCACGCTTTCGTAATAATCTTTTTTATAGTTATGCCAATCATAATTGGTGGCTTCGGGAATTGATTAGTTCCTTTAATAATTGGTGCACCAGACATGGCCTTCCCACGAATAAATAACATAAGTTTCTGACTTCTTCCACCATCATTTCTTCTCCTCCTAGCTTCTGCTGGGGTAGAAGCTGGAGCAGGAACTGGTTGAACAGTTTATCCTCCATTAGCTAGCAATTTAGCCCATGCTGGACCATCCGTTGACTTAGCTATTTTTTCTCTTCATTTAGCTGGTGTATCATCAATCTTAGCCTCAATCAATTTTATTACAACTATTATCAATATAAAACCCCCAGCCATCTCCCAATATCAAACACCACTATTTGTTTGATCTATCCTTGTAACTACTATTTTACTTCTCCTCTCACTTCCAGTTCTTGCAGCAGGGATTACAATATTACTTACAGATCGTAACCTTAATACTACATTCTTTGATCCCGCAGGAGGAGGAGATCCAATTCTTTATCAACACTTATTC
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Statistics of barcoding coverage: Sphyrna zygaena

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 26
Specimens with Barcodes: 76
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Conservation

Conservation Status

IUCN Red List Assessment


Red List Category
VU
Vulnerable

Red List Criteria
A2bd+3bd+4bd

Version
3.1

Year Assessed
2005

Assessor/s
Casper, B.M., Domingo, A., Gaibor, N., Heupel, M.R., Kotas, E., Lamónaca, A.F., Pérez-Jimenez, J.C., Simpfendorfer, C., Smith, W.D., Stevens, J.D., Soldo, A. & Vooren, C.M.

Reviewer/s
Valenti, S.V., Fowler, S.L. (Shark Red List Authority)

Contributor/s

Justification
This assessment is based on the information published in the 2005 shark status survey (Fowler et al. 2005).

The Smooth Hammerhead (Sphyrna zygaena) is one of the larger hammerhead sharks, found world-wide in temperate and tropical seas, with a wider range than other members of its family. It is semipelagic and occurs on the continental shelf. Although few data are available on the Smooth Hammerhead?s life-history characteristics, it is a large hammerhead shark and presumably at least as biologically vulnerable as S. lewini. This species is caught with a wide variety of gears in both coastal and oceanic fisheries, as bycatch and a target. Therefore in some areas, all size classes and reproductive stages are susceptible to capture. The Smooth Hammerhead?s large fins are highly valued for their high fin ray count and they are being increasingly targeted in some areas in response to increasing demand for the fin trade. Few species-specific data are available to assess population trends because catches of hammerhead sharks are often grouped together under a single category. Very often these sharks are finned and the carcasses discarded. This species has sometimes been confused with S. lewini in the tropics and these two species are probably misidentified with each other in some areas. Time series data on population trends in hammerhead sharks, including S. zygaena, are available from the Northwest and Western Central Atlantic and the Mediterranean Sea. In the Northwest and Western Central Atlantic, where S. zygaena is outnumbered by S. lewini by about ten to one, analysis of U.S. pelagic longline logbook data estimated that Sphrynidae (including S. lewini, S. mokarran and S. zygaena) declined in abundance by 89% since 1986. In the Mediterranean Sea, where S. zygaena outnumbers S. lewini, compilation and meta-analysis of time series abundance indices estimated that Sphrynidae (including S. lewini, S. mokarran and S. zygaena) declined by >99% in abundance and biomass since the early 19th century. While very steep declines have been recorded in these areas, the species is afforded some refuge in other areas of its range, such as southern Australia, where it is abundant and fishing pressure is low. The species is currently assessed as Vulnerable globally and further investigation into threats, population trends, catches and life-history parameters throughout its range is required to determine whether it may warrant a higher category in the future.

History
  • 2000
    Lower Risk/near threatened
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

IUCN Red List: Listed, Near threatened

CITES: Not listed
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© Shorefishes of the tropical eastern Pacific online information system. www.stri.org/sftep

Source: Shorefishes of the Tropical Eastern Pacific Online Information System

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Status

The smooth hammerhead is classified as Lower Risk – near threatened (LR/nt) on the IUCN Red List (1).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Population

Population
Specific data on populations of this species are generally unavailable in many areas because hammerhead shark catches are often grouped to include several Sphyrna species. Furthermore, this species has sometimes been confused with the Scalloped Hammerhead (S. lewini) in the tropics and these two species are probably misidentified with each other.

Population Trend
Decreasing
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Threats

Vulnerable (VU) (A2bd+3bd+4bd)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Major Threats
Smooth Hammerhead is caught with a variety of gears, including with pelagic longlines, handlines, gillnets, purse-seines and pelagic and bottom trawls (Bonfil 1994, Compagno in prep, Maguire et al. 2006). In a review of world elasmobranch fisheries Bonfil (1994) listed S. zygaena as being reported in catches from directed shark fisheries off the east and west coasts of the USA, Brazil, Spain, Taiwan and Philippines. It also is taken in the shark fishery off south-western Australia (Heald 1987) and western Africa (Castro and Mejuto 1995). This shark is undoubtedly caught in shark fisheries in other parts of its range, but has not been reported separately from other hammerhead species. Very often these sharks are finned and the carcasses discarded. Bonfil (1994) also reported that this species is caught as bycatch in a number of non-shark fisheries, particularly pelagic longline and gillnet fisheries that operate close to temperate and subtropical continental shelves (e.g., South Pacific driftnet fishery, Mediterranean drift net fishery, Spanish longline fishery operating in the Mediterranean Sea and eastern Atlantic Ocean, and Indian Ocean tuna longline fishery). The capture of S. zygaena in many of these fisheries is infrequent (Bonfil 1994). Although size data are limited, catches in pelagic fisheries appear to be dominated by larger individuals, while juveniles are common in inshore shelf fisheries.

This species? fins are highly valued and they are being increasingly targeted in some areas in response to increasing demand for shark fins. Hammerhead shark species S. zygaena and S. lewini were found to represent at least 4?5% of the fins auctioned in Hong Kong, the world?s largest shark fin trading center (Clarke et al. 2006a). Hammerhead shark fins are generally high value compared to other species because of their high fin ray count (S. Clarke unpubl. data). It is estimated that between 1.3 and 2.7 million S. zygaena and/or S. lewini are represented in the shark fin trade each year or, in biomass, 49,000 to 90,000 mt (Clarke et al. 2006b).

Catches of Sphyrnidae have been reported only from the Atlantic Ocean since 1991 and these landings are undoubtedly under-reported. The catch was near 2,200 tonnes in 2004 (Maguire et al. 2006). Only S. zygaena and S. lewini are reported as individual species in the Food and Agriculture Organisation (FAO) fisheries statistics, but hammerhead catches are often grouped in one category as, Sphyrna species, which makes identification of actual catches of S. zygaena difficult.

Northeast Atlantic and Mediterranean Sea
The Smooth Hammerhead appears to be less common in the central Mediterranean, in comparison to the western regions of this sea. Buencuerpo et al. (1998) reported that 757 specimens were captured during their pelagic longline and gillnet survey from July 1991-July 1992 off southern Spain. Most of these specimens were presumed to be part of the Atlantic population. In the Northeast Atlantic and Mediterranean Sea this species is mainly caught by longlines and gillnets, particularly as bycatch in tuna and swordfish fisheries. Despite a ban on driftnetting in Mediterranean waters, this practice continues illegally (WWF 2005). A recent study of the Moroccan driftnet fleet operating in the Alboran Sea (southwest Mediterranean) and around the Strait of Gibraltar by Tudela et al. (2005) indicates that pelagic fishing pressure in this area is beyond the reproductive capacity of several other semi-oceanic shark species that were previously caught with S. zygaena (such as Alopias vulpinus). Some of these vessels appear to be increasingly targeting sharks by deploying driftnets closer to shore (Tudela et al. 2005). Sphyrna zygaena is not mentioned in this study. However, this species was reported in Buencuerpo et al.?s (1998) survey of longline and gillnet landings from the same area in 1992. Buencuerpo et al. (1998) report the highest catches of Sphyrna zygaena in the Spanish swordfish fishery from the western African coasts and near the Strait of Gibraltar.

Ferretti et al. (2008) compiled nine time series of abundance indices from commercial and recreational fishery landings, scientific surveys and sighting records, to reconstruct long-term population trends of large sharks in the northwestern Mediterranean Sea. Of the taxa for which there were enough data to investigate, hammerhead sharks (Sphyrna spp) declined the fastest; they appeared to disappear from coastal waters after 1963 and catches declines consistently in pelagic waters in the early 1980s in all sectors. Meta-analysis showed an average instantaneous rate of decline of -0.17 (CI 95%: ?0.34, ?0.003; time range 178 years) in abundance and -0.36 (CI 95%: -0.56, -0.1?6; time range: 107 years) in biomass, which translated into an estimated species decline of >99.99% in both cases. Walker et al. (2005) also report that the species has virtually disappeared from the central-southern Mediterranean Sea since 1986.

Mejuto et al. (2002) estimate landings of 240 tons of Sphyrna spp. And 1.1 ton of Sphyrna zygaena in the North Atlantic for the Spanish Surface longline fleet in 1999. De la Serna et al. (2002) reported only eight specimens of S. zyagaena (0.05%) in a total 17,759 sharks caught during a survey of the Spanish Mediterranean Fisheries from 1997?1999. This is significantly lower when compared to results of the same fishery along the west African coast and Iberian peninsula (where 757 specimens in period July 1991?July 1992 were caught). Megalofonou et al. (2000) only recorded four specimens during their survey of shark bycatches and discards in Mediterranean large pelagic fisheries in 1998?1999 (one in the Adriatic, two in the Ionian Sea and one in Spanish Mediterranean waters). There are few recent records of Sphyrna species in the eastern Mediterranean Sea. A total of 16 records of S. zygaena were collected in the eastern Adriatic from the 19th century to the 1950s, including reported catches were distributed throughout whole of the eastern coast. A higher number of records were reported during the 19th century in comparison to the 20th century (10 vs. 6, respectively) and the species has not been reported in this area since 1956 (Soldo and Jardas 2002). Although it occurs in open waters of southern Adriatic, it is only caught very rarely (Bello 1999). There were only 13 records of S. zygaena in the Northern Tyrrhenian and Ligurian Seas from the 1960s-1995 and there are no reports of this species during the last five years (F. Serena pers. comm.).

Northwest Atlantic
Longline fleets exert intense fishing pressure throughout the Northwest Atlantic (Baum et al. 2003). Baum et al. (2003) estimated that hammerhead sharks (grouped data for S. lewini, S. mokarran and S. zygaena) have declined in abundance by 89% since 1986 (95% confidence interval (CI): 86 to 91%) in their analysis of U.S. pelagic longline logbook data. This group is primarily composed of S. lewini; in Virginia Institute of Marine Science sampling programmes since 1973, S. lewini outnumbered S. zygaena by more than ten to one (Ha 2006).

Southwest Atlantic
In the Southwest Atlantic S. zygaena faces two main threats related to fisheries: catches of juveniles and pups along the continental shelf by different fishing gears (mainly bottom gillnets and trawlers (Vooren and Lamónaca 2003, Kotas and Petrere 2002, Doño 2008); and adult and juvenile catches by gillnets and longlines throughout the continental shelf and oceanic environments for the international fin market (Kotas et al. 2001, Kotas and Petrere 2002ab, Kotas and Petrere 2003, Zerbini and Kotas 1998, Domingo in prep). The species therefore faces intensive fishing pressure at all points in its life-cycle in this area. Off southern Brazil; from 1983?2005, indices of abundance of neonates of S. zygaena varied from 1?5% of the abundance of those of S. lewini in the same area (Vooren et al. 2005). Catches of neonates, juveniles and adults are taken by longline fleets based in Itajaí, which operate along the coast of southern Brazil (Kotas and Petrere 2002). The species is also a known bycatch of domestic, as well as Taiwanese, Japanese and other international longline fishing fleets operating throughout the South Atlantic Ocean (Joung et al. 2005, Matsushita and Matsunaga 2002). Juveniles and adults are also taken as bycatch by longline fleets operating in shelf and oceanic waters off Uruguay and Brazil (200-3000m). Given the declining trends apparent in other areas of the species? range where it is heavily fished, for example the Mediterranean Sea, the population in the Southwest Atlantic may be unable to withstand continued fishing pressure.

Eastern Pacific
Sphyrna zygaena is taken as both target and bycatch in artisanal and industrial fisheries along the eastern Pacific coast of the Americas. Landings of this species in Guatemala, Costa Rica, Panama and Mexico have been reported as 1% of the total chondrichthyan catch. Seasonal surveys of fisheries on the eastern coast of Mexico, conducted during 1998?1999, showed that S. zygaena was a common component of the landings of directed shark fisheries. The majority of those landed were juveniles in many areas (Bizzaro et al. 2007). This study reports that large sharks, such as S. zygaena were usually targeted in directed drift gillnet, or to a lesser extent, surface longline fisheries. Márquez-Farías (2000) report an overall decline in catch rates for all shark species in the Gulf of California. This species has also been reported as bycatch in longline, bottom trawl and gillnets in the landings of other Central and South American countries, down to Peru. In Ecuador, S. zygaena represents 11% of the total chondrichthyan landings. There is a high proportion of juveniles in these Ecuadorian landings; 91% of female (measuring <240 cm TL) and 89% of male (measuring <215 cm TL) specimens landed by the Ecuadorian fleet are juveniles (Martinez in prep). In Peru, S. zygaena represented 12.5% of total chondrichthyan landings over the period 1996-2005 (Romero, M. PANtiburones).

An artisanal fishing fleet targeting sharks south of Tres Marias Islands in the Central Mexican Pacific operated out of La Cruz Huanacaxtle from the early 1990s to 1997, after which they moved to Yavaros in the Central Gulf of California, apparently following the migratory movements of some of the shark species (Pérez-Jiménez et al. 2005). Pérez-Jiménez et al. (2005) monitored the shark landings of this fleet from 1995?1996. Sphyrna zygaena was the most important of 10 species recorded in 607 sets taken south of the Tres Marias Islands, composing 35% of 2,004 sharks recorded. This artisanal fleet has not caught sharks south of the Tres Marias Islands or in the Central Gulf of California since the late-1990s (Pérez-Jiménez et al. 2005).

Illegal fisheries target sharks for their fins around the Galapagos Islands. There are no specific data for these fisheries, but given the high value of its fins, it is very likely that it is targeted in illegal finning activities. Illegal fishing in this area is not only practiced by fishermen from the Galapagos, but also by the industrial and artisanal fleets from continental Ecuador and international fleets (Coello 2005). Divers and dive guides in the Galapagos have noted a severe decrease in shark number and schools of hammerhead sharks (P. Zarate pers comm.). The Ecuadorian Government issued a decree in 2004 prohibiting fin export from Ecuador, in an attempt to help stop illegal finning in the Galapagos. Unfortunately the Decree had the reverse effect of establishing illegal trade routes with fins now being exported mainly via adjacent Peru and Colombia, where there is no regulation banning finning. Interviews within fishermen and traders in both Ecuador and Peru suggest that there are illegal trade routes for fins transported both from continental Ecuador and directly from the Galapagos to Peru, and illegal finning activity is ongoing (Sáenz 2005, WildAid 2005).

Hammerhead sharks, including S. zygaena, are also caught by international purse seine fleets targeting tunas in the high seas of the Eastern Pacific, particularly those associated with Fish Aggregating Devices (FADs) (Román-Verdesoto and Orozco-Zöller 2005). IATTC conducted a one year species sampling programme to determine the accuracy of identification by fisheries observers on these vessels. Sphyrna zygaena was found to represent 1.7% and S. lewini, 3.6% of the sharks recorded during this programme, respectively.

Australia
In the West Australian demersal gillnet fishery Sphyrna zygaena is an important bycatch species, but appears not to be impacted by this low fishing pressure. The species is reasonably abundant around the northern North Island of New Zealand, and the most abundant shark species recorded in aerial surveys along the northwest coast. In New Zealand, neonates and small juveniles are a common bycatch in commercial gillnet fisheries for flatfish, and are also commonly taken by trawlers and Danish seiners. They are usually discarded, although juveniles discarded from gillnets are usually dead. Adults are mainly taken by gamefishers as bycatch when targeting marlin with live baits, and consequently the annual catch is small. Many of the sharks taken by game fishers are released alive (C. Duffy, pers. comm.). S. zygaena is abundant in the region, and significant numbers of adults do not appear to be taken in commercial fisheries.

Sphyrna zygaena, along with S. lewini and S. mokarran, are exploited by the commercial line fishery and recreational game fishery off New South Wales. The majority of the hammerhead catch in commercial and recreational fisheries is composed of S. zygaena and S. lewini (Scandol et al. 2008). Total commercial hammerhead landings peaked in 1993/94 at 15/7 t. Annual commercial catches have averaged ~3 t in the last five years. Most hammerhead landings come from the Ocean Trap and Line Fishery (74%), but they are also taken in the Estuary General and Ocean Trawl Fisheries.

Information on catches of S. zygaena by recreational anglers is very limited due to the lack of species identification. Total catch of hammerhead sharks by recreational gamefishing and protective beach meshing remained at about 250 sharks per year between the 1970s and 2001, with >95% of recreational gamefishing catches being tagged and released. It is likely that S. zygaena is caught in recreational fisheries off temperate and subtropical coasts. This species has also been reported from nets set in the New South Wales beach protection programme (Krough 1994). This employs large mesh gillnets to catch large sharks as a measure to protect beach users from shark attack. In the New South Wales programme, hammerheads (mostly S. zygaena) made up nearly 50% of the catch of 4,715 sharks in the period from 1972?73 to 1989?90 (Reid and Krough 1992). The large mesh nets used by shark control programmes appear to be very efficient at catching hammerhead sharks, including S. zygaena, while catches are very low on the large baited lines used in some programmes (Simpfendorfer 1993).

Indo-West Pacific
Hammerhead sharks, including S. zygaena, are taken in a variety of artisanal and commercial fisheries in this region as both target and bycatch, however, no reliable species specific data are available because catches tend to be grouped into ?Sphyrna spp.?, if recorded at all. Pelagic fisheries have operated in the Indian Ocean for more than 50 years; Japanese long-liners in the eastern Indian Ocean since 1952 and in the western region since 1956. Russian, Taiwanese and South Korean vessels have fished there since 1954?1966 (Gubanov and Paramonov 1993). The Spanish swordfish longline fishery, which also targets sharks, is also active across the Indian Ocean (ICCAT 2005). Large hook and line and in mesh gillnet fisheries are known to target sharks off India, where this species occurs (Anderson and Simpfendorfer 2005). Finning and discarding of carcasses has also been reported, especially in offshore and high seas fisheries (Anderson and Simpfendorfer 2005). A recent review of fisheries in the Indian Ocean (Young et al. 2006) reported that sharks in this area are considered fully to over-exploited. Large numbers of longline vessels have also been reported to be operating illegally in coastal waters of the western Indian Ocean, primarily targeting hammerhead sharks and giant guitarfish (IOTC 2005, Dudley and Simpfendorfer 2006).

Japanese data on hammerhead species are limited, but reported landings in Japan?s coastal ports totaled 11-34 mt annually between 2000 and 2004 with an average of 24 mt per annum. No CPUE trends are available (Japan Fisheries Agency 2006).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

The smooth hammerhead is rarely fished intentionally, but may be used for its liver oil in vitamins, its fins for shark fin soup in Asia, its hide for leather and the carcass is used as fishmeal (2). It forms part of accidental catch in gillnet, longline and driftnet fishing operations but, as the fins are prized in Asia, it is rarely released alive when caught (3).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Management

Conservation Actions

Conservation Actions
Smooth hammerhead is a member of the family Sphyrnidae, which is listed on Annex I, Highly Migratory Species, of the UN Convention on the Law of the Sea. States are urged to cooperate over the management of these species. No such management yet exists. Precautionary adaptive collaborative management of target and bycatch fisheries is urgently needed for this highly migratory species. It is also essential to improve and sustain data collection and develop stock assessments for this species. Listing on international resource management agreements, such as the Convention on Migratory Species (CMS) could help to drive improvements in national and regional management and facilitate collaboration between states, for this species and other migratory sharks.

The adoption of shark finning bans by fishing states (e.g., USA, Australia, Brazil), regional entities (EU) and regional fisheries organisations (e.g. ICCAT, IOTC, IATTC, WCPFC) is accelerating and should increasingly prevent the capture of oceanic sharks for their fins alone. Strict enforcement of these bans is required if they are to be effective.

Management plans, fishing regulation, and monitoring programs are needed throughout this species? range. Estimates of acceptable catch rates should be viewed with precaution until there is more certainty in age and growth parameters and further research on the species? life-history characteristics is required. Protection of known adult aggregation sites and coastal nursery areas is also recommended.

In the USA, this species is included in the Large Coastal Shark complex management unit on the US Highly Migratory Species Fishery Management Plan, however there are no management measures specific to this species and no stock assessments have been undertaken for it. Enforcement of Brazilian laws restricting the length of pelagic gillnets and banning trawl fishing at a distance of less than 3 nm from shore has been difficult and therefore trawling in inshore nursery grounds has persisted.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Conservation

Shark-fining is banned in US waters, and the smooth hammerhead is a prohibited target species in New Zealand waters. Despite relatively few attacks on humans, many people fear hammerhead sharks and so conservation efforts can be difficult. Currently this species is not immediately threatened with extinction, and whilst there is much research into its ecology and physiology, there is little targeted conservation action (2).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Relevance to Humans and Ecosystems

Benefits

Importance

fisheries: commercial; gamefish: yes
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Wikipedia

Smooth hammerhead

The smooth hammerhead (Sphyrna zygaena) is a species of hammerhead shark, family Sphyrnidae, so named because of the distinctive shape of the head, which is flattened and laterally extended into a hammer shape (called the "cephalofoil"), without an indentation in the middle of the front margin (hence "smooth"). Unlike other hammerheads, this species prefers temperate waters and occurs worldwide at medium latitudes. In the summer, these sharks migrate towards the poles following cool water masses, sometimes forming schools numbering in the hundreds to thousands.

The second-largest hammerhead shark after the great hammerhead shark, the smooth hammerhead can measure up to 5 m (16 ft) long. It is an active predator that takes a wide variety of bony fishes and invertebrates, with larger individuals also feeding on sharks and rays. As in the rest of its family, this shark is viviparous and gives birth to litters of 20–40 pups. A relatively common shark, it is captured, intentionally or otherwise, by many commercial fisheries throughout its range; its fins are extremely valuable for use in shark fin soup. This shark is potentially dangerous and has likely been responsible for a few attacks on humans, though it is less likely to encounter swimmers than other large hammerhead species due to its temperate habitat.

Contents

Taxonomy and phylogeny

The Swedish natural historian Carl Linnaeus, known as the "father of taxonomy", originally described the smooth hammerhead as Squalus zygaena in the 1758 tenth edition of Systema Naturae, without designating a type specimen. The name was later changed to Sphyrna zygaena.[2] The specific epithet zygaena comes from the Greek word zygon, meaning "yoke", referring to the shape of its head.[3] Other common names for this species include common hammerhead, common smooth hammerhead, round-headed hammerhead, or simply hammerhead.[4]



Eusphyra blochii





Sphyrna mokarran



Sphyrna zygaena





Sphyrna lewini





Sphyrna tudes



Sphyrna media





Sphyrna tiburo



Sphyrna corona







Phylogenetic tree of hammerhead sharks.[5]

Studies based on morphology have generally regarded the smooth hammerhead as one of the more derived members of its family, grouped together with the scalloped hammerhead (S. lewini) and the great hammerhead (S. mokarran). Phylogenetic analyses based on nuclear and mitochondrial DNA have concluded differently: while the smooth and great hammerheads are closely related, they are not as closely related to the scalloped hammerhead as the other Sphyrna species. Furthermore, the smooth hammerhead is among the more basal hammerhead species, indicating that the first hammerheads to evolve had large cephalofoils.[5][6]

Description

The scalloped hammerhead (left) and the smooth hammerhead (right) differ in cephalofoil shape.

The second-largest hammerhead next to the great hammerhead, the smooth hammerhead typically measures 2.5–3.5 m (8.2–11 ft) long, with a maximum recorded length and weight of 5 m (16 ft) and 400 kg (880 lb) respectively.[7] The smooth hammerhead differs from other large hammerheads in the shape of its cephalofoil, which has a curved front margin without an indentation in the center. The cephalofoil is wide but short, measuring 26–29% of the body length across. The nostrils are located near the ends of the cephalofoil, with long grooves running towards the center. There are 26–32 tooth rows in the upper jaw and 25–30 tooth rows in the lower jaw. Each tooth is triangular in shape, with smooth to weakly serrated edges.[7]

The body is streamlined, without a dorsal ridge between the two dorsal fins. The first dorsal fin is moderately tall and falcate (sickle-like) in shape, with a rounded tip. The pectoral and pelvic fins are not falcate, rather having nearly straight rear margins. The anal fin is larger than the second dorsal fin, with long free rear tip and a strong notch in the rear margin.[2] The dermal denticles are densely packed, each with 5–7 horizontal ridges (3 in juveniles) leading to a W-shaped rear margin. The back is dark brownish gray to olive in color, in contrast to the simple brown of most other hammerheads, becoming lighter on the flanks. The belly is white, and sometimes the pectoral fins have dark edges underneath.[7]

Distribution and habitat

Of the hammerhead sharks, the smooth hammerhead is the species most tolerant of temperate water, and occurs worldwide to higher latitudes than any other species. In the Atlantic, it occurs from Nova Scotia to the Virgin Islands and from Brazil to southern Argentina in the west, and from the British Isles to Côte d'Ivoire, including the Mediterranean Sea, in the east. In the Indian Ocean, it is found off South Africa, India, and Sri Lanka. In the western Pacific, it occurs from the Gulf of Tonkin to southern Japan and Siberia, as well as off Australia and New Zealand. In the central and eastern Pacific, it occurs off the Hawaiian Islands, California, Panama, the Galapagos Islands, Ecuador, and Chile. This species is usually considered to be amphitemperate (absent from the tropics) in distribution, though there are rare reports from tropical waters such as in the Gulf of Mannar off India, and off southern Mozambique. Its presence in the tropics is difficult to determine due to confusion with other hammerhead species.[2]

Compared to the scalloped and great hammerheads, the smooth hammerhead stays closer to the surface, in water less than 20 m (66 ft) deep. However, it has been recorded diving to a depth of 200 m (660 ft). It prefers inshore waters such as bays and estuaries, but is sometimes found in the open ocean over the continental shelf, and around oceanic islands. This shark has also been reported entering freshwater habitats, such as the Indian River in Florida. In the summer, smooth hammerheads migrate poleward to stay in cooler water, heading back towards the equator in winter.[8]

Biology and ecology

A migrating smooth hammerhead swimming with its dorsal fin exposed

Adult smooth hammerheads are either solitary or form small groups. They may come together in great numbers during their annual migrations; schools of over a hundred juveniles under 1.5 m (4.9 ft) long have been observed off the eastern Cape of South Africa, and schools thousands strong have been reported off California.[2][8] During hot summer weather, they can be seen swimming just below the surface with their dorsal fins exposed.[7] Young smooth hammerheads are preyed upon by larger sharks such as the dusky shark (Carcharhinus obscurus);[7] adults have been observed being consumed by killer whales (Orcinus orca) off New Zealand.[9] Known parasites of the smooth hammerhead include the nematodes Parascarophis sphyrnae and Contracaecum spp.[7]

The smooth hammerhead is an active-swimming predator that feeds on bony fishes, rays, sharks (including of its own species), cephalopods, and to a lesser extent crustaceans such as shrimp, crabs, and barnacles. They readily scavenge from fishing lines.[2] In some areas, stingrays are a favored prey and comprise a majority of its diet. The venomous barbs of stingrays are often found lodged in and around the mouths of these sharks; one specimen examined contained 95 such spines.[10] In northern Europe, the smooth hammerhead feeds on herring and seabass, while in North America it takes Spanish mackerel and menhaden.[7] Off South Africa, smooth hammerheads feed on squid such as Loligo vulgaris and small schooling fish such as pilchard over the deep coral reefs at the edge of the continental shelf, with individuals over 2 m (6.6 ft) long taking increasing numbers of smaller sharks and rays. Off Australia, squid are the most important prey, followed by bony fish.[11][12]

Like other hammerheads, the smooth hammerhead is viviparous: once the young exhaust their supply of yolk, the empty yolk sac is converted into a placental connection through which the mother delivers nourishment. Females bear relatively large litters of 20–50 pups after a gestation period of 10–11 months.[8] Birthing occurs in shallow coastal nurseries, such as Bulls Bay in North Carolina.[13] The pups measure 50–61 cm (20–24 in) long at birth; females reach maturity at 2.7 m (8.9 ft) long and males at 2.1–2.5 m (6.9–8.2 ft) long, depending upon locality.[7] Off South Africa, newly mated females have been caught in February and females with full-term embryos in November; off the east coast of Australia, birthing takes place between January and March, with ovulation taking place around the same time.[11] This shark is thought to live for 20 years or more.[7]

Human interactions

The smooth hammerhead is potentially dangerous to humans. As of 2008, the International Shark Attack File lists 34 attacks attributable to large hammerhead sharks, 17 of them unprovoked (1 fatal).[14] However, due to the smooth hammerhead's occurrence in temperate regions where people are less likely to enter the water, it was likely responsible for a minority of these attacks.[7] Off southern California, this species has been reported to steal catches from sport fishers and divers.[2]

Smooth hammerheads are caught by commercial fisheries throughout the world, including those off the United States (East and West Coasts), Brazil, Spain, Taiwan, the Philippines, southwestern Australia, and western Africa, primarily using gillnets and longlines. Fishery catches of smooth hammerheads are difficult to quantify due to a frequent lack of distinction between them and other large hammerheads.[11] The meat is sold fresh, dried and salted, or smoked, though in most markets it is considered undesirable and there are reports of poisoning. Much more valuable are the fins, which have the highest rating for use in shark fin soup and often leads to captured sharks being finned at sea. Additionally, the liver oil is used for vitamins, the skin for leather, and the offal for fishmeal.[7] This shark is also used in Chinese medicine.[4]

Many other fisheries from every ocean also take smooth hammerheads as bycatch, and they are caught in some numbers by recreational anglers. Smooth hammerheads are also killed by entanglement in shark nets used to protect beaches. Fewer than 10 smooth hammerheads were caught annually in the nets off KwaZulu-Natal, South Africa, from 1978–1990. In contrast, in the nets off New South Wales, Australia, smooth hammerheads comprised 50% of the 4,715 sharks captured from 1972–1990.[11] At present, this species remains relatively common and has been assessed as "Lower Risk/Near Threatened" by the World Conservation Union.[1] Off New Zealand, it is a prohibited target species and is the most abundant shark along the northwest coast. It also does not appear to have been negatively impacted by fishing off southern Australia.[7] Off the eastern United States, catches of this species are regulated by the National Marine Fisheries Service (NMFS) Atlantic shark Fishery Management Plan (FMP), under which it is classified as a Large Coastal Shark (LCS).[11]

References

  1. ^ a b Casper, B.M., A. Domingo, N. Gaibor, M.R. Heupel, E. Kotas, A.F. Lamónaca, J.C. Pérez-Jimenez, C. Simpfendorfer, W.D. Smith, J.D. Stevens, A. Soldo, and C.M. Vooren (2005). Sphyrna zygaena. In: IUCN 2008. IUCN Red List of Threatened Species. Retrieved March 6, 2010.
  2. ^ a b c d e f Compagno, L.J.V. (1984). Sharks of the World: An Annotated and Illustrated Catalogue of Shark Species Known to Date. Rome: Food and Agricultural Organization. pp. 553–554. ISBN 92-5-101384-5. 
  3. ^ Ellis, R. (1989). The Book of Sharks. New York: Alfred A. Knopf Inc. ISBN 0-679-72210-6. 
  4. ^ a b Froese, Rainer, and Daniel Pauly, eds. (2008). "Sphyrna zygaena" in FishBase. January 2008 version.
  5. ^ a b Lim, D.D.; Motta, P.; Mara, K.; Martin, A.P. (2010). "Phylogeny of hammerhead sharks (Family Sphyrnidae) inferred from mitochondrial and nuclear genes". Molecular Phylogenetics and Evolution 55 (2): 572–579. 
  6. ^ Cavalcanti, M.J. (2007). "A Phylogenetic Supertree of the Hammerhead Sharks (Carcharhiniformes: Sphyrnidae)". Zoological Studies 46 (1): 6–11. 
  7. ^ a b c d e f g h i j k l Bester, C. Biological Profiles: Smooth Hammerhead. Florida Museum of Natural History Ichthyology Department. Retrieved on October 19, 2008.
  8. ^ a b c Ebert, D.A. (2003). Sharks, Rays, and Chimaeras of California. University of California Press. pp. 178–179. ISBN 0-520-23484-7. 
  9. ^ Visser, I.N. (January 2005). "First Observations of Feeding on Thresher (Alopias vulpinus) and Hammerhead (Sphyrna zygaena) Sharks by Killer Whales (Orcinus orca) Specialising on Elasmobranch Prey". Aquatic Mammals 31 (1): 83–88. doi:10.1578/AM.31.1.2005.83. 
  10. ^ Strong, W.R., Snelson, Jr., F.F., and Gruber, S.H. (September 19, 1990). "Hammerhead Shark Predation on Stingrays: An Observation of Prey Handling by Sphyrna mokarran". Copeia (American Society of Ichthyologists and Herpetologists) 1990 (3): 836–840. doi:10.2307/1446449. JSTOR 1446449. 
  11. ^ a b c d e Fowler, S.L., Cavanagh, R.D., Camhi, M., Burgess, G.H., Cailliet, G.M., Fordham, S.V., Simpfendorfer, C.A. and Musick, J.A. (2005). Sharks, Rays and Chimaeras: The Status of the Chondrichthyan Fishes. International Union for Conservation of Nature and Natural Resources. pp. 106–109, 318–320. ISBN 2-8317-0700-5. 
  12. ^ Smale, M.J. (December 1991). "Occurrence and feeding of three shark species, Carcharhinus brachyurus, C. obscurus and Sphyrna zygaena, on the Eastern Cape coast of South Africa". South African Journal of Marine Science 11 (1): 31–42. 
  13. ^ Sumich, J.L. and Morrissey, J.F. (2004). Introduction to the Biology of Marine Life (eighth ed.). Jones & Bartlett Publishers. p. 197. ISBN 0-7637-3313-X. 
  14. ^ ISAF Statistics on Attacking Species of Shark. International Shark Attack File, Florida Museum of Natural History, University of Florida. Retrieved on May 18, 2009.
Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

 

Source: Wikipedia

Unreviewed

Article rating from 0 people

Average rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!