Overview

Comprehensive Description

Description

  Common names: bonnethead (English), shark (English), tiburón (Espanol), cabeza (Espanol), cornuda (Espanol)
 
Sphyrna tiburo (Linnaeus, 1758)


Bonnethead,     Common bonnethead shark

A small hammerhead shark with a very narrow, rounded shovel-shaped head, without the prominent lateral-blade extensions of other hammerheads; width of head 18-25% (usually < 21%) of TL; front margin of head broadly convex and without indentations; length before mouth about 40% of head width; front teeth blade-like, with 1 short, stout point, lower teeth straight, upper teeth oblique, deeply notched on rear side;  enlarged keeled molariform teeth at back of jaws; first dorsal fin moderately large and erect, its rear margin concave; second dorsal fin base about half length of anal fin base; origin of second dorsal fin above middle of anal fin; anal fin rear edge shallowly concave; transverse pit above tail base crescent shaped, a pit below tail base; tail fin strongly asymmetrical, notched under tip of top lobe, large lower lobe.


Grey or grey brown on back and sides, whitish below; often small dark spots on back.


Maximum size about 150 cm, 10.8kg; size at birth 35-40 cm.

A common inshore hammerhead ranging into shallow estuaries.

From the intertidal zone to at least 80 m depth.

Western Atlantic and eastern Pacific (Southern California to Peru, Cocos and the Revillagigedos Islands.   
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© Shorefishes of the tropical eastern Pacific online information system. www.stri.org/sftep

Source: Shorefishes of the Tropical Eastern Pacific Online Information System

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Biology

Found on the continental and insular shelves, on inshore and coastal areas, over mud and sand bottoms, also on coral reefs. Often occur in shallow water including estuaries, shallow bays and over coral reefs (Ref. 9987). Feed mainly on crustaceans, also on bivalves, octopi, and small fish. Viviparous, with 6 to 9 young per litter. Size at birth about 35 to 40 cm. Not territorial. Always occurs in small groups. Considerable sexual segregation occurs. Shows diel rhythm of activity. Utilized for human consumption and processed for fishmeal.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Distribution

Found on both the East and West coast of North and South America. In the western Atlantic, they are found from southern Brazil to North Carolina, straying to Massachusetts Bay and Nantucket Sound.
  • North-West Atlantic Ocean species (NWARMS)
Creative Commons Attribution 3.0 (CC BY 3.0)

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Range Description

This species occurs off the American continent only. In the western Atlantic it has been reported from southern Brazil to North Carolina, USA, and occasionally further north. It is also common in the Gulf of Mexico and part of the Caribbean. In the eastern Pacific it is reported from southern California to Ecuador (Compagno 1984b).
The bonnethead shark is an abundant, small coastal shark commonly found in shallow estuaries and bays over grass, mud and sandy bottoms. Off Florida?s west coast it is very abundant in shallow estuaries during the summer months and moves to deeper water off the beaches in winter (Hueter and Manire 1994). This species shows sexual segregation.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Zoogeography

See Map (including site records) of Distribution in the Tropical Eastern Pacific 
 
Global Endemism: All species, TEP non-endemic, East Pacific + Atlantic (East +/or West), New world (East Pacific + West Atlantic), Transisthmian (East Pacific + Atlantic of Central America)

Regional Endemism: All species, Eastern Pacific non-endemic, Tropical Eastern Pacific (TEP) non-endemic, Continent + Island (s), Continent, Island (s)

Residency: Resident

Climate Zone: North Temperate (Californian Province &/or Northern Gulf of California), Northern Subtropical (Cortez Province + Sinaloan Gap), Northern Tropical (Mexican Province to Nicaragua + Revillagigedos), Equatorial (Costa Rica to Ecuador + Galapagos, Clipperton, Cocos, Malpelo), South Temperate (Peruvian Province )
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© Shorefishes of the tropical eastern Pacific online information system. www.stri.org/sftep

Source: Shorefishes of the Tropical Eastern Pacific Online Information System

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Western Atlantic and eastern Pacific.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Western Atlantic: North Carolina, USA to southern Brazil, including Cuba and the Bahamas. Caribbean and Gulf of Mexico; rare in Bermuda (Ref. 26938). Eastern Pacific: southern California, USA to Ecuador.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Geographic Range

The bonnethead is confined to the warm waters of the western hemisphere. It ranges from New England, where it is rare, to the Gulf of Mexico and Brazil and from southern California to Ecuador. It is common in the inshore waters of the Carolinas and Georgia in summer, and off Florida and in the Gulf of Mexico in spring, summer, and fall (Castro, 1987).

Biogeographic Regions: atlantic ocean (Native ); pacific ocean (Native )

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Tropical-warm temperature Atlantic; from southern Brazil to North Carolina in the west, and as a stray to southern New England and Massachussetts Bay; tropical West Africa in the east; also from southern California to Ecuador on the Pacific Coast of America.
  • Bigelow, H. B. and Schroeder, W. C.,1953; Compagno, L. J. V., 1984; Frimodt, C., 1995.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Gulf of Maine - CoML

Source: Gulf of Maine Area Census of Marine Life

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Depth

Depth Range (m): 0 (S) - 80 (S)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© Shorefishes of the tropical eastern Pacific online information system. www.stri.org/sftep

Source: Shorefishes of the Tropical Eastern Pacific Online Information System

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Physical Description

Morphology

Physical Description

The characteristic shovel- or bonnet-shaped head makes this hammerhead the easiest to identify. Body moderately compact; head flattened, spade-shaped front margin of head not lobed without nasal grooves, the anterior margin of the head is evenly rounded between the eyes; mouth arched; mouth corners posterior to oculonarial expansion. The frontal teeth have erect, smooth-edged cusps, while subsequent teeth have oblique cusps; the outermost teeth of the lower jaw are modified into flat crushers. First dorsal fin high, originating slightly posterior to base of pectoral fin; second dorsal with rear lobe not well developed, higher and shorter than anal one; eyes separated from nasal grooves by a distance of 1.5 times diameter of eye. Some are dark brown in the lateral dorsal region, lighter in ventral region while others are gray or greensih gray above and paler below. Average size is 70-100 cm (28-39 in.) Maximum size is about 110 cm (43 in.) These are the smallest of family Sphyrnidae (Cortes and Parsons,1996).

Range mass: 3 to 4 kg.

Average mass: 0.0035 kg.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Size

Length max (cm): 150.0 (S)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© Shorefishes of the tropical eastern Pacific online information system. www.stri.org/sftep

Source: Shorefishes of the Tropical Eastern Pacific Online Information System

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Size

Maximum size: 1500 mm TL
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Max. size

150 cm TL (male/unsexed; (Ref. 5217)); max. published weight: 10.8 kg (Ref. 40637); max. reported age: 12 years (Ref. 26248)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

to 150 cm TL; max. weight: 8,840 g.
  • Bigelow, H. B. and Schroeder, W. C.,1953; Compagno, L. J. V., 1984; Frimodt, C., 1995.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Gulf of Maine - CoML

Source: Gulf of Maine Area Census of Marine Life

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Diagnostic Description

Front of head semicircular in outline. No other hammerhead has front of head in semicircle. (Ref. 26938).
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Ecology

Habitat

nektonic
  • North-West Atlantic Ocean species (NWARMS)
Creative Commons Attribution 3.0 (CC BY 3.0)

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Habitat and Ecology

Habitat and Ecology
The Bonnethead Shark is a small coastal sphyrnid that reaches about 150 cm total length (TL). The life history of this species in the Gulf of Mexico has received considerable attention. In the eastern Gulf of Mexico, female Bonnethead Sharks seldom exceed 130 cm TL, whereas males rarely surpass 110 cm TL. Females generally mature between 80?95 cm TL (or 2?3 years of age) and males mature between 68?85 cm TL (two years of age). Maximum observed ages are 6?7 years or more for females and 5?6 years or more for males, whereas theoretical longevities derived from von Bertalanffy growth curves range from 5?6 years for males and from 10?12 years for females (Parsons 1993a, Carlson and Parsons 1997). Empirical data for populations of this species in the eastern Gulf of Mexico reveal a latitudinal increase in maximum size, size at maturity and offspring size (Parsons 1993, Carlson and Parsons 1997, C.A. Manire pers. comm.).

The Bonnethead Shark is a placental viviparous species that reproduces annually. Its gestation period is one of the shortest known in sharks, lasting approximately 4.5?5 months; litter size averages nine. The periodicity of parturition also varies latitudinally, taking place in mid to late August in Florida Bay (southernmost location), early September in Tampa Bay (middle location) and mid to late September off north-west Florida (northernmost location) (Manire et al. 1995, J. Carlson pers. comm.). Size at birth ranges from an average of 27 cm TL in Florida Bay to 35 cm TL in Tampa Bay (Parsons 1983). Parsons (1993) and Manire et al. (1995) found that mating occurs in November and sperm is stored until ovulation/fertilisation the following March or April. Ongoing tagging studies along the west coast of Florida (R.E. Hueter and C.A. Manire pers. Comm.) indicate that individuals of this species are highly site-attached, with little evidence for long-distance migrations and mixing of populations.

The shallow grass bottoms off Florida?s west coast are documented nursery grounds for this species, which probably utilises similar habitats as nursery areas throughout its range (Hueter and Manire 1994). The Bonnethead Shark's diet off south-west Florida is very homogeneous, dominated by crustaceans, consisting mostly of portunid crabs (Cortés et al. 1996). Stomach contents also show a high incidence of angiosperms, which are likely ingested incidentally to prey capture and denote the benthic feeding habits of this species (Cortés et al. 1996). This species also feeds on cephalopods and fish, but to a much lesser extent. Bonnethead sharks are specialist hunters (Cortés et al. 1996) that appear to have higher daily rations than other species of sharks for which quantitative food consumption data exist (Cortés unpubl.).

Cortés and Parsons (1996) compared the demography of two populations off Florida?s west coast and found short generation times (4?5 years) and high population growth rates (1?28% per year). Recent demographic studies of this species by Cortés (in press) incorporating uncertainty in estimates of vital rates indicate that the bonnethead has very high population growth rates (l) (mean=1.304 yr-1; 95% confidence interval=1.150?1.165 yr-1) and short generation times (A) (mean=3.9 years, 95% CI=2.6?4.5 years). Elasticity analysis (which examines the proportional sensitivity of l to a proportional change in a vital rate) also showed that l is most sensitive to juvenile survival and adult survival than to fertility (which includes survival to age-1). Annual survivorship values used in Cortés (in press) were estimated through five indirect life history methods and ranged from 55?81%. The high l values and elasticity patterns for this species are a result of its ?fast? life history characteristics.

Systems
  • Marine
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Depth: 10 - 80m.
From 10 to 80 meters.

Habitat: reef-associated.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Environment

reef-associated; brackish; marine; depth range 10 - 80 m (Ref. 244), usually 10 - 25 m (Ref. 9253)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

S. tiburo is believed to migrate southward in winter or to deeper offshore waters in Florida and the Gulf of Mexico, but little is known about its movements. It often travels in schools of five to fifteen individuals. Migrating schools of hundreds and even thousands of these sharks have been reported (Parsons1993).

Aquatic Biomes: benthic ; coastal

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Depth range based on 397 specimens in 1 taxon.
Water temperature and chemistry ranges based on 94 samples.

Environmental ranges
  Depth range (m): 1.5 - 92
  Temperature range (°C): 22.001 - 27.643
  Nitrate (umol/L): 0.289 - 1.990
  Salinity (PPS): 35.556 - 36.273
  Oxygen (ml/l): 4.294 - 4.877
  Phosphate (umol/l): 0.038 - 0.424
  Silicate (umol/l): 0.756 - 4.128

Graphical representation

Depth range (m): 1.5 - 92

Temperature range (°C): 22.001 - 27.643

Nitrate (umol/L): 0.289 - 1.990

Salinity (PPS): 35.556 - 36.273

Oxygen (ml/l): 4.294 - 4.877

Phosphate (umol/l): 0.038 - 0.424

Silicate (umol/l): 0.756 - 4.128
 
Note: this information has not been validated. Check this *note*. Your feedback is most welcome.

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Reef-associated; brackish; marine. Depth range: 10-80 m. Found on the continental and insular shelves, on inshore and coastal areas, over mud and sand bottoms, also on coral reefs. Often occurs in shallow water including estuaries, shallow bays and over coral reefs.
  • Bigelow, H. B. and Schroeder, W. C.,1953; Compagno, L. J. V., 1984; Frimodt, C., 1995.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Gulf of Maine - CoML

Source: Gulf of Maine Area Census of Marine Life

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Salinity: Marine, Brackish

Inshore/Offshore: Inshore, Inshore Only

Water Column Position: Mid Water, Near Bottom, Bottom, Bottom + water column

Habitat: Soft bottom (mud, sand,gravel, beach, estuary & mangrove), Mud, Sand & gravel, Estuary, Freshwater, Water column

FishBase Habitat: Demersal
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© Shorefishes of the tropical eastern Pacific online information system. www.stri.org/sftep

Source: Shorefishes of the Tropical Eastern Pacific Online Information System

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Trophic Strategy

Food Habits

The diet of S. tiburo is dominated by crustaceans, consisting mostly of blue crabs, but also it feeds upon shrimp, mollusks, and small fishes. Seagrasses were also found in stomach contents.

It was found that stomach content weight of females was higher than that of males, probably because females, due to reproduction, have a higher energy budget. They need to feed more in order to store energy for when they reproduce (Cortes , Manire, and Hueter,1996).

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Feeds mainly on crustaceans, bivalves, octopi, and small fish.
  • Bigelow, H. B. and Schroeder, W. C.,1953; Compagno, L. J. V., 1984; Frimodt, C., 1995.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Gulf of Maine - CoML

Source: Gulf of Maine Area Census of Marine Life

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Feeding

Feeding Group: Carnivore

Diet: mobile benthic crustacea (shrimps/crabs), octopus/squid/cuttlefish, bony fishes
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© Shorefishes of the tropical eastern Pacific online information system. www.stri.org/sftep

Source: Shorefishes of the Tropical Eastern Pacific Online Information System

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Life History and Behavior

Life Cycle

Viviparous, placental (Ref. 50449), with 6 to 9 young per litter. Size at birth about 35 to 40 cm.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Life Expectancy

Lifespan, longevity, and ageing

Maximum longevity: 6.5 years (wild)
Creative Commons Attribution 3.0 (CC BY 3.0)

© Joao Pedro de Magalhaes

Source: AnAge

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Reproduction

S. tiburo reproduces sexually and is viviparous. Maturity is reached at about 75 cm (30 in). The pups are born in late summer and early fall and measure 30-32 cm (12-13 in) at birth and approximately 172 g. Usually eight to twelve pups are produced in each litter.

Survivorship for young individuals, especially newborn pups, may be affected by size-selective predation.

Geographic variation does seem to have an effect on the survival of the pups, as well as the weight and size. In Florida Bay and Tampa Bay there was a study of two populations of bonnethead sharks. Size at maturation, age at maturation, time of fertilization, rate of embryonic development, size at birth, the energetic investment in producing offspring, gestation period, and the incidence of fertility were found to differ between these population. Food limitations and seasonal differences may play a role in these differences (Castro, 1987).

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Viviparous, with 6 to 9 young per litter. Size at birth about 35 to 40 cm.. Always occurs in small groups. Considerable sexual segregation occurs.
  • Bigelow, H. B. and Schroeder, W. C.,1953; Compagno, L. J. V., 1984; Frimodt, C., 1995.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Gulf of Maine - CoML

Source: Gulf of Maine Area Census of Marine Life

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Egg Type: Live birth, No pelagic larva
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© Shorefishes of the tropical eastern Pacific online information system. www.stri.org/sftep

Source: Shorefishes of the Tropical Eastern Pacific Online Information System

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Sphyrna tiburo

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 43 barcode sequences available from BOLD and GenBank.  Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

CCTTTATCTAATTTTTGGTGCATGAGCAGGAATAATTGGAACAGCCCTAAGTCTTTTAATTCGAGCTGAACTTGGGCAACCAGGTTCTCTTTTAGGAGATGATCAGATTTATAATGTAATTGTAACTGCCCACGCTTTTGTAATAATCTTTTTTATAGTTATACCAATCATAATTGGTGGCTTTGGAAACTGACTGGTTCCTTTAATAATTGGTGCACCAGACATGGCCTTCCCACGAATAAATAACATAAGCTTCTGGCTCCTTCCACCATCATTCCTTCTACTACTAGCTTCTGCTGGGGTAGAAGCTGGAGCAGGCACCGGCTGAACAGTCTACCCTCCATTAGCTAGCAACTTAGCTCATGCTGGGCCATCTGTTGATTTAGCTATCTTTTCTCTCCATCTGGCTGGAGTATCGTCAATTCTAGCTTCAATCAATTTTATTACAACTATTATTAACATAAAACCCCCAGCCATTTCCCAGTACCAAACGCCATTATTTGTTTGATCTATCCTTGTGACTACTATTCTGCTACTCCTTTCCCTCCCAGTTCTTGCAGCAGGAATTACAATATTACTCACAGACCGCAACCTTAATACTACATTCTTTGATCCTGCAGGAGGAGGAGATCCAATCCTTTATCAACACCTA
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Sphyrna tiburo

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 43
Specimens with Barcodes: 49
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Conservation

Conservation Status

IUCN Red List Assessment


Red List Category
LC
Least Concern

Red List Criteria

Version
3.1

Year Assessed
2005

Assessor/s
Cortés, E.

Reviewer/s
Musick, J.A. & Fowler, S.L. (Shark Red List Authority)

Contributor/s

Justification
This assessment is based on the information published in the 2005 shark status survey (Fowler et al. 2005).

The Bonnethead Shark (Sphyrna tiburo) is a very abundant small hammerhead of shallow estuaries and bays on the Atlantic and Pacific coasts of the Americas. Despite pressure from both directed and incidental fisheries, this is an abundant species with some of the highest population growth rates calculated for sharks, making it much less susceptible to removals than most other species of sharks.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

IUCN Red List of Threatened Species: least concern

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

IUCN Red List: Listed, Least concern

CITES: Not listed
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© Shorefishes of the tropical eastern Pacific online information system. www.stri.org/sftep

Source: Shorefishes of the Tropical Eastern Pacific Online Information System

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Population

Population Trend
Unknown
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Threats

Major Threats
In the USA, Bonnethead Sharks are caught in commercial and recreational fisheries and also as bycatch. Recent commercial landings of this species indicate that it accounted for over 50% of all landings of small coastal sharks in the south-eastern USA in 1995, but was the least important small coastal species of shark represented in commercial landings from 1996?1999. Commercial landings of bonnetheads in numbers averaged about 22,000 individuals from 1995?1999 (Cortés 2000b).

Recreational catch estimates from several surveys indicate that about 29,000 bonnetheads were caught annually from 1981?1998, ranging from a minimum of about 13,000 sharks in 1991 to a peak of about 53,000 sharks caught in 1986 (Cortés 2000b). Additionally, bycatch estimates from the shrimp trawl fishery operating in the Gulf of Mexico indicate that about 410,000 individuals were caught annually from 1972?1999 (Cortés unpubl.).

Bonnetheads are also exploited in Mexico. In Mexican coastal waters of the Gulf of Mexico, S. tiburo is the second most important species in the artisanal fisheries, accounting for 15% of the landings numerically (Castillo et al. 1998). Targeted fisheries for this species have also been documented for Trinidad and Tobago (Shing 1999) and Ecuador (Martinez 1999). Bycatch in other fisheries, mainly from shrimp trawling, is probably also significant in other fishing nations of the American continent.
Nursery areas for this species are located inshore and adults frequent inshore waters, making this species vulnerable to exploitation and human-induced habitat degradation. Preliminary results of an ongoing study on the reproductive endocrinology of this species off Florida?s west coast show that high levels of organochlorine contaminants are present in tissues of sampled individuals (C.A. Manire pers. comm.).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Least Concern (LC)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Management

Conservation Actions

Conservation Actions
In the USA, the Bonnethead Shark is classified as a small coastal species in the Federal Management Plan (FMP) for Sharks of the Atlantic Ocean, Gulf of Mexico and Caribbean, together with the Blacknose Shark (Carcarhinus acronotus), the Finetooth Shark (C. isodon), the Smalltail Shark (C. porosus), the Atlantic Angel (Squatina dumeril), the Atlantic Sharpnose (Rhizoprionodon terranovae) and the Caribbean Sharpnose (R. porosus) sharks (NMFS 1993). The small coastal shark complex is not currently considered to be overfished, but there are fishing regulations in effect. A more recent FMP (NMFS 1999) called for more stringent measures, including a reduction of the annual commercial quota for small coastal sharks to 359 t.

The Bonnethead Shark is a very abundant species, with early age at maturity, short lifespan and generation time, and high litter size and population growth rates, capable of withstanding much higher removal levels than many other species of sharks. It is thus considered to be of lesser risk because of its life history and population characteristics.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Relevance to Humans and Ecosystems

Benefits

Importance

fisheries: commercial; gamefish: yes
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Economic Importance for Humans: Negative

Only one attack on humans by this species has been recorded, and it is generally considered to be harmless.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Economic Importance for Humans: Positive

This species is used commercially as dried meat similar in quality to second-class cod; the meat is dark and frequently is consumed fresh. However, even though marketed, it is of little or no economic importance to man.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Wikipedia

Bonnethead

The bonnethead shark or shovelhead, Sphyrna tiburo, is a member of the hammerhead shark genus Sphyrna, and part of the family Sphyrnidae. The Greek word sphyrna translates as hammer, referring to the shape of this shark's head - tiburo is the Taino word for shark.

Appearance[edit]

A top view

Characterized by a broad, smooth, spade-like head, they have the smallest cephalofoil (hammerhead) of all Sphyrna. Grey-brown above and lighter on the underside, it is a timid and a harmless shark.

Size[edit]

On average, bonnethead sharks are about 2–3 ft (0.61–0.91 m) long, with a maximum size of about 5 feet (150 cm), with female Bonnethead sharks being larger than males.

Habitat[edit]

This species lives in the Western Hemisphere where the water is usually warmer than 70 °F (21 °C). It ranges from New England, where it is rare, to the Gulf of Mexico and Brazil, and from southern California to Ecuador. During the summer it is common in the inshore waters of the Carolinas and Georgia; in spring, summer, and fall, it is found off Florida and in the Gulf of Mexico. In the winter, the bonnethead shark is found closer to the equator, where the water is warmer.

Behavior[edit]

The bonnethead shark is an active tropical shark that swims in small groups of 5 to 15 individuals. Curiously however, schools of hundreds or even thousands have been reported. Bonnethead sharks move constantly following changes in water temperature and to maintain respiration. The bonnethead shark will sink if it does not keep moving since hammerhead sharks are among the most negatively buoyant of marine vertebrates. The bonnethead shark uses a unique type of cerebrospinal fluid to let others know it is nearby. Like other sharks it is capable of electroreception to detect its preys. This system allows the bonnethead shark to position itself for biting prey within a few feet where its eyes are least able to assist. This shark is not dangerous to humans. It can be seen in aquariums.

Diet[edit]

It feeds primarily on crustaceans, consisting mostly of blue crabs, but also shrimp, mollusks and small fish. Seagrasses have been found in its stomach contents. Their feeding behavior involves swimming across the seafloor, moving its head in arc patterns like a metal detector, looking for minute electro-magnetic disturbances produced by crabs and other creatures hiding in the sediment. Upon discovery, they sharply turn around and bite into the sediment where the disturbance was detected. If a crab is caught, the bonnethead shark uses its teeth to grind its carapace and then uses suction to swallow.

To accommodate the many types of animals that it feeds on, the bonnethead shark has small, sharp teeth in the front of the mouth (for grabbing soft prey) and flat, broad molars in the back (for crushing hard-shelled prey).

Reproduction[edit]

The bonnethead shark is viviparous, which means females produce eggs that are retained and nourished in the reproductive system until the young are mature enough to be released to the outside. Females reach sexual maturity at about 32 inches, while males reach maturity at around 24 inches. Four to twelve pups are born in late summer and early fall, measuring 12 to 13 inches (330 mm).

Researchers from Queen's University Belfast and the Southeastern University (Florida), have recently shown that a bonnethead female produced a pup by parthenogenesis in 2001. The birth took place at the Henry Doorly Zoo in Nebraska and subsequent DNA analysis has shown a perfect match between mother and pup.[1]

Sexual dimorphism[edit]

Bonnethead sharks are the only sharks known to exhibit sexual dimorphism; that is, male and female adults look different from one another. In morphology, adult female bonnethead sharks have a broadly rounded head, whereas males possess a distinct bulge along the anterior margin of the cephalofoil. This bulge is formed by the elongation of the rostral cartilages of the males at the onset of sexual maturity and corresponds temporally with the elongation of the clasper cartilages.

Purpose of the hammer[edit]

The reasons for cephalofoil has caused scientific debate for more than a decade. Whatever the ultimate purpose, a wing shaped cephalofoil allows hammerhead sharks to swim on a horizontal plane and was thought to give them the ability to execute sharp turns. However, research shows that it is the vertebrae that help them execute sharp turns[citation needed]. The cephalofoil is responsible for better electroreception (using ampullae of Lorenzini) and heightened olfactory acuity.[citation needed]

Pectoral fins and swimming[edit]

The pectoral fins on most fish control pitching (up-and-down motion of the body), yawing (the side-to-side motion) and rolling. Most hammerhead sharks do not yaw or roll and achieve pitch by using their cephalofoil. The smaller cephalofoil of a bonnethead shark is not as successful and they therefore have to rely on the combination of cephalofoil and their large pectoral fins for most of their motility. Compared to other hammerheads, bonnethead sharks have larger and more developed pectoral fins and are the only species of hammerhead to actively use pectoral fins for swimming.

Evolution[edit]

Using data from mtDNA analysis, scientist have found that evolution of hammerhead sharks has probably begun with a taxon that had a highly pronounced cephalofoil (most likely that similar to the winghead shark, Eusphyra blochii), and has later been modified through selective pressures. It is thus assumed today that, judging by their smaller cephalofoil, bonnethead sharks are the more recent developments of a 25 million year evolutionary process.

References[edit]

Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

Source: Wikipedia

Unreviewed

Article rating from 0 people

Default rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!