Overview

Brief Summary

<i>Sphyrna mokkaran</i>

The Great Hammerhead Shark (Sphyrna mokkaran) taxonomy :

Filum : Chordata

Class : Chondricthys

Ordo : Charcarinifer

Famili : Sphyrinidae

Genus : Sphyrna

Species : Sphyrna mokkaran

The great Hammerhead Shark (Sphyrna mokarran), one species of Sphyrninidae that have the largest size of body usually founded in the warm water especially on the warm temperate ocean around the world like Pacific and Hindia ocean. This species can we found on the lagoon, coral reef, embayment, coastal water, sea mount, and island chain. They also found on the schooling but not on the large schooling scale.

The hammerhead shark commonly observed from coastal water to continental shelf and at depth ranging from 1m to 300m under the sea surface. They are high migratory species and nomadic. They distribution area such as Andaman Sea, Arabian sea, East china sea, Indonesia sea, gulf of Mexico,

Mediteranian sea, etc.

Like the other species of shark, the hammerhead shark is one of top predator on the coastal ecosystem that need a good condition for the live. They diet includes demersal fish (prefer), crustacea, otherelasmobranchs, and chepalopods. Grouper and catfish also the prefer food for great hammerhead shark.

Today, the great hammerhead shark is one of shark species commonly targeted for their large ddorsal and tail fins which are highly valued on Asian fish market. The impact for this condition is decreasing

population of great hammershark. IUCN give ENDENGARED status for this species.

  • TRACS.2010.Profile of great Hammer shark.www.tracsaustralia.com.au (2010)
  • Fisheries Scientific Committee.2011.PROPOSED DETERMINATION The Great Hammerhead - Sphyrna mokarran, as a Vulnerable Species.Ref. No. PD 49 File No. FSC 10/02
Creative Commons Attribution 3.0 (CC BY 3.0)

© Adriani Sunuddin

Supplier: Ferdy Gustian

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Biology

The great hammerhead is particularly keen on feeding on stingrays, despite the danger of their barbs. The hammerhead pins down each ray with its hammer and then bites chunks from the wings until the ray is immobilised (4). It also feeds on groupers, sea catfish, small, bony fish, crabs, squid, other sharks and lobsters (2). It can be cannibalistic although it is not known what triggers this behaviour. Feeding mainly at dusk, the great hammerhead uses an electro-sensory system to locate prey; sensing the weak electric field produced by all living organisms. Larger sharks may prey on juvenile great hammerheads but adults have no natural predators (3). Mating has rarely been observed in this species, but unlike other sharks it is known to mate at the surface (3). Males use extensions of the pelvic fins called 'claspers' to transfer sperm to the female (5), resulting in a pregnancy lasting 11 months (3). Young are born live in the spring or summer (3). The function of the hammer is much discussed and a great many theories have been put forward as to its purpose. Amongst these theories, the most popular are that it helps the shark to scan larger areas of the ocean floor for food, and that it maximises the area of the sensory organs (known as the ampullae of Lorenzini) that can detect chemical, physical and thermal changes in the water, as well as electric fields (5).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Description

This massive and well-known shark has the most distinctive hammer of its genus. It is particularly wide and virtually straight along the front edge, with just a small notch in the centre. The eyes are at either end of the hammer and the mouth is positioned on the underside in line with the trail edge of the hammer. The first dorsal fin is particularly tall, sickle-shaped and has a pointed tip. The second dorsal fin is also tall with a concave rear edge. The body is dark grey above fading to light grey below. The teeth are triangular and strongly serrated. Juveniles are similar but have a more curved hammer (3).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Comprehensive Description

Biology

A coastal-pelagic, semi-oceanic shark, found close inshore and well offshore, over the continental shelves, island terraces, and in passes and lagoons (Ref. 244, 58302). Often bottom and reef associated at 1-80 m (Ref. 58302). Prefers to feed on stingrays and other batoids, groupers and sea catfishes, but also preys on other small bony fishes, crabs, squid, other sharks, rays, and lobsters (Ref. 244, 13562, 1602). A viviparous species, with 13-42 of about 56 to 70 cm young in a litter (Ref. 26938, 1602). Potentially dangerous to people (Ref. 13562) but only few, if any, of the attacks on people can be definitely attributed to it because of the apparent difficulty of distinguishing large hammerhead species involved in attacks (Ref. 244). Caught occasionally by target shark longline, demersal tangle net and tuna gillnet fisheries (Ref.58048). Meat utilized for human consumption (fresh, fresh-frozen, dried-salted, and smoked), liver oil for vitamins, fins for soup, hides for leather, and carcasses for fishmeal (Ref. 244). Its large fins, including the tail, sail-like first dorsal fin, are prized in the Oriental sharkfin trade (Ref. 47737).
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Description

Common names: hammerhead (English), shark (English), tiburón (Espanol)
 
Sphyrna mokarran (Rüppell, 1837)


Great hammerhead,     Great hammerhead shark


A hammerhead shark with broad, narrow-blade side extensions on the head forming a hammer (width 23-27% of TL); front margin of head nearly straight in adults, with shallow central and side indentations; front teeth blade-like, with 1 point, lower teeth straight, upper teeth oblique, deeply notched on rear side; rear teeth like front teeth; first dorsal fin very tall and curved, with pointed tip; second dorsal fin large, height > length of 3rd  gill slit; second dorsal and anal fins with strongly notched rear edges, their bases about equal; pelvics large, with concave rear borders; transverse pit above tail base crescent shaped, a pit below tail base; tail fin strongly asymmetrical, notched under tip of top lobe, large lower lobe.

Grey brown on back and sides, whitish below; no prominent markings on fins.

Said to reach 610 cm and 450kg, but uncommon above 350 cm; size at birth 50-70 cm.

A coastal pelagic and semi- oceanic species.

Depth range 1-300 m.

Circumtropical distribution, in the eastern Pacific from southern Baja California and the Gulf of California to northern Peru, Malpelo and the Galapagos.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© Shorefishes of the tropical eastern Pacific online information system. www.stri.org/sftep

Source: Shorefishes of the Tropical Eastern Pacific Online Information System

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Distribution

Djibouti, Eritrea, European waters (ERMS scope), Greek Exclusive Economic Zone, Gulf of Mexico, Kenya, Madagascar, Mauritius, Mediterranean Sea, Mozambique, North West Atlantic, Portuguese Exclusive Economic Zone, Red Sea, Reunion, Seychelles, Somalia, South Africa (country), Spanish Exclusive Economic Zone, Tanzania
Creative Commons Attribution 3.0 (CC BY 3.0)

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Circumglobal in coastal warm temperate and tropical seas (Ref. 13562). Western Atlantic: North Carolina, USA to Uruguay, including the Gulf of Mexico and Caribbean. Eastern Atlantic: Mediterranean and Morocco to Senegal. Indo-Pacific: throughout the Indian Ocean; Ryukyu Islands to New Caledonia and French Polynesia. Eastern Pacific: southern Baja California, Mexico to Peru. Highly migratory species, Annex I of the 1982 Convention on the Law of the Sea (Ref. 26139).
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Range Description

The great hammerhead ranges widely throughout the tropical waters of the world, from latitudes 40°N to 35°S (Last and Stevens 1994). It is apparently nomadic and migratory, with some populations moving polewards in the summer, as off Florida and in the South China Sea (Compagno in prep. b).

Widespread in the south-west Indian Ocean but in South Africa is confined to the KwaZulu-Natal coast, where it co-exists with the scalloped hammerhead S. lewini, also an inhabitant of the tropic, and the smooth hammerhead S. zygaena, which favours cooler waters (Cliff 1995, Bass et al. 1975). There is a pupping and nursery ground in a coastal mangrove estuarine area of southern Belize (R.T. Graham pers. obs).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Geographic Range

Great hammerhead sharks occur in all tropical waters worldwide.

Biogeographic Regions: oceanic islands (Native ); indian ocean (Native ); atlantic ocean (Native ); pacific ocean (Native )

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

North Carolina to Uruguay (highly migratory species)
Creative Commons Attribution 3.0 (CC BY 3.0)

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Circumglobal in tropical through warm temperate seas (including Red Sea, Madagascar, Mascarenes, Hawaiian Islands).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Depth

Depth Range (m): 1 (S) - 300 (S)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© Shorefishes of the tropical eastern Pacific online information system. www.stri.org/sftep

Source: Shorefishes of the Tropical Eastern Pacific Online Information System

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Zoogeography

See Map (including site records) of Distribution in the Tropical Eastern Pacific


 
Global Endemism: All species, TEP non-endemic, Circumtropical ( Indian + Pacific + Atlantic Oceans), "Transpacific" (East + Central &/or West Pacific), West + East Pacific (but not Central), East Pacific + Atlantic (East +/or West), Transisthmian (East Pacific + Atlantic of Central America), East Pacific + all Atlantic (East+West)

Regional Endemism: All species, Eastern Pacific non-endemic, Tropical Eastern Pacific (TEP) non-endemic, Continent + Island (s), Continent, Island (s)

Residency: Resident

Climate Zone: North Temperate (Californian Province &/or Northern Gulf of California), Northern Subtropical (Cortez Province + Sinaloan Gap), Northern Tropical (Mexican Province to Nicaragua + Revillagigedos), Equatorial (Costa Rica to Ecuador + Galapagos, Clipperton, Cocos, Malpelo), South Temperate (Peruvian Province )

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© Shorefishes of the tropical eastern Pacific online information system. www.stri.org/sftep

Source: Shorefishes of the Tropical Eastern Pacific Online Information System

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Range

The great hammerhead is found around the world in warm temperate and tropical seas including the Atlantic, Pacific and Indian Oceans and the Mediterranean and Black Seas (1) (2). It migrates poleward during the summer in search of cooler waters (3).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Physical Description

Morphology

Dorsal spines (total): 0; Dorsal soft rays (total): 0; Analspines: 0; Analsoft rays: 0
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Physical Description

Great hammerhead sharks posses a virtually straight anterior margin of the head with a deep central indentation. They have high second dorsal fins and the pelvic fins have curved rear margins. The teeth are triangular with extraordinarily serrated edges, becoming increasingly oblique toward the corners of the mouth. Their coloration varies from deep olive green to brownish grey above and white below. They are generally 4 to 6 m in length.

Range mass: 400 to 460 kg.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Size

Length max (cm): 610.0 (S)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© Shorefishes of the tropical eastern Pacific online information system. www.stri.org/sftep

Source: Shorefishes of the Tropical Eastern Pacific Online Information System

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Size

Maximum size: 6100 mm TL
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Max. size

610 cm TL (male/unsexed; (Ref. 244)); max. published weight: 449.5 kg (Ref. 40637)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Diagnostic Description

A very large hammerhead also with a notch at the center of the head (Ref. 5578). Front margin of head gently curved in juveniles, becoming nearly straight in adults, with slight median notch (Ref. 26938). 1st dorsal fin very high and curved; 2nd dorsal and pelvic fins high and with deeply concave rear margins. Light grey or grey-brown above, white below; fins without conspicuous markings (Ref. 5578).
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Description

A coastal-pelagic, semi-oceanic shark, found close inshore and well offshore, over the continental shelves, island terraces, and in passes and lagoons. Nomadic and migratory. Feeds on small bony fishes, crabs and squid, also on other sharks, rays, and lobsters. Viviparous, with 13 to 38 young in a litter. Size at birth 50 to 70 cm. Potentially dangerous. Meat utilized for human consumption, liver oil for vitamins, fins for soup, and hides for leather.
Creative Commons Attribution 3.0 (CC BY 3.0)

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Ecology

Habitat

Environment

pelagic-oceanic; oceanodromous (Ref. 51243); brackish; marine; depth range 1 - 300 m (Ref. 37816)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Habitat and Ecology

Habitat and Ecology
Sphyrna mokarran is a coastal-pelagic and semi-oceanic tropical hammerhead occurring close inshore and well offshore, over the continental shelves, island terraces, and in passes and lagoons of coral atolls, as well as over deep water near land, at depths ranging from near-surface to over 80 m (Compagno in prep. b). The maximum total size is reported as 550 to 610 cm by Compagno (in prep. b), though 400 cm is more common for a mature adult (Compagno in prep. b, Last and Stevens 1994). Males mature at about 234 to 269 cm, and reach at least 341 cm, and females mature at about 250 to 300 cm and reach 482 to 549 cm (Compagno in prep. b). S. mokarran is viviparous, with a yolk-sac placenta. Litter size ranges from 6 to 42 pups after 11 months? gestation (Compagno in prep. b). Size at birth is 50 to 70 cm. Females breed once every two years (Stevens and Lyle 1989). Pups are born in late spring to summer in the Northern Hemisphere and between December and January off Australia (Compagno in prep. b, Last and Stevens 1994).

The diet includes fish (mainly demersal species), other elasmobranchs, crustacea and cephalopods (Compagno in prep. b). Strong et al. (1990) observed a large (ca 4 m) great hammerhead feeding on a southern stingray Dasyatis americana (disc width 1.5 m).

Systems
  • Marine
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

These sharks are found in both open ocean and shallow coastal waters. During summer they may make small migrations towards more northerly areas.

Aquatic Biomes: reef ; coastal

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Found at depths of 1 - 300m.
Creative Commons Attribution 3.0 (CC BY 3.0)

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

nektonic
Creative Commons Attribution 3.0 (CC BY 3.0)

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Depth range based on 81 specimens in 1 taxon.
Water temperature and chemistry ranges based on 48 samples.

Environmental ranges
  Depth range (m): 0 - 1750
  Temperature range (°C): 3.860 - 27.331
  Nitrate (umol/L): 0.171 - 29.210
  Salinity (PPS): 34.006 - 36.580
  Oxygen (ml/l): 3.107 - 6.104
  Phosphate (umol/l): 0.083 - 1.926
  Silicate (umol/l): 0.380 - 23.528

Graphical representation

Depth range (m): 0 - 1750

Temperature range (°C): 3.860 - 27.331

Nitrate (umol/L): 0.171 - 29.210

Salinity (PPS): 34.006 - 36.580

Oxygen (ml/l): 3.107 - 6.104

Phosphate (umol/l): 0.083 - 1.926

Silicate (umol/l): 0.380 - 23.528
 
Note: this information has not been validated. Check this *note*. Your feedback is most welcome.
Public Domain

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Depth: 0 - 80m.
Recorded at 80 meters.

Habitat: pelagic. Great hammerhead.  (Ruppell, 1837)  Vivaparous; 20 pups per litter. Attains 5 metres. May be angerous to man. In tropical waters on our east coast, extending south to Natal; ranges widely in tropical seas, both inshore and over deep water.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Salinity: Marine, Marine Only

Inshore/Offshore: Offshore, In & Offshore, Inshore

Water Column Position: Mid Water, Near Bottom, Bottom

Habitat: Reef (rock &/or coral), Corals, Reef and soft bottom, Reef associated (reef + edges-water column & soft bottom), Soft bottom (mud, sand,gravel, beach, estuary & mangrove), Water column

FishBase Habitat: Pelagic
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© Shorefishes of the tropical eastern Pacific online information system. www.stri.org/sftep

Source: Shorefishes of the Tropical Eastern Pacific Online Information System

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Preferring warm temperate and tropical waters, the great hammerhead is usually found close inshore, particularly around reefs, but may also found some distance offshore to depths of 300 metres (2).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Migration

Oceanodromous. Migrating within oceans typically between spawning and different feeding areas, as tunas do. Migrations should be cyclical and predictable and cover more than 100 km.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

The great hammerhead can be found around the world in tropical waters such as the Atlantic, Pacific and Indian Oceans, and smaller seas like the Mediterranean, the Black Sea, and the Arabian Gulf. The great hammerhead migrates poleward during the summer in search of cooler waters.

Creative Commons Attribution 3.0 (CC BY 3.0)

 

Supplier: Lindsay Pickering

Unreviewed

Article rating from 0 people

Average rating: 2.5 of 5

Trophic Strategy

Occurs on the continental shelf (Ref. 75154). Inhabits coral reefs (Ref. 58534).
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Food Habits

Great hammerhead sharks feed on rays, smaller sharks, and many species of bony fishes.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Feeding

Feeding Group: Carnivore

Diet: mobile benthic crustacea (shrimps/crabs), mobile benthic gastropods/bivalves, octopus/squid/cuttlefish, bony fishes, sharks/rays
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© Shorefishes of the tropical eastern Pacific online information system. www.stri.org/sftep

Source: Shorefishes of the Tropical Eastern Pacific Online Information System

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Associations

Known prey organisms

Sphyrna mokarran preys on:
Myliobatidae

This list may not be complete but is based on published studies.
Creative Commons Attribution 3.0 (CC BY 3.0)

© SPIRE project

Source: SPIRE

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Life History and Behavior

Life Cycle

Viviparous with a yolk sac placenta and 13-42 young in a litter (Ref. 244); 6-42 pups after gestation period of ~11 months (Ref.58048). Size at birth between 50 to 70 cm TL (Ref.58048, Ref. 13562).
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Reproduction

Great Hammerhead sharks are viviparous. At a length of 3m, maturity is reached. Litters are made up of between 20 and 40 pups. Young are born in the summer season and are approximately 70 cm in length. Head shape of a newborn pup is more rounded than that of an adult but this changes as they grow.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Egg Type: Live birth, No pelagic larva
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© Shorefishes of the tropical eastern Pacific online information system. www.stri.org/sftep

Source: Shorefishes of the Tropical Eastern Pacific Online Information System

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Mating has not been that observed in this species, but unlike other sharks the great hammerhead is known to mate at the surface. Males use extensions of the pelvic fins called ‘claspers’ to transfer sperm to the females. The pregnancy’s last 11 months, and then the young are born live in the spring or summer.

Creative Commons Attribution 3.0 (CC BY 3.0)

 

Supplier: Lindsay Pickering

Unreviewed

Article rating from 0 people

Average rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Sphyrna mokarran

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 38 barcode sequences available from BOLD and GenBank.  Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

CCTTTACCTAATTTTTGGTGCATGAGCAGGTATAGTTGGAACAGCCCTAAGTCTTTTAATTCGAGCTGAACTTGGGCAACCAGGATCCCTTTTAGGAGATGATCAGATTTACAATGTAATTGTAACCGCCCACGCTTTCGTAATAATCTTTTTTATGGTAATGCCAATTATAATTGGTGGTTTTGGGAATTGACTAGTTCCTTTAATAATTGGTGCACCAGATATAGCTTTCCCACGAATAAATAACATAAGCTTCTGACTTCTTCCACCATCATTTCTTCTTCTCCTAGCTTCTGCTGGAGTAGAAGCTGGAGCAGGCACTGGCTGAACAGTCTATCCTCCATTAGCTAGCAACCTAGCTCATGCTGGACCATCCGTTGATCTAGCCATCTTCTCTCTCCACTTAGCTGGTATCTCATCAATCCTGGCCTCAATTAATTTCATCACAACTATTATTAACATAAAACCCCCAGCTATTTCTCAATACCAAACACCATTATTTGTCTGATCTATTCTTGTAACTACTATTCTACTTCTCCTTTCACTTCCAGTCCTTGCAGCAGGAATTACAATATTACTTACAGATCGCAACCTTAATACTACATTCTTTGACCCTGCAGGAGGAGGAGATCCAATTCTTTATCAACATTTATTC
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Statistics of barcoding coverage: Sphyrna mokarran

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 37
Specimens with Barcodes: 49
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Genomic DNA is available from 3 specimens with morphological vouchers housed at British Antarctic Survey
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© Ocean Genome Legacy

Source: Ocean Genome Resource

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Conservation

Conservation Status

IUCN Red List Assessment


Red List Category
EN
Endangered

Red List Criteria
A2bd+4bd

Version
3.1

Year Assessed
2007

Assessor/s
Denham, J., Stevens, J., Simpfendorfer, C.A., Heupel, M.R., Cliff, G., Morgan, A., Graham, R., Ducrocq, M., Dulvy, N.D, Seisay, M., Asber, M., Valenti, S.V., Litvinov, F., Martins, P., Lemine Ould Sidi, M., Tous, P. and Bucal, D.

Reviewer/s
Dudley, S., Musick, J., Fowler, S.L., Kyne, P.M., Cavanagh, R.D. and Valenti, S.V. (Shark Red List Authority)

Justification
A large, widely distributed, tropical hammerhead shark largely restricted to continental shelves. Sphyrna mokarran is highly valued for its fins (in target and incidental fisheries), suffers very high bycatch mortality and only reproduces once every two years, making it vulnerable to over-exploitation and population depletion. Generally regarded as solitary, and is therefore unlikely to be abundant wherever it occurs. Previously observed from Mauritania to Angola, reportedly abundant from November to January in Senegal, and in October in Mauritania, stocks have since collapsed and it is recognized as one of the four most threatened species by member states of the Sub Regional Fishing Commission. Although there is very little species specific data available, the absence of recent records give cause to suspect a decline of at least 80% in the past 25 years. Fishing proceeds unmanaged and unmonitored, resulting in an assessment of Critically Endangered in the Eastern Atlantic. Although not targeted in the Northwest Atlantic and Gulf of Mexico it is taken as by-catch in several fisheries and suffers greater than 90% vessel mortality. Two time series data sets (pelagic logbook, large pelagic survey) have shown a decline in the catch of Sphyrna spp. since 1986. Difficulties in species identification and accurate recording make an assessment of this species very difficult, however low survival at capture makes it highly vulnerable to fishing pressure, whether directed or incidental. It is therefore assessed as Endangered in the Northwest Atlantic and Gulf of Mexico, based on a suspected decline of at least >50% over the past 10 years. The decline is poorly documented and has not been curtailed. In the Southwest Indian Ocean this species is assessed as Endangered based on a continued decline in catch rate of 79% reported for the period 1978 to 2003. It is uncertain whether these declines reflect highly localized stock depletion or whether they reflect a general decline in the Southwest Indian Ocean, but large numbers of longline vessels have been reported to be operating illegally in coastal waters of the western Indian Ocean where they are targeting primarily hammerhead sharks and giant guitarfish Rhynchobatus djiddensis. Sphyrna mokarran is found along the northern coast of Australia. A large increase in the illegal, unregulated and unreported (IUU) fishing in northern Australia in the last few years points to great concern that this species is being increasingly targeted for its valuable large fins. Recent Risk Assessments of northern Australian elasmobranchs indicate that it may be ?high-risk? however, due to a lack of data to form the basis of an accurate assessment, the species is considered Data Deficient in Australia at the present time. Further investigation of its status there is required. Given its vulnerability to depletion, low survival at capture and high value for the fin trade this species is considered to meet the criteria for Endangered globally based on the available evidence for declines of >50%. There is an urgent need for data collection in other parts of its range, but considering the high value of its fins and high fishing pressure in other parts of its range, similar declines are likely to have occurred elsewhere.

History
  • 2000
    Data Deficient
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Great hammerhead shark populations seem to be stable.

US Federal List: no special status

CITES: no special status

IUCN Red List of Threatened Species: endangered

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

IUCN Red List: Listed, Endangered

CITES: Not listed
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© Shorefishes of the tropical eastern Pacific online information system. www.stri.org/sftep

Source: Shorefishes of the Tropical Eastern Pacific Online Information System

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Status

Classified as Endangered (EN) on the IUCN Red List (1).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

The great hammerhead is desperately in need of coordinated conservation efforts involving the management of directed fisheries and those that take this species as bycatch. Fortunately, the increasing recognition of the detrimental effects of shark finning has led to the implementation of finning bans by fishing states in the U.S.A., Australia and the European Union. Nevertheless, improved enforcement of legislation is required to prevent ongoing illegal finning activities. Bycatch limits for sharks in the South African longline fishery are also helping to conserve this imperilled species

Creative Commons Attribution 3.0 (CC BY 3.0)

 

Supplier: Lindsay Pickering

Unreviewed

Article rating from 0 people

Average rating: 2.5 of 5

Population

Population Trend
Decreasing
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Threats

Endangered (EN) (A2bd+4bd)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Major Threats
Due to the distinctive head shape of this genus, it is typical for catches to be reported at the genus level, Sphyrna spp. Therefore, it is rare to find fisheries statistics that are specific to one species of hammerhead shark. Due to the great hammerhead?s preference for warmer waters, it can be expected to make up a greater proportion of tropical catches of hammerheads than more temperate fisheries. Sphyrna mokarran is taken by target and bycatch, fisheries (Dudley and Simpfendorfer 2006, Zeeberg et al. 2006) and is regularly caught in the tropics, with longlines, fixed bottom nets, hook-and-line, and possibly with pelagic and bottom trawls (Compagno in prep). Hammerhead sharks, S. mokarran in particular, have been noted as a favoured target species due to the size of their fins (R.T. Graham pers. comm). Fin prices are rising, driven by the Asian Fin market (R.T. Graham pers. obs).

There was a directed shark fishery operated by Taiwan around the northern coast of Australia that regularly caught great hammerheads up until 1986 (Stevens and Lyle 1989). Other possible threats include sport fishing (Pepperell 1992) and capture in anti-shark measures around the beaches of Australia and South Africa (Paterson 1990, Cliff 1995). Bonfil (1994) gives an overview of global shark fisheries. This species is mentioned specifically with reference to fisheries in Brazil, East USA and Mexico, however Sphyrna spp. are mentioned in the majority of tropical fisheries cited.

West Africa
Mainly taken by drift gillnets, bottom gillnets and on longlines, hook and line, pelagic and bottom trawls (Schneider 1990). This species is a bycatch in both the industrial and artisanal fisheries but a specialised artisanal fishery for charcharhinid and sphyrnid species was introduced in Sierra Leone in 1975, and since then fishing pressure has not decreased (M. Seisay pers. obs). The Subregional workshop for sustainable management of sharks and rays in West Africa, 26-28 April 2000 in St Louis, Senegal (Ducrocq 2002) noted the high threat to sharks in the west African region and a noticeable decline in the CPUE of total sharks and rays. This workshop identified S. mokkarran as particularly threatened. The subsequent sub-regional plan of action for sharks of West Africa (member states of the Sub Regional Fishing Commission) states that landings of S. mokarran have collapsed and lists this as one of the four most threatened species, deserving the greatest attention in the whole region (Ducrocq 2002).

Previously observed from Mauritania to Angola, reportedly abundant from November to January in Senegal, and in October in Mauritania (Cadenat and Blache 1981). However, recent scientific trawl surveys off Guinea-Bissau, Mauritania, Senegal, Gambia and Guinea-Conakry between 20 to 1,000 m have failed to record it, except in very low numbers off Guinea-Conakry and one record from Senegal in 1995 (FISA unpublished data). Anecdotal evidence from interviews with fishermen in Senegal, Guinea-Bissau and Guinea suggest there was a large decline in all shark species during the 1990s and that S. mokarran is almost extirpated from these areas (M. Ducrocq pers. obs.).

Data are lacking as there is little species specific data collection in the region, however this is a very distinctive species with a large dorsal fin which is highly valued for the shark fin trade. Increased targeting of sharks began in the 1970s, when a Ghanaian fishing community settled in the Gambia and established a commercial network throughout the region, encouraging local fishermen to target sharks for exportation to Ghana. By the 1980s many fishermen were specialising in catching sharks, resulting in a decline in overall shark populations (Walker et al. 2005). There has been rapid growth in the shark fin market in this region, for export to the Far East, and yearly production of dried fins exported from Guinea-Bissau alone is estimated at 250 t (dry weight) (Walker et al. 2005). Sphyrna species combined represented 42% of bycatch in the European industrial pelagic trawl fishery off Northwest Africa (Zeeberg 2006).

Although there are very little species specific data available, the absence of recent records and region-wide recognition of the extent of the decline, give cause to suspect that the population has decreased by least 80% in the past 25 years. Fisheries in this region remain largely unmonitored and unmanaged, leading to an assessment of Critically Endangered in the Eastern Atlantic.

Southwest Indian Ocean
This species is widely distributed in the SW Indian Ocean and is a summer migrant to KwaZulu-Natal (KZN) (east coast of South Africa), where the annual catch in the KZN shark nets is 11 sharks (1978 to 1999), consisting mainly of adolescents and adults. Over this period there has been a significant decline in annual catch (18 to 4 sharks) and catch rate (0.5 to 0.2 sharks.km-net-1.yr-1 (p = 0.000) (Dudley 2002). A continued decline in catch rate was reported for the period 1978 to 2003 (Dudley and Simpfendorfer 2006). Over this period, regression of catch and catch rate against year revealed a significant decline in annual catch from 18 to two sharks (89%) and in catch rate from 0.44 to 0.09 sharks.km-net-1.yr-1 (79%) (S. Dudley pers. obs. 2006). It is uncertain whether these declines reflect highly localized stock depletion or whether they reflect a general decline in the Southwest Indian Ocean, but large numbers of longline vessels have been reported to be operating illegally in coastal waters of the western Indian Ocean where they are targeting primarily hammerhead sharks and giant guitarfish Rhynchobatus djiddensis (IOTC 2005 in Dudley and Simpfendorfer 2006). This species is generally regarded as solitary, and is therefore unlikely to be abundant wherever it occurs. This is in contrast to other large hammerheads, such as Sphyrna lewini which forms large schools. Sphyrna mokarran, like other hammerheads, readily takes baited hooks and is sought after for its fins. Based on these characteristics, together with the decline of 79% in catch rates in the KZN shark nets, this species is assessed as Endangered in the southwest Indian Ocean.

Northwest Atlantic
This species is caught primarily as a bycatch in the pelagic longline, bottom longline and net fisheries along the northwest Atlantic and Gulf of Mexico. It is also caught in the recreational fishery. The species represents 0.7% of the species catch and suffers from greater than 90% at-vessel fishing mortality in the U.S. bottom longline fishery (Commercial Shark Fishery Observer Program unpubl. data). The U.S. pelagic fishery logbook data has shown a decline close to 90%, however this data-set is known for inaccurate data reporting (Beerkircher et al. 2002). There is probably a lack of reporting of the catch of great hammerheads because this species is routinely finned and discarded, which is illegal in the US Atlantic Federal Waters (Commercial Shark Fishery Observer Program unpub. data). Both the pelagic and bottom longline observer programs have recorded a 2 to 3:1 ratio for S. Lewini to S. mokarran. The meat is not valuable but the fins are high grade and bring in a good price, thus finning still occurs in the U.S. fishery. Interview with shark fishermen in Belize indicate that hammerheads (S. mokarran in particular) are a favoured target species for their large fins (R.T. Graham pers. obs.). Fin prices are rising above US$50/lb in the neighbouring countries of Guatemala, driven by Asian buyers, according to these interviews (R.T. Graham pers. obs). This species is probably caught in other fisheries but is usually placed in a combined ?hammerhead? category. Species identification (S. mokarran vs. S. lewini) a large obstacle in the proper assessment of this species. The high at-vessel fishing mortality for both species of hammerhead makes the threat of fishing even greater for this species. In the Pacific Ocean off of Guatemala this species is caught as by-catch in the commercial longline fishery.

There appear to be little data for landings and catch effort for this species in Central America and the Caribbean. Off the coast of Belize hammerheads were fished heavily by longline in the 1980s and early 1990s. Interviews with fishermen indicate that the abundance and size of Sphyrnids has declined dramatically in the past 10 years as a result of over exploitation, leading to a halt in the Belize based shark fishery (R.T. Graham pers. obs). However, the pressure is still sustained by fishers driving into Belizean waters from Guatemala (R.T. Graham pers. obs). The Cuban directed shark fishery (longline) between 1983 and 1991 recorded S. mokarran (subadults and juveniles) as one of 23 species caught. Since 1992 small increases in mean sizes were noted, indicating partial recovery of the species. In Mexico between November 1993 and December 1994 (Tamaulipas, Veracruz, Tabasco, Campeche and Yucatan) 901 vessels were monitored every day. Sphyrna mokarran represented 86% of the total catch.

The difficulty in species identification and accurate recording make an assessment of this species very difficult. However, low survival at capture makes this species very vulnerable to fishing pressure, whether directed or incidental. This species is listed as Endangered in the Northwest Atlantic under criterion A2 based on a suspected decline of at least >50% over the past 10 years. The decline is poorly documented and has not been curtailed.

Australia
There has been a large increase in the illegal, unregulated and unreported (IUU) fishing in northern Australia in the last few years (J. Stevens pers. obs.). Several initiatives are underway to identify which species are being taken and in what quantities. Hammerheads are known to feature in the catches, and are suspected targets for their large valuable fins, although no specific data are available. Some domestic boats are also suspected to be targeting species for their fins in the Northern Territory, and this likely includes hammerheads (J. Stevens pers. obs). It is not a productive species and is coming out at the ?high-risk? end in recent Risk Assessments of northern Australian elasmobranchs (J. Stevens pers. obs). There is concern that this species is being increasingly targeted, and therefore an urgent need to obtain data to form an accurate assessment of the population in this region.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Although not targeted specifically, once caught accidentally on longline and in drift nets, this shark is rarely returned to the water alive. It is prized for its fins for shark fin soup, as well as for its liver oil for vitamins, its skin for leather, and its meat for fishmeal (2).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Management

Conservation Actions

Conservation Actions
There are no known species specific conservation measures in place for S. mokarran.

This species is listed on Annex I, Highly Migratory Species, of the UN Convention on the Law of the Sea, which urges States to cooperate over the management of these species. No such management yet exists. Precautionary adaptive collaborative management of target and bycatch fisheries is urgently needed for this unproductive shark. It is also essential to improve data collection and develop stock assessments for this species.

The adoption of shark finning bans by fishing states (e.g., USA, Australia), regional entities (EU) and regional fisheries organisations (ICCAT) is accelerating and should increasingly prevent the harvesting of hammerhead sharks for their fins alone.

In the U.S. this species is managed as a Large Coastal Shark on U.S. Highly Migratory Species Fishery Management Plan (National Marine Fisheries Service: Federal Fisheries Management Plan for Atlantic Tuna, Swordfish and Sharks).

In South Africa there is a shark bycatch limit in the tuna longline fishery of 10% of the weight of tuna landed, and a recreational line fishery Bag Limit of one shark per angler per day.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Conservation

Sharks have a poor reputation with humans although they are responsible for relatively few deaths. All nine species of hammerhead together have attacked just 21 people, resulting in two deaths in the history of the International Shark Attack File, which attempts to compile all shark attacks on record since the mid 1500s. Conservation action for sharks is generally poor, but further research into great hammerhead population numbers and trends is necessary before it is known how threatened this species is (3).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Relevance to Humans and Ecosystems

Benefits

Importance

fisheries: commercial
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Economic Importance for Humans: Negative

These sharks are potentially dangerous to humans and cases of attacks by great hammerhead sharks have been documented.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Economic Importance for Humans: Positive

Great hammerhead sharks are classified as game fish, as are all large hammerhead sharks. Their skin is often used for leather.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Wikipedia

Great hammerhead

The great hammerhead (Sphyrna mokarran) is the largest species of hammerhead shark, family Sphyrnidae, attaining a maximum length of 6.1 m (20 ft). It is found in tropical and warm temperate waters worldwide, inhabiting coastal areas and the continental shelf. The great hammerhead can be distinguished from other hammerheads by the shape of its "hammer" (called the "cephalofoil"), which is wide with an almost straight front margin, and by its tall, sickle-shaped first dorsal fin. A solitary, strong-swimming apex predator, the great hammerhead feeds on a wide variety of prey ranging from crustaceans and cephalopods, to bony fishes, to smaller sharks. Observations of this species in the wild suggest that the cephalofoil functions to immobilize stingrays, a favored prey. This species has a viviparous mode of reproduction, bearing litters of up to 55 pups every two years.

Although potentially dangerous, the great hammerhead rarely attacks humans. It sometimes behaves inquisitively toward divers and should be treated with respect. This shark is heavily fished for its large fins, which are extremely valuable on the Asian market as the main ingredient of shark fin soup. As a result, great hammerhead populations are declining substantially worldwide, and it has been assessed as Endangered by the International Union for Conservation of Nature (IUCN).

Contents

Taxonomy and phylogeny [edit]

The great hammerhead was first described as Zygaena mokarran in 1837 by the German naturalist Eduard Rüppell. The name was later changed to the current Sphyrna mokarran.[2] However, for many years the valid scientific name for the great hammerhead was thought to be Sphyrna tudes, which was coined in 1822 by Achille Valenciennes. In 1950, Enrico Tortonese determined that the specimens illustrated by Valenciennes were in fact smalleye hammerheads, to which the name S. tudes then applied. As the next most senior synonym, Sphyrna mokarran became the great hammerhead's valid name. The lectotype for this species is a 2.5 m (8.2 ft) long male from the Red Sea.[3]



Eusphyra blochii





Sphyrna mokarran



Sphyrna zygaena





Sphyrna lewini





Sphyrna tudes



Sphyrna media





Sphyrna tiburo



Sphyrna corona







Phylogenetic tree of hammerhead sharks.[4]

Older studies based on morphology have generally placed the great hammerhead as one of the more derived members of its family, reflecting the traditional view that cephalofoil size gradually increased over the course of hammerhead shark evolution. However, this view has been refuted by phylogenetic analyses using nuclear and mitochondrial DNA, which found that the great hammerhead and the smooth hammerhead (S. zygaena) form a clade that is basal to all other Sphyrna species. These results also show that the first hammerheads to evolve had large rather than small cephalofoils.[4][5]

Distribution and habitat [edit]

The great hammerhead inhabits tropical waters around the world, between the latitudes of 40°N and 37°S. In the Atlantic Ocean, it is found from North Carolina to Uruguay, including the Gulf of Mexico and the Caribbean Sea, and from Morocco to Senegal, and the Mediterranean Sea. It is found all along the rim of the Indian Ocean, and in the Pacific Ocean from the Ryukyu Islands to Australia, New Caledonia, and French Polynesia, and from southern Baja California to Peru.[2] It may occur off Gambia, Guinea, Mauritania, Sierra Leone, and Western Sahara, but this has not been confirmed.[1] Great hammerheads may be found from inshore waters of less than 1 m (3.3 ft) deep, to a depth of 80 m (230 ft) offshore. They favor coral reefs, but also inhabit continental shelves, island terraces, lagoons, and deep water near land. They are migratory; populations off Florida and in the South China Sea have been documented moving closer to the poles in the summer.[3]

Description [edit]

The "hammer" of the great hammerhead is wide with a distinctively straight leading edge.

The streamlined body of the great hammerhead with the expanded cephalofoil is typical of the hammerhead sharks. Adult great hammerheads can be distinguished from the scalloped hammerhead and the smooth hammerhead by the shape of the cephalofoil, which has a nearly straight front margin (as opposed to arched), with prominent medial and lateral indentations. The width of the cephalofoil is 23–27% of the body length. The teeth are triangular and strongly serrated, becoming more oblique towards the corners of the mouth. There are 17 tooth rows on either side of the upper jaw with 2–3 teeth at the symphysis (the midline of the jaw), and 16–17 teeth on either side of the lower jaw and 1–3 at the symphysis.[2]

The first dorsal fin is distinctive, being very tall and strongly falcate (sickle-shaped), and originates over the insertions of the pectoral fins. The second dorsal fin and anal fin are both relatively large, with deep notches in the rear margins. The pelvic fins are falcate with concave rear margins, in contrast to the straight-margined pelvic fins of the scalloped hammerhead. The skin is covered with closely placed dermal denticles. Each denticle is diamond-shaped, with 3–5 horizontal ridges leading to marginal teeth in smaller individuals, and 5–6 in larger ones. The great hammerhead is dark brown to light gray to olive above, fading to white on the underside. The fins are unmarked in adults, while the tip of the second dorsal fin may be dark in juveniles.[2][3]

The average great hammerhead measures up to 3.5 m (11.5 ft) long and weighs over 230 kg (500 lb). A small percentage of the population, mostly or all females, are much larger. The longest great hammerhead on record was 6.1 m (20 ft).[2][3] The heaviest known great hammerhead is a 4.4 m (14.4 ft) long, 580 kg (1,280 lb) female caught off Boca Grande, Florida in 2006. The weight of the female was due to her being pregnant with 55 near-natal pups.[6]

Biology and ecology [edit]

The great hammerhead is a solitary, nomadic predator that tends to be given a wide berth by other reef sharks. If confronted, they may respond with an agonistic display: dropping their pectoral fins and swimming in a stiff or jerky fashion.[7] Juveniles are preyed upon by larger sharks such as bull sharks (Carcharhinus leucas), while adults have no major predators.[2] Yellow jacks (Carangoides bartholomaei) have been seen rubbing themselves against the hammerhead's flanks, possibly to rid themselves of parasites.[8] Schools of pilot fish (Naucrates ductor) sometimes accompany the great hammerhead.[9] The great hammerhead is parasitized by several species of copepods, including Alebion carchariae, A. elegans, Nesippus orientalis, N. crypturus, Eudactylina pollex, Kroyeria gemursa, and Nemesis atlantica.[2]

Feeding [edit]

Stingrays are a favored prey of the great hammerhead.

An active predator with a varied diet, known prey of the great hammerhead include invertebrates such as crabs, lobsters, squid, and octopus, bony fishes such as tarpon, sardines, sea catfishes, toadfish, porgies, grunts, jacks, croakers, groupers, flatfishes, boxfishes, and porcupine fishes, and smaller sharks such as smoothhounds.[3] At Rangiroa Atoll, great hammerheads prey opportunistically on grey reef sharks (Carcharhinus amblyrhynchos) that have exhausted themselves pursuing mates.[10] The species is known to be cannibalistic.[2]

The favorite prey of the great hammerhead are rays and skates, especially stingrays. The venomous spines of stingrays are frequently found lodged inside its mouth and do not seem to bother the shark as one specimen caught off Florida had 96 spines in and around its mouth. Great hammerheads primarily hunt at dawn or dusk, swinging their heads in broad angles over the sea floor so as to pick up the electrical signatures of stingrays buried in the sand, via numerous ampullae of Lorenzini located on the underside of the cephalofoil. The cephalofoil also serves as a hydrofoil that allows the shark to quickly turn around and strike at a ray once detected.[11] Off Florida, large hammerheads are often the first to reach newly baited sharklines, suggesting a particularly keen sense of smell.[3]

Another function of the cephalofoil is suggested by an observation of a great hammerhead attacking a southern stingray (Dasyatis americana) in the Bahamas: the shark first knocked the ray to the sea bottom with a powerful blow from above, and then pinned it with its head while pivoting to take a large bite from each side of the ray's pectoral fin disc. This effectively crippled the stingray, which was then picked up in the jaws and sawed apart with rapid shakes of the head.[12] A great hammerhead has also been seen attacking a spotted eagle ray (Aetobatus narinari) in open water by taking a massive bite out of one of its pectoral fins. The ray thus incapacitated, the shark once again used its head to pin it to the bottom and pivoted to take the ray in its jaws head-first. These observations suggest that the great hammerhead seeks to disable rays with the first bite, a strategy similar to that of the great white shark (Carcharodon carcharias), and that its cephalofoil is an adaptation for prey handling.[13]

Life history [edit]

Great hammerhead embryos are connected to their mother by a placenta during gestation.

As with other hammerhead sharks, great hammerheads are viviparous: once the developing young use up their supply of yolk, the yolk sac is transformed into a structure analogous to a mammalian placenta. Unlike most other sharks, which mate on or near the sea bottom, great hammerheads have been observed mating near the surface. In one account from the Bahamas, a mating pair ascended while swimming around each other, mating when they reached the surface.[2] Females breed once every two years, giving birth from late spring to summer in the Northern Hemisphere and from December to January in Australian waters.[1] The gestation period is 11 months.[2] The litter size ranges from 6–55 pups, with 20–40 being typical.[6] The young measure 50–70 cm (20–28 in) at birth; males reach maturity at 2.3–2.8 m (7.5–8.9 ft) long and 51 kg (113 lbs) and the females at 2.5–3.0 m (8.2–9.8 ft) and 41 kg (90 lbs). The young differ from the adults in having a rounded frontal margin on the head.[1][2] The typical lifespan of this species is 20–30 years;[2] the record Boca Grande female was estimated to be 40–50 years old.[6]

Human interactions [edit]

A great hammerhead caught by a sport fisherman. Human exploitation now threatens the survival of this species.

With its large size and cutting teeth, the great hammerhead is certainly capable of inflicting fatal injuries to a human and caution should be exercised around them. This species has a (possibly undeserved) reputation for aggression and being the most dangerous of the hammerhead sharks.[14][15] Divers underwater have reported that great hammerheads tend to be shy or unreactive to humans.[8][11] However, there are reports of great hammerheads approaching divers closely and even charging them when they first enter the water.[9][14] As of 2009, the International Shark Attack File lists 34 attacks, 17 of them unprovoked and 1 fatal, attributable to hammerhead sharks of the genus Sphyrna. Due to the difficulty in identifying the species involved, it is uncertain how many were caused by great hammerheads. This shark has been confirmed to be responsible for only one (provoked) attack.[16]

The great hammerhead is regularly caught both commercially and recreationally in the tropics, using longlines, fixed bottom nets, hook-and-line, and trawls. Though the meat is rarely consumed, their fins are becoming increasing valuable due to the Asian demand for shark fin soup.[1] In addition, their skin used for leather, their liver oil for vitamins, and their carcasses for fishmeal.[2] The great hammerhead is also taken unintentionally as bycatch and suffers very high mortality, over 90% for fisheries in the northwest Atlantic and the Gulf of Mexico. Entanglement in shark nets around Australian and South African beaches is another source of mortality.[1]

Conservation status [edit]

The great hammerhead is extremely vulnerable to overfishing due to its low overall abundance and long generation time. Assessment of its conservation status is difficult as few fisheries separate the great hammerhead from other hammerheads in their reported catches. This species is listed as globally Endangered on the IUCN Red List. It is Endangered in the northwestern Atlantic and the Gulf of Mexico, where though it is a non-targeted species, populations have dropped 50% since the 1990s due to bycatch. It is also Endangered in the southwestern Indian Ocean, where large numbers of longline vessels operate illegally along the coasts for hammerheads and the giant guitarfish (Rhynchobatus djiddensis). The great hammerhead catch rate in Indian Ocean has declined 73% from 1978 to 2003, though it is yet undetermined whether these represent localized or widespread depletion. The great hammerhead is Critically Endangered along the western coast of Africa, where stocks have collapsed with an estimated 80% decline in the past 25 years. The West African Sub-Regional Fishing Commission (SRFC) has recognized the great hammerhead as one of the four most threatened species in the region, though fishing continues unmonitored and unregulated. Off northern Australia, this species was assessed as Data Deficient but at "high risk". Concern has arisen there over a substantial increase in illegal, unreported, and unregulated (IUU) fishing, reflecting the raising value of this shark's fins.[1]

No conservation measures specifically protecting the great hammerhead have been enacted. It is listed on Annex I, Highly Migratory Species, of the UN Convention on the Law of the Sea, though no management schemes have yet been implemented under this agreement. The banning of shark finning by countries and supranational entities such as United States, Australia, and the European Union, and international regulatory bodies such as the International Commission for the Conservation of Atlantic Tunas (ICCAT), should reduce fishing pressure on the great hammerhead.[1]

References [edit]

  1. ^ a b c d e f g h Denham, J., Stevens, J., Simpfendorfer, C.A., Heupel, M.R., Cliff, G., Morgan, A., Graham, R., Ducrocq, M., Dulvy, N.D, Seisay, M., Asber, M., Valenti, S.V., Litvinov, F., Martins, P., Lemine Ould Sidi, M., Tous, P. and Bucal, D. (2007). "Sphyrna mokarran". IUCN Red List of Threatened Species. Version 2010.1. International Union for Conservation of Nature. Retrieved May 20, 2010. 
  2. ^ a b c d e f g h i j k l m Bester, Cathleen. Biological Profiles: Great Hammerhead. Florida Museum of Natural History Ichthyology Department. Retrieved on October 18, 2008.
  3. ^ a b c d e f Compagno, L.J.V. (1984). Sharks of the World: An Annotated and Illustrated Catalogue of Shark Species Known to Date. Rome: Food and Agricultural Organization. pp. 548–549. ISBN 92-5-101384-5. 
  4. ^ a b Lim, D.D.; Motta, P.; Mara, K.; Martin, A.P. (2010). "Phylogeny of hammerhead sharks (Family Sphyrnidae) inferred from mitochondrial and nuclear genes". Molecular Phylogenetics and Evolution 55 (2): 572–579. 
  5. ^ Cavalcanti, M.J. (2007). "A Phylogenetic Supertree of the Hammerhead Sharks (Carcharhiniformes: Sphyrnidae)". Zoological Studies 46 (1): 6–11. 
  6. ^ a b c "Record Hammerhead Pregnant With 55 Pups". Discovery News. Associated Press. July 1, 2006. Retrieved October 18, 2008. 
  7. ^ Martin, R.A. (Mar. 2007). "A review of shark agonistic displays: comparison of display features and implications for shark–human interactions". Marine and Freshwater Behaviour and Physiology 40 (1): 3–34. doi:10.1080/10236240601154872. 
  8. ^ a b Great Hammerhead. Elasmodiver.com. Retrieved on October 18, 2008.
  9. ^ a b Stafford-Deitsch, J. (1999). Red Sea Sharks. Trident Press Ltd. pp. 92–93. ISBN 1-900724-28-6. 
  10. ^ Whitty, J. (2007). The Fragile Edge: Diving and Other Adventures in the South Pacific. Houghton Mifflin Harcourt. p. 9. ISBN 0-618-19716-8. 
  11. ^ a b Hammerschlag, Rick. Sandy Plains: Great Hammerhead Shark. ReefQuest Centre for Shark Research. Retrieved on October 18, 2008.
  12. ^ Strong, W.R., Snelson, Jr., F.F., and Gruber, S.H. (Sep. 19, 1990). "Hammerhead Shark Predation on Stingrays: An Observation of Prey Handling by Sphyrna mokarran". Copeia (American Society of Ichthyologists and Herpetologists) 1990 (3): 836–840. doi:10.2307/1446449. JSTOR 1446449. 
  13. ^ Chapman, D.D. and Gruber, S.H. (May 2002). "A further observation of the prey-handling behavior of the great hammerhead shark, Sphyrna mokarran: predation upon the spotted eagle ray, Aetobatus narinari". Bulletin of Marine Science 70 (3): 947–952. 
  14. ^ a b Stafford-Deitsch, J. (2000). Sharks of Florida, the Bahamas, the Caribbean and the Gulf of Mexico. Trident Press Ltd. pp. 90–91. ISBN 1-900724-45-6. 
  15. ^ Thornley, M., Dante, V., Wilson, P. and Bartholomew, W. (2003). Surfing Australia (second ed.). Tuttle Publishing. p. 264. ISBN 962-593-774-9. 
  16. ^ ISAF Statistics on Attacking Species of Shark. International Shark Attack File, Florida Museum of Natural History, University of Florida. Retrieved on April 24, 2009.
Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

 

Source: Wikipedia

Unreviewed

Article rating from 0 people

Average rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!