Articles on this page are available in 1 other language: Chinese (Simplified) (4) (learn more)

Overview

Comprehensive Description

Biology

Inhabits seaward reefs to at least 35 m depth, usually in areas of mixed coral and reef rock with sand patches (Ref. 9710). Also in reef crests and slopes on rocky or rubble-algae substrates (Ref. 48636).
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Distribution

Range Description

This species ranges from the Philippines to Samoa, northwards to southern Japan and southwards to Rowley Shoals and Ningaloo Reef in the west and southern New South Wales (Montague Island) in the east.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Western Pacific: Philippines to Samoa, north to southern Japan, south to Rowley Shoals and the southern Great Barrier Reef.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

West Pacific and southeastern Indian Ocean.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Physical Description

Morphology

Dorsal spines (total): 9; Dorsal soft rays (total): 12; Analspines: 3; Analsoft rays: 11 - 12
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Size

Maximum size: 120 mm NG
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Max. size

12.0 cm TL (male/unsexed; (Ref. 9710))
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Diagnostic Description

Juveniles and sub adults have a pair of ocelli on the dorsal fin which disappears with growth (Ref. 1602, 48636).
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Type Information

Paratype for Halichoeres biocellatus Schultz
Catalog Number: USNM 112941
Collection: Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Fishes
Collector(s): E. Herald
Year Collected: 1946
Locality: Marshall Islands: Rongelap Atoll at Lomuilal Island, west side of Lomuilal Island. lagoon reef., Rongelap Atoll, Ralik Chain, Marshall Islands, Pacific
Depth (m): 3
  • Paratype: Schultz, L. P. 1953. Bulletin of the United States National Museum. No. 202: 233.
Creative Commons Attribution 3.0 (CC BY 3.0)

© Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Fishes

Source: National Museum of Natural History Collections

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Type for Halichoeres biocellatus Schultz
Catalog Number: USNM 112940
Collection: Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Fishes
Preparation: Illustration
Collector(s): V. Brock, E. Herald, Donaldson, A. Welander, Potski & Bradner
Year Collected: 1946
Locality: Marshall Islands: Bikini Atoll, isolated coral area 100 yds offshore of Airukiiji (Arji) Island; Bikini Atoll, lagoon side., Bikini Atoll, Ralik Chain, Marshall Islands, Pacific
Depth (m): 12
  • Type: Schultz, L. P. 1953. Bulletin of the United States National Museum. No. 202: 233.
Creative Commons Attribution 3.0 (CC BY 3.0)

© Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Fishes

Source: National Museum of Natural History Collections

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Paratype for Halichoeres biocellatus Schultz
Catalog Number: USNM 112942
Collection: Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Fishes
Collector(s): L. Schultz
Year Collected: 1947
Locality: Johnston Island, 750 mile southwest of Honolulu northwest side and northeast side of reef., Johnston Atoll, United States Minor Outlying Islands, Pacific
  • Paratype: Schultz, L. P. 1953. Bulletin of the United States National Museum. No. 202: 233.
Creative Commons Attribution 3.0 (CC BY 3.0)

© Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Fishes

Source: National Museum of Natural History Collections

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Ecology

Habitat

Habitat and Ecology

Habitat and Ecology
This species inhabits seaward reefs to at least 35 m depth, usually from seven to 35 m usually in areas of mixed coral and reef rock with sand patches (Lieske and Myers 1994). It is also found in reef crests and slopes on rocky or rubble-algae substrates (Kuiter and Tonozuka 2001). The maximum size recorded for male/unsexed is 12.0 cm TL (Lieske and Myers 1994).

Systems
  • Marine
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Environment

reef-associated; marine; depth range 7 - 35 m (Ref. 9710), usually 7 - 35 m (Ref. 27115)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Depth range based on 41 specimens in 1 taxon.
Water temperature and chemistry ranges based on 24 samples.

Environmental ranges
  Depth range (m): 0.5 - 53
  Temperature range (°C): 25.245 - 29.171
  Nitrate (umol/L): 0.027 - 0.822
  Salinity (PPS): 34.114 - 35.383
  Oxygen (ml/l): 4.444 - 4.812
  Phosphate (umol/l): 0.086 - 0.238
  Silicate (umol/l): 0.810 - 3.817

Graphical representation

Depth range (m): 0.5 - 53

Temperature range (°C): 25.245 - 29.171

Nitrate (umol/L): 0.027 - 0.822

Salinity (PPS): 34.114 - 35.383

Oxygen (ml/l): 4.444 - 4.812

Phosphate (umol/l): 0.086 - 0.238

Silicate (umol/l): 0.810 - 3.817
 
Note: this information has not been validated. Check this *note*. Your feedback is most welcome.

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Trophic Strategy

Occurs inshore (Ref. 75154).
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Partner Web Site: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Diseases and Parasites

Uronema infection. Parasitic infestations (protozoa, worms, etc.)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Halichoeres biocellatus

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 6 barcode sequences available from BOLD and GenBank.

Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.

See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

CCTATATATAGTATTCGGAGCCTGAGCCGGGATGGTAGGCACAGCCCTAAGCTTGCTAATTCGAGCTGAATTAAGCCAGCCCGGCGCTCTCCTCGGAGACGACCAGATTTATAATGTAATCGTTACAGCCCACGCTTTCGTAATAATCTTCTTTATAGTAATACCAATCATGATTGGTGGCTTCGGAAACTGACTAATTCCACTAATGATTGGAGCCCCCGATATGGCCTTCCCTCGAATAAATAATATAAGCTTCTGATTACTTCCCCCCTCCTTCCTTCTCCTCCTCGCCTCATCGGGCGTAGAAGCAGGGGCAGGAACAGGCTGAACGGTTTACCCTCCTCTTGCAGGCAACTTAGCTCACGCCGGGGCTTCAGTAGACCTAACCATCTTCTCCCTTCATCTAGCAGGGATTTCATCAATCCTGGGTGCAATTAATTTTATTACAACAATTATTAATATGAAACCCCCTGCAATCTCCCAATATCAAACCCCCCTATTTGTTTGAGCCGTACTAATTACGGCAGTTCTTCTTCTCCTCTCCCTTCCCGTCCTAGCGGCCGGAATTACCATGCTATTAACAGACCGAAACCTAAATACTACTTTCTTCGACCCCGCTGGAGGAGGAGACCCCATTCTTTACCAACACCTA
-- end --

Download FASTA File

Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Halichoeres biocellatus

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 7
Specimens with Barcodes: 8
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Conservation

Conservation Status

IUCN Red List Assessment


Red List Category
LC
Least Concern

Red List Criteria

Version
3.1

Year Assessed
2010

Assessor/s
Cabanban, A., Pollard, D. & Choat, J.H.

Reviewer/s
Sadovy, Y. & Carpenter, K.E.

Contributor/s

Justification
This species is subjected to exploitation for the aquarium trade and the destruction of the coral reefs in part of its range (Indonesia and the Philippines). There have been declines in the southeast Asia part of the range, but globally the declines do not meet any of the thresholds for threatened categories. It is listed as Least Concern.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Population

Population
Estimates of population numbers are unknown. It is inferred from its exploitation in the aquarium trade and from the degradation of coral reefs in Southeast Asia (Burke et al. 2002) that there is probably a decline of the population in the south-east Asian part of the range. However, the range in Australia most likely acts as a refuge.

Population Trend
Decreasing
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Threats

Major Threats
This species is traded in the aquarium industry. It is not clear whether the aquarium trade has caused the low numbers of such popular coral reef fishes in the Indo-Pacific and the Caribbean due to lack of baseline data (Hodgson 1999).

It is also recorded as a rare minor component in the Guam subsistence and recreational fisheries records (R. Myers pers. comm. 2008).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Least Concern (LC)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Management

Conservation Actions

Conservation Actions
There are no specific conservation measures in place for this species. Its distribution overlaps several marine protected areas within its range.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Relevance to Humans and Ecosystems

Benefits

Importance

aquarium: commercial
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Wikipedia

Halichoeres biocellatus

The red-lined wrasse, two-spotted wrasse or biocellated wrasse, Halichoeres biocellatus, is a species of wrasse native to shallow tropical waters in the western Pacific Ocean.

Description[edit]

The red-lined wrasse can grow to about 12 cm (4.7 in) in length. Mature males are silvery grey with narrow, longitudinal, red stripes and a dark mark on their caudal peduncles. Females have narrow orange stripes, continuous near the front, but intermittent near the back. Juveniles and females have two distinctive, dark-coloured spots outlined in white on their dorsal fins, one in the middle and one near the back. These may fade as the fish matures. The long, narrow dorsal fin has 9 spines and 12 soft rays. The anal fin has three spines and 11 or 12 soft rays.[2][3]

Distribution and habitat[edit]

The red-lined wrasse is found in the tropical western Pacific Ocean between 32°N and 24°S at depths down to 35 metres (115 ft). Its range includes Japan, Indonesia, the Philippines and Australia, where it is found around the northern coast from Western Australia to New South Wales.[2] It inhabits the seaward side of coral and rocky reefs, usually with sandy patches, and is also found on reef slopes and crests with rock, rubble, and seaweed.[3]

Ecology[edit]

Juvenile slender groupers (Anyperodon leucogrammicus) are aggressive mimics of red-lined wrasses.[4] In this form of mimicry, the grouper mimics the wrasse in colouring and behaviour so that a prey fish is tricked into approaching what it thinks is a harmless wrasse and can then be attacked.[5]

Status[edit]

The IUCN Red List of Threatened Species lists the red-lined wrasse to be of least concern.[1] Their rationale is that, although populations may be declining slowly in Southeast Asia where the fish is collected for the aquarium trade and where coral reefs are being degraded, this is counterbalanced by populations in Australia which are relatively stable. Also, some of the fish's range falls within marine conservation areas.[6] It is also resilient, having a short growth period before maturity with populations being capable of doubling within 15 months.[3]

References[edit]

  1. ^ a b Cabanban, A., Pollard, D. & Choat, J. H. (2010). "Halichoeres biocellatus". IUCN Red List of Threatened Species. Version 2011.2. International Union for Conservation of Nature. Retrieved 4 May 2012. 
  2. ^ a b Biocellate Wrasse, Halichoeres biocellatus (Schultz, 1960) Australian Museum. Retrieved 2012-04-18.
  3. ^ a b c Halichoeres biocellatus - Schultz, 1960 FishBase. Retrieved 2012-04-18.
  4. ^ Russel B. C.; Allen, G. R.; Lubbock, H. R. (1976). New cases of mimicry in marine fishes 180 (3). pp. 407–423. doi:10.1111/j.1469-7998.1976.tb04685.x. 
  5. ^ Aggressive mimicry The Gale Encyclopedia of Science. <retrieved 2012-04-18.
  6. ^ Halichoeres biocellatus IUCN Red List of Threatened Species. Retrieved 2012-04-18.
Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

Source: Wikipedia

Unreviewed

Article rating from 0 people

Default rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!