Articles on this page are available in 2 other languages: Spanish (1), Arabic (16) (learn more)

Overview

Comprehensive Description

Biology

An occasionally schooling species which feeds mainly on krill (euphausiids), and also on squids and small fishes. Juveniles are found between 20 and 35°S at surface temperatures ranging from 19 to 24°C. Its flesh is paler than that of most true tunas and is very oily, but the cooked meat has fine eating qualities. Mainly marketed fresh.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Distribution

Range Description

This species is found in the Southern Ocean and is circumglobal. One individual was taken in Los Angeles Harbor (Fitch and Craig 1964) and another from the North Pacific subarctic gyre (Schaefer and Childers 1999), both probably vagrants. This species has also been reported from Santo City, Sao Paulo, Brazil (A. Amorim pers. comm. 2010).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Southern Ocean: circumglobal. One individual taken in Los Angeles Harbor.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Southern circumglobal, including Mascarenes.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Physical Description

Morphology

Dorsal spines (total): 15 - 18; Dorsal soft rays (total): 12 - 13; Analspines: 0; Analsoft rays: 13 - 14; Vertebrae: 40
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Size

Maximum size: 1050 mm FL
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Max. size

105 cm FL (male/unsexed; (Ref. 5313)); max. published weight: 13.7 kg (Ref. 5313)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Diagnostic Description

Description

An occasionally schooling species which feeds mainly on krill (euphausids), and also on squids and small fishes. Juveniles are found between 20 and 35°S at surface temperatures ranging from 19 to 24°C. Its flesh is paler than that of most true tunas and is very oily, but the cooked meat has fine eating qualities. Marketed mostly fresh.
  • Anon. (1996). FishBase 96 [CD-ROM]. ICLARM: Los Baños, Philippines. 1 cd-rom pp.
Creative Commons Attribution 3.0 (CC BY 3.0)

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Interpelvic process small and bifid. Body naked ventrally behind the long anterior corselet. Dorsal half of body to lateral line covered with scales. Swim bladder absent. The back is bluish, turning to deep purple or almost black on the head; the belly is white, without stripes or spots; the pectoral and pelvic fins purple, their inner sides black.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Ecology

Habitat

Habitat and Ecology

Habitat and Ecology
This species is pelagic and oceanodromous. It is an occasionally schooling species which feeds mainly on krill (euphausiids), squids, copepods, and small fishes. Juveniles are found between 20 and 35°S at surface temperatures ranging from 19 to 24°C (Collette 2002).

Spawning is presumed to take place during the summer months (Oct–Dec) over a wide range of the temperate Indian and South Pacific oceans north of 31°S (Yatsu 1995, Collette 2010). Both sexes have a reported length at first maturity of 71.5 cm fork length (FL) in Tasmania (Wolfe and Webb 1975) but there are no other studies to support this.

Maximum Size is recorded as 105 cm FL. The all-tackle gamefish record is a 11.9 kg fish taken off Taiaroa Heads, Otago, New Zealand in 2001 (IGFA 2011).

Systems
  • Marine
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Environment

pelagic-oceanic; oceanodromous (Ref. 51243); marine
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Depth range based on 13 specimens in 1 taxon.
Water temperature and chemistry ranges based on 7 samples.

Environmental ranges
  Depth range (m): 15 - 478
  Temperature range (°C): 7.497 - 11.391
  Nitrate (umol/L): 12.069 - 20.683
  Salinity (PPS): 34.382 - 35.014
  Oxygen (ml/l): 4.984 - 6.465
  Phosphate (umol/l): 0.783 - 1.294
  Silicate (umol/l): 3.886 - 7.218

Graphical representation

Depth range (m): 15 - 478

Temperature range (°C): 7.497 - 11.391

Nitrate (umol/L): 12.069 - 20.683

Salinity (PPS): 34.382 - 35.014

Oxygen (ml/l): 4.984 - 6.465

Phosphate (umol/l): 0.783 - 1.294

Silicate (umol/l): 3.886 - 7.218
 
Note: this information has not been validated. Check this *note*. Your feedback is most welcome.

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Migration

Oceanodromous. Migrating within oceans typically between spawning and different feeding areas, as tunas do. Migrations should be cyclical and predictable and cover more than 100 km.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Trophic Strategy

Juveniles are principally encountered between 20 and 35°S at surface temperatures ranging from 19 to 24°C. With increasing size they gradually move into higher latitudes where water temperatures are lower.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Allothunnus fallai

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 7 barcode sequences available from BOLD and GenBank.  Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

CCTTTATCTAGTATTTGGTGCATGAGCTGGAATAGTTGGCACAGCCCTAAGCTTGCTTATCCGAGCTGAACTAAGCCAACCAGGTGCCCTTCTTGGGGACGACCAGATCTACAATGTAATCGTTACGGCCCATGCGTTCGTAATGATTTTCTTTATAGTAATACCAATTATGATTGGAGGATTCGGAAACTGACTCATCCCTCTAATGATCGGAGCTCCAGACATAGCATTCCCCCGAATAAACAACATGAGCTTTTGACTCCTTCCTCCATCTTTCCTTCTTCTCCTAGCTTCTTCTGGAGTTGAGGCTGGTGCCGGAACTGGTTGAACAGTCTACCCTCCCCTTGCCGGTAACCTAGCCCACGCTGGAGCATCCGTTGACTTAACTATTTTCTCCCTACACTTAGCAGGTGTTTCCTCAATTCTTGGGGCAATCAACTTCATCACCACAATTATTAACATGAAACCCGCGGCTATTTCCCAATATCAGACACCCCTATTTGTATGGGCCGTCCTTATTACAGCCGTCCTTCTTCTACTATCACTACCAGTCCTTGCCGCTGGCATTACAATGCTCCTAACAGACCGAAACCTAAATACAACCTTTTTCGACCCTGCAGGCGGAGGAGATCCAATTCTTTACCAACACCTANNN
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Statistics of barcoding coverage: Allothunnus fallai

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 7
Specimens with Barcodes: 7
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Conservation

Conservation Status

IUCN Red List Assessment


Red List Category
LC
Least Concern

Red List Criteria

Version
3.1

Year Assessed
2011

Assessor/s
Collette, B., Amorim, A.F., Boustany, A., Carpenter, K.E., de Oliveira Leite Jr., N., Di Natale, A., Fox, W., Fredou, F.L., Graves, J., Viera Hazin, F.H., Juan Jorda, M., Minte Vera, C., Miyabe, N., Nelson, R., Oxenford, H., Sun, C., Teixeira Lessa, R.P., Pires Ferreira Travassos, P.E. & Uozumi, Y.

Reviewer/s
Russell, B. & Polidoro, B.

Contributor/s

Justification
This species is widespread and locally abundant in the Southern Ocean. It is taken as bycatch in long-line fisheries for Southern Bluefin Tuna. The impact of incidental take is not known, but it is not considered a major threat at this time. It is listed as Least Concern. More information is needed on this species' biology and population trends.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Population

Population
There is no special fishery for this species but it is incidentally caught, largely by the Southern Bluefin Tuna fishery (Collette and Nauen 1983). Reported catches worldwide are only 15 t in 2002, 6 t in 2003, 11 t in 2004, and 6 t in 2006 (FAO 2009). However, the major fishing nations for Southern Bluefin Tuna do not report bycatch landings for this species. In the southwest Atlantic, small catches have been reported from the Falkland Islands. This species was reported to be locally abundant in the Southern Ocean (Yatsu 1995).

Population Trend
Stable
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Threats

Major Threats
This is a minor commercial species that is taken incidentally by tuna longliners fishing for southern Bluefin Tuna and by purse seiners, buy this is not considered a major threat at presen (B. Collette pers. comm. 2010).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Least Concern (LC)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Management

Conservation Actions

Conservation Actions
There are no species specific conservation measures in place. More information is needed on this species biology and population trends.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Relevance to Humans and Ecosystems

Benefits

Importance

fisheries: minor commercial; price category: very high; price reliability: very questionable: based on ex-vessel price for species in this family
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Wikipedia

Slender tuna

The slender tuna, Allothunnus fallai, is a species of tuna, the only species in the genus Allothunnus, found around the world in the southern oceans between latitudes 20° and 50° South. Its length is up to one metre (3.3 feet).

References[edit]

Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

Source: Wikipedia

Unreviewed

Article rating from 0 people

Average rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!