Articles on this page are available in 1 other language: Chinese (Simplified) (4) (learn more)

Overview

Comprehensive Description

Biology

Meso- (Ref. 58302) and bathypelagic (Ref. 58302, 75154). Males dwarfed, non-parasitic (Ref. 4491).
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Data on Catalog of Fishes

View data on Catalog of Fishes here.

Creative Commons Attribution 3.0 (CC BY 3.0)

© Kenaley, Christopher

Source: Deep-sea Fishes of the World

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Type locality

CHALLENGER station 106, Central Atlantic, between St. Vincent and St. Paul‚Äôs Rocks, 1°47'N, 24°26'W, 0–3386 m, 25 August 1873.

Creative Commons Attribution 3.0 (CC BY 3.0)

© Kenaley, Christopher

Source: Deep-sea Fishes of the World

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Type specimen(s)

Lectotype of Melanocetus murrayi: BMNH 1887.12.7.17, female, 71 mm.

Creative Commons Attribution 3.0 (CC BY 3.0)

© Kenaley, Christopher

Source: Deep-sea Fishes of the World

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Main Reference

Pietsch TW. 2009. Oceanic Anglerfishes: Extraordinary Diversity in the Deep Sea. Berkley: University of California Press. 638 p.

Creative Commons Attribution 3.0 (CC BY 3.0)

© Kenaley, Christopher

Source: Deep-sea Fishes of the World

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Description

Escal bulb rounded, not compressed, bearing a low, rounded distal prolongation usually unpigmented on tip; posterior and anterior escal crests minute or absent; integument thin (cross sections measure 0.48 mm in thickness), easily torn, pigment readily lost during fixation and preservation, often transparent, especially in gill region and over branchiostegal rays; vomerine teeth 0–10; dorsal-fin rays 12–14; anal-fin rays 4 (very rarely 3 or 5); pectoral rays 15–19 (rarely 20).

Creative Commons Attribution 3.0 (CC BY 3.0)

© Kenaley, Christopher

Source: Deep-sea Fishes of the World

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Distribution

tropical to temperate parts of all oceans, as far north as off Grand Bank
  • North-West Atlantic Ocean species (NWARMS)
Creative Commons Attribution 3.0 (CC BY 3.0)

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Tropical to temperate parts of all oceans.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Melanocetus murrayi has a wide horizontal distribution in the Atlantic and Pacific oceans between approximately 62°N and 35°S, but is apparently absent from the Indian Ocean. Compared with M. johnsonii, it is a much deeper living form: only 10% of the material (for which data was available) was captured in open nets fished at maximum depths of less than 1000 m. Approximately 58% of the material was taken by gear fished at maximum depths of 1500 m or below, and 45% by gear fished at 2000 m or below. The relatively thin integument of M. murrayi (less than one-third the thickness of that of its congeners) as well as a lighter, less well-ossified skeleton apparently reflects the poorer trophic economies of these greater depths.

Creative Commons Attribution 3.0 (CC BY 3.0)

© Kenaley, Christopher

Source: Deep-sea Fishes of the World

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Atlantic; Pacific, including Hawaiian Islands.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Physical Description

Morphology

The body of metamorphosed females is short and deep, globular, the depth 60–75% SL (but often appearing highly compressed due apparently to deformation following capture). The head is short, the mouth large, its opening oblique to nearly vertical and the cleft not extending past the eye. The jaws are equal anteriorly. The oral valves are only weakly developed. There are two nostrils on each side of the snout, situated on the distal surface of a rounded papilla. The eye is small and subcutaneous, appearing through a circular translucent area of the integument, within a shallow orbital pit formed between the sphenotic and frontal bones. The teeth are slender, recurved, and depressible, some slightly hooked distally, those in the lower jaw less numerous (except in some small specimens, less than approximately 20 mm) but slightly longer than those in the upper jaw. There are 29–178 teeth in upper jaw and 32–142 in lower jaw. The longest tooth in the lower jaw measures 6.9–25.0% SL. There are 0–12 vomerine teeth. The first epibranchial and the proximal one-half of the first ceratobranchial are bound to the wall of the pharynx by connective tissue. All four epibranchials are closely bound together. The fourth epibranchial and ceratobranchial are bound to the wall of the pharynx, leaving no opening behind the fourth arch. The proximal one-half of the first ceratobranchial is bound to the wall of the pharynx, while the distal half is free, not bound by connective tissue to the adjacent second ceratobranchial. The proximal one-quarter to one-half of ceratobranchials II–IV are not bound together by connective tissue. Gill filaments are absent on the epibranchials, but present on the proximal tip of ceratobranchial I and the full length of ceratobranchials II–IV. A pseudobranch is absent. The length of illicium is 23.1–60.8% SL. The anterior-most tip of the pterygiophore of the illicium is exposed, emerging on the snout between the eyes, the posterior end concealed under the skin. The escal bulb is simple, usually with a rounded or conical distal prolongation, and often with posterior and anterior crests. Elongate cylindrical escal appendages and filaments are absent. The neuromasts of the acoustico-lateralis system are located at the tips of low cutaneous papillae, the pattern of placement as described for other ceratioids.

Creative Commons Attribution 3.0 (CC BY 3.0)

© Kenaley, Christopher

Source: Deep-sea Fishes of the World

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Size

Maximum size: 20 mm ---
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Max. size

2.0 cm TL (male/unsexed; (Ref. 4491)); 12 cm TL (female)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Known from over 300 metamorphosed females (13.5–124 mm), four metamorphosed males (15–20 mm), and 77 larvae (2.5–13 mm TL).

Creative Commons Attribution 3.0 (CC BY 3.0)

© Kenaley, Christopher

Source: Deep-sea Fishes of the World

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Diagnostic Description

Metamorphosed females of Melanocetus murrayi differ from those of all other described species of the genus in having the anterior margin of the vomer deeply concave; least outside width between frontals 9.1–17.8% SL; number of teeth in upper jaw 34–178, in lower jaw 46–142; length of longest tooth in lower jaw 7.7–16.7% SL; width of pectoral-fin lobe 6.1–8.9% SL; width of escal bulb 1.9–5.1% SL; length of illicium 23.1–37.2% SL; esca with crests minute or absent; skin with minute spinules restricted to caudal peduncle; integument relatively thin (0.48 mm).

Metamorphosed males of Melanocetus murrayi differ from those of all other described species of the genus in having upper denticular with 9–12 ventrally directed anterior teeth and a postero-medial series of 3–5 teeth; lower denticular with 10–13 teeth; posterior nostril contiguous to eye; olfactory lamellae 12–14; skin naked or with a few scattered dermal spinules.

Larvae of Melanocetus murrayi differ from those of all other described species of the genus in having a dorsal group of melanophores extending from anterior part of body musculature to or beyond posterior margin of base of dorsal fin (except in specimens less than 3 mm TL); caudal peduncle unpigmented in smaller specimens, peduncle reached by spreading dorsal pigment in larger specimens; branchial and branchiostegal pigmentation weak or absent; cephalic, sphenotic, preopercular, and pectoral pigment usually present.

Creative Commons Attribution 3.0 (CC BY 3.0)

© Kenaley, Christopher

Source: Deep-sea Fishes of the World

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Ecology

Habitat

nektonic
  • North-West Atlantic Ocean species (NWARMS)
Creative Commons Attribution 3.0 (CC BY 3.0)

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Environment

bathypelagic; marine; depth range 100 - 6370 m (Ref. 58302), usually 1000 - 2500 m (Ref. 58302)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Depth range based on 15 specimens in 1 taxon.
Water temperature and chemistry ranges based on 15 samples.

Environmental ranges
  Depth range (m): 19 - 3500
  Temperature range (°C): 2.459 - 22.540
  Nitrate (umol/L): 0.259 - 29.499
  Salinity (PPS): 34.919 - 36.586
  Oxygen (ml/l): 3.405 - 6.178
  Phosphate (umol/l): 0.042 - 1.863
  Silicate (umol/l): 0.921 - 38.676

Graphical representation

Depth range (m): 19 - 3500

Temperature range (°C): 2.459 - 22.540

Nitrate (umol/L): 0.259 - 29.499

Salinity (PPS): 34.919 - 36.586

Oxygen (ml/l): 3.405 - 6.178

Phosphate (umol/l): 0.042 - 1.863

Silicate (umol/l): 0.921 - 38.676
 
Note: this information has not been validated. Check this *note*. Your feedback is most welcome.

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Life History and Behavior

Reproduction

Until very recently, the only evidence of sexual parasitism in this family was an anomalous case of a 20-mm male Melanocetus johnsonii attached to the upper lip of a 168-mm female Centrophryne spinulosa (LACM 30843-1). However, the attachment did not involve fusion of male-female tissue and is therefore not considered to be a parasitic association. Two similar couplings in Melanocetus, but between sexes of the same taxon, have recently been discovered. One of these, a 23.5-mm male attached to a 75-mm female Melanocetus johnsonii (BMNH 2004.6.3.2-3), was collected in the eastern North Atlantic off Ireland in 1999 by the RRS Discovery in a cruise partially funded by the British Broadcasting Corporation for the celebrated “Blue Planet” video series. The second example is part of collections made by Hiromitsu Endo, aboard the R/V Tansei-Maru, west of Okinawa, in April 2002: a 15-mm male attached to a 73-mm female Melanocetus murrayi (BSKU 57842). Both males are only loosely attached, with tissue of the female pinched by the tightly closed denticular jaws of the male, the BMNH example hanging from the middle of the belly of the female, the BSKU specimen attached to the right side of the head of the female, just beneath the sphenotic bone. In both cases, it does not appear that any fusion of male and female tissue has taken place. Either the connections of the two were so recent that the tissues did not have time to fuse, or, more likely, these are the first and only known examples of a non-parasitic coupling—male ceratioids caught in the act of temporary attachment.

Creative Commons Attribution 3.0 (CC BY 3.0)

© Kenaley, Christopher

Source: Deep-sea Fishes of the World

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Melanocetus murrayi

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 2 barcode sequences available from BOLD and GenBank.  Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

ACACGTTGATTTTTCTCGACCAATCACAAAGATATCGGCACCCTATACCTAATTTTTGGTGCCTGAGCTGGGATAGTAGGCACAGCTTTAAGTTTACTTATCCGCGCCGAACTAAGTCAACCAGGCGCCCTTTTAGGGGAC---GACCAAATCTACAACGTAATTGTTACGGCACATGCCTTTGTAATAATTTTCTTTATGGTCATACCAATTATAATCGGAGGCTTCGGAAACTGACTAGTCCCTCTAATGATTGGGGCCCCAGACATAGCCTTTCCTCGAATAAACAACATAAGCTTCTGGCTACTTCCTCCATCTTTTCTCCTCCTCCTTGCCTCCTCCGGAGTAGAGTCGGGGGCAGGAACTGGATGAACAGTTTACCCCCCTCTGGCAGGCAACCTGGCCCATGCTGGAGCTTCTGTTGACCTCACAATTTTCTCCCTTCATCTGGCCGGGGTATCCTCAATTCTAGGGGCCATTAACTTTATCACAACAATTATCAATATGAAACCCCCAGCCATTTCTCAATACCAGACCCCCCTCTTCGTATGGTCCGTCTTGATCACCGCAGTCCTCCTTTTACTCTCCCTACCTGTCCTTGCTGCTGGTATCACGATACTCCTAACTGACCGGAATCTAAACACAACCTTCTTTGACCCCGCAGGAGGAGGTGACCCAATCCTTTACCAACACCTATTCTGATTCTTTGGACACCCCGAAGTATATATTCTCATTCTTCCAGGCTTTGGAATAATTTCACACATTGTTGCTTACTACTCAGGGAAAAAAGAGCCCTTTGGTTACATAGGCATGGTGTGAGCTATAATGGCCATCGGCCTACTAGGATTTATTGTTTGAGCTCACCACATATTCACAGTCGGCATGGACGTAGACACACGAG
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Statistics of barcoding coverage: Melanocetus murrayi

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 2
Specimens with Barcodes: 3
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Conservation

Threats

Not Evaluated
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!