Overview

Comprehensive Description

Biology

Lives with the alphaeid shrimp, Alpheus randalli, in burrows on coral reefs, with coarse sandy bottoms. Occurs in clear coastal to outer reefs on sand and rubble flats in depths of 20-35 meters (Ref. 48637).
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Distribution

Western Indian Ocean: Maldives southward to northern Natal, South Africa. Reported from the Andaman Sea (Ref. 9710).
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Indian Ocean: South Africa and Réunion (western Mascarenes) east to Andaman Sea.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Physical Description

Morphology

Dorsal spines (total): 7; Dorsal soft rays (total): 13; Analspines: 1; Analsoft rays: 14
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Size

Maximum size: 110 mm NG
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Max. size

11.0 cm TL (male/unsexed; (Ref. 30404))
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Diagnostic Description

3 pinkish bars on body; caudal fin with 3-9 red spots (Ref. 2798).
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Ecology

Habitat

Environment

reef-associated; marine; depth range 1 - 35 m (Ref. 9360), usually 5 - 10 m (Ref. 27115)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Depth range based on 2 specimens in 1 taxon.

Environmental ranges
  Depth range (m): 29 - 29
 
Note: this information has not been validated. Check this *note*. Your feedback is most welcome.

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Depth: 1 - 35m.
From 1 to 35 meters.

Habitat: reef-associated.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Statistics of barcoding coverage: Amblyeleotris aurora

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 2
Specimens with Barcodes: 2
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Barcode data: Amblyeleotris aurora

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There is 1 barcode sequence available from BOLD and GenBank.   Below is the sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen.  Other sequences that do not yet meet barcode criteria may also be available.

CCTCTACCTCGTGTTCGGTGCTTGAGCCGGAATAGTCGGCACAGCACTTAGCCTACTAATCCGGGCCGAACTCTCCCAACCCGGCGCCCTGCTGGGAGACGACCAAATCTACAACGTTATTGTAACCGCCCACGCATTTGTAATGATTTTCTTTATAGTAATACCAATTATGATTGGAGGATTTGGAAATTGACTAATTCCGCTCATGATCGGCGCTCCCGATATGGCTTTCCCCCGAATAAACAACATGAGCTTCTGGCTCCTGCCCCCTTCTTTCCTCCTACTCCTCGCCTCCTCTGGGGTTGAAGCCGGAGCTGGTACAGGGTGAACTGTTTACCCCCCACTTGCGGGCAACCTAGCACATGCAGGAGCTTCCGTCGACCTGACCATCTTCTCTCTCCACCTGGCTGGTATTTCATCAATTCTTGGGGCAATCAACTTCATCACTACCATCCTAAACATGAAACCCCCTGCCATTTCACAATACCAAACGCCCCTCTTCGTCTGAGCAGTACTAATTACAGCTGTCCTTCTTCTCCTTTCCCTGCCCGTCCTTGCTGCCGGCATCACAATGCTTCTAACGGACCGAAACCTCAACACAACTTTCTTCGACCCTGCAGGAGGAGGAGACCCCATCCTTTATCAACACCTG
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Conservation

Threats

Not Evaluated
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Relevance to Humans and Ecosystems

Benefits

Importance

aquarium: commercial
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Wikipedia

Pinkbar goby

Amblyeleotris aurora, Pinkbar goby, is a species of goby native to reefs of the western Indian Ocean at depths of from 5 to 40 metres (16 to 130 ft) though usually not deeper than 10 metres (33 ft). It is commensal with the shrimp Alpheus randalli. This species can reach a length of 11 centimetres (4.3 in) TL. It can also be found in the aquarium trade.[1]

References[edit]

  1. ^ Froese, Rainer and Pauly, Daniel, eds. (2013). "Amblyeleotris aurora" in FishBase. April 2013 version.
Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

Source: Wikipedia

Unreviewed

Article rating from 0 people

Average rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!