Overview

Comprehensive Description

Biology

Lives with the alphaeid shrimp, Alpheus randalli, in burrows on coral reefs, with coarse sandy bottoms. Occurs in clear coastal to outer reefs on sand and rubble flats in depths of 20-35 meters (Ref. 48637).
  • Hoese, D.F. 1986 Gobiidae. p. 774-807. In M.M. Smith and P.C. Heemstra (eds.) Smiths' sea fishes. Springer-Verlag, Berlin. (Ref. 2798)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Distribution

Western Indian Ocean: Maldives southward to northern Natal, South Africa. Reported from the Andaman Sea (Ref. 9710).
  • Hoese, D.F. 1986 Gobiidae. p. 774-807. In M.M. Smith and P.C. Heemstra (eds.) Smiths' sea fishes. Springer-Verlag, Berlin. (Ref. 2798)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Indian Ocean: South Africa and Réunion (western Mascarenes) east to Andaman Sea.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Physical Description

Morphology

Dorsal spines (total): 7; Dorsal soft rays (total): 13; Analspines: 1; Analsoft rays: 14
  • Hoese, D.F. 1986 Gobiidae. p. 774-807. In M.M. Smith and P.C. Heemstra (eds.) Smiths' sea fishes. Springer-Verlag, Berlin. (Ref. 2798)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Size

Maximum size: 110 mm NG
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Max. size

11.0 cm TL (male/unsexed; (Ref. 30404))
  • Kuiter, R.H. 1998 Photo guide to fishes of the Maldives. Atoll Editions, Victoria, Australia. 257 p. (Ref. 30404)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Diagnostic Description

Characterized by whitish body color with five, wide brown bands with diffuse margins; rear corner of mouth with oblique brown band; yellow caudal fin with ocellated red spots/streaks; divided pelvic fins except very low membrane across basal part of fins; gill opening extending forward to about one-third distance from upper rear edge of preopercle to posterior margin of eye; longitudinal scale series 66-92; greatest depth of body 5.7-6.9 in SL (Ref 90102).
  • Hoese, D.F. 1986 Gobiidae. p. 774-807. In M.M. Smith and P.C. Heemstra (eds.) Smiths' sea fishes. Springer-Verlag, Berlin. (Ref. 2798)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Ecology

Habitat

Environment

reef-associated; marine; depth range 5 - 40 m (Ref. 90102), usually 5 - 10 m (Ref. 27115)
  • Allen, G.R. and M.V. Erdmann 2012 Reef fishes of the East Indies. Perth, Australia: Universitiy of Hawai'i Press, Volumes I-III. Tropical Reef Research. (Ref. 90102)
  • Baensch, H.A. and H. Debelius 1997 Meerwasser atlas. Mergus Verlag GmbH, Postfach 86, 49302, Melle, Germany. 1216 p. 3rd edition. (Ref. 27115)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Depth range based on 2 specimens in 1 taxon.

Environmental ranges
  Depth range (m): 29 - 29
 
Note: this information has not been validated. Check this *note*. Your feedback is most welcome.

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Depth: 1 - 35m.
From 1 to 35 meters.

Habitat: reef-associated.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Amblyeleotris aurora

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There is 1 barcode sequence available from BOLD and GenBank.

Below is the sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.

See the BOLD taxonomy browser for more complete information about this specimen.

Other sequences that do not yet meet barcode criteria may also be available.

CCTCTACCTCGTGTTCGGTGCTTGAGCCGGAATAGTCGGCACAGCACTTAGCCTACTAATCCGGGCCGAACTCTCCCAACCCGGCGCCCTGCTGGGAGACGACCAAATCTACAACGTTATTGTAACCGCCCACGCATTTGTAATGATTTTCTTTATAGTAATACCAATTATGATTGGAGGATTTGGAAATTGACTAATTCCGCTCATGATCGGCGCTCCCGATATGGCTTTCCCCCGAATAAACAACATGAGCTTCTGGCTCCTGCCCCCTTCTTTCCTCCTACTCCTCGCCTCCTCTGGGGTTGAAGCCGGAGCTGGTACAGGGTGAACTGTTTACCCCCCACTTGCGGGCAACCTAGCACATGCAGGAGCTTCCGTCGACCTGACCATCTTCTCTCTCCACCTGGCTGGTATTTCATCAATTCTTGGGGCAATCAACTTCATCACTACCATCCTAAACATGAAACCCCCTGCCATTTCACAATACCAAACGCCCCTCTTCGTCTGAGCAGTACTAATTACAGCTGTCCTTCTTCTCCTTTCCCTGCCCGTCCTTGCTGCCGGCATCACAATGCTTCTAACGGACCGAAACCTCAACACAACTTTCTTCGACCCTGCAGGAGGAGGAGACCCCATCCTTTATCAACACCTG
-- end --

Download FASTA File

Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Amblyeleotris aurora

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 2
Specimens with Barcodes: 2
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Conservation

Threats

Not Evaluated
  • IUCN 2006 2006 IUCN red list of threatened species. www.iucnredlist.org. Downloaded July 2006.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Relevance to Humans and Ecosystems

Benefits

Importance

aquarium: commercial
  • Burgess, W.E., H.R. Axelrod and R.E. Hunziker III 1990 Dr. Burgess's atlas of marine aquarium fishes. T.F.H. Publications, Inc., Neptune City, New Jersey. 768 p.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Wikipedia

Pinkbar goby

Amblyeleotris aurora, Pinkbar goby, is a species of goby native to reefs of the western Indian Ocean at depths of from 5 to 40 metres (16 to 130 ft) though usually not deeper than 10 metres (33 ft). It is commensal with the shrimp Alpheus randalli. This species can reach a length of 11 centimetres (4.3 in) TL. It can also be found in the aquarium trade.[1]

References[edit]

  1. ^ Froese, Rainer and Pauly, Daniel, eds. (2013). "Amblyeleotris aurora" in FishBase. April 2013 version.
Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

Source: Wikipedia

Unreviewed

Article rating from 0 people

Default rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!