Articles on this page are available in 1 other language: Chinese (Simplified) (4) (learn more)

Overview

Comprehensive Description

Biology

Adults inhabit lagoon and seaward reefs at depths of 1 to over 30 m, and relatively common along shallow reef margins with good coral cover (Ref. 9710). Usually solitary (Ref. 5213). Feed mainly on shelled benthic invertebrates such as mollusks and crustaceans, but occasionally take fishes (Ref. 1602). Oviparous, distinct pairing during breeding (Ref. 205). Difficult to approach (Ref. 9710). Juveniles secretive on algae reefs and usually around stinging hydrozoans (Ref. 48636).
  • Westneat, M.W. 2001 Labridae. Wrasses, hogfishes, razorfishes, corises, tuskfishes. p. 3381-3467. In K.E. Carpenter and V. Niem (eds.) FAO species identification guide for fishery purposes. The living marine resources of the Western Central Pacific. Vol. 6. Bony fishes part 4 (Labridae to Latimeriidae), estuarine crocodiles. FAO, Rome. (Ref. 9823)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Distribution

Range Description

Cheilinus trilobatus is broadly distributed in the Indo-Pacific, from East Africa to Tuamoto and from Japan to New Caledonia.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Indo-West Pacific: East Africa, South Africa, Madagascar and Mascarenes east to Wake Atoll and Gambier Islands, north to southern Japan, south to Western Australia, New Caledonia and Austral Islands.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Indo-Pacific: East Africa to the Tuamoto and Austral islands, north to the Ryukyu Islands, south to New Caledonia.
  • Myers, R.F. 1991 Micronesian reef fishes. Second Ed. Coral Graphics, Barrigada, Guam. 298 p. (Ref. 1602)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Physical Description

Morphology

Dorsal spines (total): 9; Dorsal soft rays (total): 10; Analspines: 3; Analsoft rays: 8
  • Myers, R.F. 1991 Micronesian reef fishes. Second Ed. Coral Graphics, Barrigada, Guam. 298 p. (Ref. 1602)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Size

Maximum size: 450 mm NG
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Max. size

45.0 cm TL (male/unsexed; (Ref. 9710))
  • Lieske, E. and R. Myers 1994 Collins Pocket Guide. Coral reef fishes. Indo-Pacific & Caribbean including the Red Sea. Haper Collins Publishers, 400 p. (Ref. 9710)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Diagnostic Description

Description

Occurs in lagoon and seaward reefs at depths of 1 to over 30 m, and relatively common along shallow reef margins (Ref. 1602). Usually solitary (Ref. 5213). Feeds mainly on shelled benthic invertebrates such as molluscs and crustaceans, but occasionally takes fishes (Ref. 1602).
  • Anon. (1996). FishBase 96 [CD-ROM]. ICLARM: Los Baños, Philippines. 1 cd-rom pp.
Creative Commons Attribution 3.0 (CC BY 3.0)

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Olivaceous with a vertical red line on each body scale; small red spots and irregular lines on head and chest; red lines radiating anteriorly from eye (Ref. 4392). Large adults of this species have trilobed caudal fins.
  • Myers, R.F. 1991 Micronesian reef fishes. Second Ed. Coral Graphics, Barrigada, Guam. 298 p. (Ref. 1602)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Ecology

Habitat

Habitat and Ecology

Habitat and Ecology
Juveniles of Cheilinus trilobatus are found on algae reefs and usually around stinging hydrozoans (Kuiter and Tonozuka 2001), while adults inhabit coral lagoon, coastal reef-flats, seaward reefs and along shallow reef margins with high coral cover (Lieske and Myers 1994; Allen 2000; Kuiter 2006). It is also occasionally observed in grassy areas at depths of 1–30 m (Carpenter and Niem 2001; Gell and Whittington 2002). Cheilinus trilobatus feeds on hard-shelled benthic invertebrates, including sea urchins, molluscs, crustaceans and occasionally small fishes (Myers 1991; Sadovy and Cornish 2000).



Systems
  • Marine
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Depth: 1 - 30m.
From 1 to 30 meters.

Habitat: reef-associated. Inhabits lagoon and seaward reefs at depths of 1 to over 30 m, and relatively common along shallow reef margins with good coral cover (Ref. 9710). Usually solitary (Ref. 5213). Feeds mainly on shelled benthic invertebrates such as molluscs and crustaceans, but occasionally takes fishes (Ref. 1602). Difficult to approach (Ref. 9710).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Environment

reef-associated; brackish; marine; depth range 1 - 30 m (Ref. 1602)
  • Myers, R.F. 1991 Micronesian reef fishes. Second Ed. Coral Graphics, Barrigada, Guam. 298 p. (Ref. 1602)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Depth range based on 97 specimens in 1 taxon.
Water temperature and chemistry ranges based on 65 samples.

Environmental ranges
  Depth range (m): 0.1 - 49
  Temperature range (°C): 24.091 - 29.336
  Nitrate (umol/L): 0.000 - 1.251
  Salinity (PPS): 30.220 - 37.566
  Oxygen (ml/l): 4.314 - 4.932
  Phosphate (umol/l): 0.087 - 0.339
  Silicate (umol/l): 1.073 - 8.403

Graphical representation

Depth range (m): 0.1 - 49

Temperature range (°C): 24.091 - 29.336

Nitrate (umol/L): 0.000 - 1.251

Salinity (PPS): 30.220 - 37.566

Oxygen (ml/l): 4.314 - 4.932

Phosphate (umol/l): 0.087 - 0.339

Silicate (umol/l): 1.073 - 8.403
 
Note: this information has not been validated. Check this *note*. Your feedback is most welcome.

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Trophic Strategy

Occurs inshore (Ref. 75154). Present in seagrass beds at all life stages (Ref. 41878).
  • Sano, M., M. Shimizu and Y. Nose 1984 Food habits of teleostean reef fishes in Okinawa Island, southern Japan. University of Tokyo Bulletin, no. 25. v,128p. University of Tokyo Press, Tokyo, Japan. 128 p. (Ref. 6110)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Partner Web Site: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Life History and Behavior

Behavior

Biomechanics of Feeding

Wrasses rule

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

Supplier: Mark Westneat

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Life Cycle

Oviparous, distinct pairing during breeding (Ref. 205).
  • Breder, C.M. and D.E. Rosen 1966 Modes of reproduction in fishes. T.F.H. Publications, Neptune City, New Jersey. 941 p. (Ref. 205)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Cheilinus trilobatus

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 11 barcode sequences available from BOLD and GenBank.

Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.

See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

CACCCTTTATCTCGTATTTGGTGCCTGAGCCGGAATAGTGGGTACTGCCCTTAGCTTACTCATCCGAGCGGAACTCAGTCAACCCGGTGCTCTACTCGGAGACGACCAGATCTATAATGTAATCGTAACAGCCCATGCTTTCGTTATGATTTTCTTTATAGTAATACCAATCATGATCGGGGGTTTCGGAAACTGACTAATCCCCCTTATGATTGGCGCCCCTGACATGGCCTTTCCTCGTATAAACAACATGAGCTTTTGACTTCTTCCTCCGTCCTTCCTCCTTCTCCTGGCATCCTCTGGCGTAGAAGCAGGGGCCGGCACAGGTTGAACAGTTTACCCCCCATTAGCCGGAAATTTAGCCCATGCAGGTGCATCAGTAGATTTAACAATCTTTTCCCTTCACCTCGCCGGGATCTCGTCAATTCTAGGGGCCATTAATTTCATTACAACTATCATTAACATGAAACCCCCAGCCATTACTCAGTATCAGACTCCCCTGTTCGTCTGAGCGGTTCTCATCACAGCCGTTCTTCTGTTACTATCCCTCCCTGTCCTCGCTGCAGGCATTACAATGCTTTTAACGGACCGCAACCTAAACACAACCTTCTTCGACCCAGCAGGAGGGGGAGACCCCATTCTTTACCAACACCTA
-- end --

Download FASTA File

Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Cheilinus trilobatus

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 8
Specimens with Barcodes: 27
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Genomic DNA is available from 9 specimens with morphological vouchers housed at Museum of Tropical Queensland
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© Ocean Genome Legacy

Source: Ocean Genome Resource

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Conservation

Conservation Status

IUCN Red List Assessment


Red List Category
LC
Least Concern

Red List Criteria

Version
3.1

Year Assessed
2010

Assessor/s
Allen, G.R., Kwok Ho, S., Min, L. & Sadovy, Y.J.

Reviewer/s
Collen, B., Richman, N., Beresford, A., Chenery, A. & Ram, M.

Contributor/s
De Silva, R., Milligan, H., Lutz, M., Batchelor, A., Jopling, B., Kemp, K., Lewis, S., Lintott, P., Sears, J., Wilson, P., Smith, J. & Livingston, F.

Justification
Cheilinus trilobatus has been assessed as Least Concern. This species is widespread and is common in many parts of its range. There are no major threats to this species.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Population

Population
Cheilinus trilobatus has been commonly observed on recent surveys throughout Indonesia, Papua New Guinea and the Solomon Islands (G. R. Allen pers. comm. 2009.). This is a common species throughout its range (G. R. Allen pers. comm. 2009).

Population Trend
Stable
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Threats

Major Threats
There are no major threats known for Cheilinus trilobatus. This species is caught in multi-species fisheries and marketed both alive and dead, and is occasionally collected for the aquarium trade. At present these are not considered major threats to the population of this species due to the small size of these fisheries.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Least Concern (LC)
  • IUCN 2006 2006 IUCN red list of threatened species. www.iucnredlist.org. Downloaded July 2006.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Management

Conservation Actions

Conservation Actions
There are no species-specific conservation measures for Cheilinus trilobatus. However, this species distribution includes a number of marine protected areas within its range. For example, Cheilinus trilobatus was recorded in 5 marine protected areas off Africa: Malindi, Watamu, Mombasa, Kisite and Chumbe Island (McClanahan 2000). More species-specific information on harvest and trade is needed for this species.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Relevance to Humans and Ecosystems

Benefits

Importance

fisheries: minor commercial; aquarium: commercial; price category: very high; price reliability: very questionable: based on ex-vessel price for species in this family
  • Burgess, W.E., H.R. Axelrod and R.E. Hunziker III 1990 Dr. Burgess's atlas of marine aquarium fishes. T.F.H. Publications, Inc., Neptune City, New Jersey. 768 p.
  • Gomon, M.F. and J.E. Randall 1984 Labridae. In W. Fischer and G. Bianchi (eds.) FAO species identification sheets for fishery purposes. Western Indian Ocean fishing area 51. Vol. 2. (Ref. 5374)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!