Articles on this page are available in 1 other language: Chinese (Simplified) (4) (learn more)

Overview

Comprehensive Description

Biology

Found in coral-rich areas of lagoon and seaward reefs at depths of 1 to over 40 m (Ref. 1602, 48636, 58534). A secretive species (Ref. 8631, 48636), rarely ventures more than a few centimeters from shelter (Ref. 1602). A shy species, usually found in pairs when adult (Ref. 48636). Oviparous, distinct pairing during breeding (Ref. 205).
  • Randall, J.E., G.R. Allen and R.C. Steene 1990 Fishes of the Great Barrier Reef and Coral Sea. University of Hawaii Press, Honolulu, Hawaii. 506 p. (Ref. 2334)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Distribution

Range Description

This species is widespread in the Indo-Pacific, it is found from East Africa to the Marquesas, Society islands and Tuamoto, north to Taiwan, south to the southern Great Barrier Reef and the Austral Islands.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Indo-Pacific: East Africa to the Marquesan and Society islands, north to Taiwan, south to the southern Great Barrier Reef and the Austral Islands.
  • Myers, R.F. 1991 Micronesian reef fishes. Second Ed. Coral Graphics, Barrigada, Guam. 298 p. (Ref. 1602)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Indo-West Pacific: East Africa, South Africa, Seychelles, Madagascar and Mascarenes east to Marquesas Islands and Gambier Islands, north to southern Japan, south to Western Australia, Queensland (Australia), New Caledonia and Austral Islands.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Physical Description

Morphology

Dorsal spines (total): 9 - 10; Dorsal soft rays (total): 9 - 10; Analspines: 3; Analsoft rays: 8
  • Myers, R.F. 1991 Micronesian reef fishes. Second Ed. Coral Graphics, Barrigada, Guam. 298 p. (Ref. 1602)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Size

Maximum size: 170 mm TL
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Max. size

17.0 cm TL (male/unsexed; (Ref. 30573))
  • Sommer, C., W. Schneider and J.-M. Poutiers 1996 FAO species identification field guide for fishery purposes. The living marine resources of Somalia. FAO, Rome. 376 p. (Ref. 30573)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Diagnostic Description

Description

Found in lagoon and seaward reefs at depths of 1 to over 40 m (Ref. 1602). A secretive species (Ref. 8631), rarely ventures more than a few centimeters from shelter (Ref. 1602).
  • Anon. (1996). FishBase 96 [CD-ROM]. ICLARM: Los Baños, Philippines. 1 cd-rom pp.
Creative Commons Attribution 3.0 (CC BY 3.0)

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Brownish red, mottled with small whitish spots; dark brown spot anteriorly on each side of upper lip; 2 dark lines diverging from the eye; dark brown spot on 1st 2 dorsal membranes (Ref. 4392). Deep-bodied for genus, and snout pointed (Ref. 48636).
  • Myers, R.F. 1991 Micronesian reef fishes. Second Ed. Coral Graphics, Barrigada, Guam. 298 p. (Ref. 1602)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Ecology

Habitat

Habitat and Ecology

Habitat and Ecology
A secretive species which inhabits coral-rich areas of lagoon and seaward reefs from 1 to over 40 m (Lieske and Myers 1994), and stays close to shelter (Allen 2000).

Pairing-up of adults are reported (Kuiter and Tonozuka 2001), except for this, not much is known on its reproductive biology or ecology.

The maximum body size is nornally between 14 and 17cm, but there is one record of 35 cm TL (Michel Kulbicki pers. comm. 2008).

Systems
  • Marine
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Environment

reef-associated; marine; depth range 1 - 40 m (Ref. 37816)
  • Myers, R.F. 1999 Micronesian reef fishes: a comprehensive guide to the coral reef fishes of Micronesia, 3rd revised and expanded edition. Coral Graphics, Barrigada, Guam. 330 p. (Ref. 37816)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Depth range based on 117 specimens in 1 taxon.
Water temperature and chemistry ranges based on 66 samples.

Environmental ranges
  Depth range (m): 0.5 - 150
  Temperature range (°C): 25.245 - 29.205
  Nitrate (umol/L): 0.027 - 0.895
  Salinity (PPS): 32.200 - 35.383
  Oxygen (ml/l): 4.279 - 4.747
  Phosphate (umol/l): 0.071 - 0.339
  Silicate (umol/l): 0.906 - 4.465

Graphical representation

Depth range (m): 0.5 - 150

Temperature range (°C): 25.245 - 29.205

Nitrate (umol/L): 0.027 - 0.895

Salinity (PPS): 32.200 - 35.383

Oxygen (ml/l): 4.279 - 4.747

Phosphate (umol/l): 0.071 - 0.339

Silicate (umol/l): 0.906 - 4.465
 
Note: this information has not been validated. Check this *note*. Your feedback is most welcome.

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Depth: 1 - 40m.
From 1 to 40 meters.

Habitat: reef-associated. Found in coral-rich areas of lagoon and seaward reefs at depths of 1 to over 40 m (Ref. 1602). A secretive species (Ref. 8631), rarely ventures more than a few centimeters from shelter (Ref. 1602).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Trophic Strategy

Occurs inshore (Ref. 75154).
  • Nguyen, N.T. and V.Q. Nguyen 2006 Biodiversity and living resources of the coral reef fishes in Vietnam marine waters. Science and Technology Publishing House, Hanoi. (Ref. 58534)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Partner Web Site: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Life History and Behavior

Life Cycle

Oviparous, distinct pairing during breeding (Ref. 205).
  • Breder, C.M. and D.E. Rosen 1966 Modes of reproduction in fishes. T.F.H. Publications, Neptune City, New Jersey. 941 p. (Ref. 205)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Cheilinus oxycephalus

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 13 barcode sequences available from BOLD and GenBank.

Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.

See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

CACCCTCTATCTTGTATTTGGTGCCTGAGCCGGAATAGTGGGTACTGCCCTTAGCTTACTCATCCGAGCGGAACTCAGTCAACCCGGTGCTCTACTCGGAGACGACCAGATCTATAATGTAATCGTAACAGCCCATGCTTTCGTTATGATTTTCTTTATAGTAATACCAATTATGATTGGGGGTTTCGGAAACTGACTAATCCCCCTTATGATTGGTGCCCCTGACATAGCCTTTCCTCGTATAAATAACATGAGCTTTTGACTCCTTCCTCCGTCCTTCCTCCTTCTCCTTGCATCCTCTGGCGTAGAAGCAGGGGCCGGCACAGGTTGAACAGTTTACCCCCCGCTAGCCGGAAATTTAGCCCATGCAGGTGCATCTGTAGATTTAACAATCTTCTCCCTCCACCTCGCCGGGATCTCATCAATTCTAGGGGCCATTAATTTCATTACAACTATCATTAACATGAAACCCCCAGCCATCACTCAATATCAAACCCCCTTGTTCGTCTGAGCAGTCCTCATCACAGCCGTTCTTCTGTTACTATCCCTCCCTGTCCTCGCTGCAGGCATCACAATGCTTTTAACAGACCGTAACCTGAACACAACCTTCTTCGACCCGGCAGGAGGGGGAGACCCCATTCTTTACCAACACCTA
-- end --

Download FASTA File

Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Cheilinus oxycephalus

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 9
Specimens with Barcodes: 17
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Conservation

Conservation Status

IUCN Red List Assessment


Red List Category
LC
Least Concern

Red List Criteria

Version
3.1

Year Assessed
2010

Assessor/s
To, A., Liu, M. & Sadovy, Y.

Reviewer/s
Craig, M.T. & Carpenter, K.E.

Contributor/s

Justification
This species is widespread and is common in many parts of its range. There are no major threats to this species. It is listed as Least Concern.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Population

Population
This species is common in at least some parts of its range.

In Fiji, a total of 15 individuals were counted in various UVC surveys with body sizes of 6-12 cm TL (M. Kulbicki pers. comm. 2008).

In New Caledonia, a total of 153 individuals were counted in various UVC surveys with body sizes of 6-35 cm TL. In nine stations, a total of 32 individuals were caught with total body weight of 428 g (M. Kulbicki pers. comm. 2008).

In French Polynesia, a total of 185 individuals were counted in various UVC surveys with body sizes of 4-20 cm TL (M. Kulbicki pers. comm. 2008).

Population Trend
Unknown
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Threats

Major Threats
There are no major threats known for this species. This species is occasionally caught in the aquarium trade, but given its small size it is not often targeted for food.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Least Concern (LC)
  • IUCN 2006 2006 IUCN red list of threatened species. www.iucnredlist.org. Downloaded July 2006.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Management

Conservation Actions

Conservation Actions
There are no species-specific conservation measures for this species. However, this species distribution includes a number of Marine Protected Areas within its range.


Country-specific
Tanzania
There is no specific fishery management on this species. There are several marine parks and reserves in Tanzania Mainland and Zanzibar (Francis et al. 2002, Wells et al. 2007). Marine parks are zoned for different purposes including no-take core zone and no fishing is allowed within the marine reserve unless authorized by Government department (Francis et al. 2002). Studies reported higher abundance and species richness of commercially important fishes in some of the studied protected areas in the region (McClanahan and Arthus 2001). The build-up of these large species may reduce the abundance of small wrasses such as C. oxycephalus (McClanahan et al. 1999). Nonetheless, these protected areas may offer protection to C. oxycephalus, however its occurrence within these areas needs further investigation.

Mozambique
There is no known fishery management or regulations on this species in Mozambique. There is a 22 km2 marine reserve, two national parks and one wildlife sanctuary where coastal waters are protected (Francis et al. 2002, Wells et al. 2007). A fish survey in 2000 at various locations including marine protected areas did not record this species (Motta et al. 2002). The occurrence of this species within these areas needs further investigation.

Madagascar
This species was reported from the Natural Reserve of the Glorieuses Islands (Durville et al. 2003). Labrids are not major catches in the reef fishes surrounding the south-west Madagascar in 1997 (Laroche et al. 1997), and catch-per-unit-effort is still relatively high in these fishing grounds. There are two marine protected areas, with no-take zones, located in the northwest region of Madagascar (McKenna and Allen 2005). The occurrence of this species within these areas needs further investigation. Fishery management or regulations are lacking.

Seychelles
Several marine protected areas are established in Seychelles, which covers over 220 km2, however enforcement and regulations within them are suggested to be very weak (Francis et al. 2002). Occurrence of C. oxycephalus within these areas is unknown. Fisheries operating in Seychelles, both artisanal and semi-industrial fisheries, are regulated by licensing system and mesh-size limit, and compliance to these regulations is maintained through regular patrols (Seychelles Fishing Authority 2008).

Comoros
One marine protected area is found in Comoros (Francis et al. 2002), within which no-take areas are set up (Granek and Brown 2005). Co-management between government and local villages is adopted to regulate fisheries within the area. (Granek and Brown 2005). The occurrence of this species within the marine protected areas needs further investigation. Fishery management and regulation are not known.

Kenya
Fishery management and regulation are not known. Several marine protected areas are established and fishing activities are regulated (Francis et al. 2002). Studies reported higher abundance and species richness of commercially important fishes in some of the studied protected areas in the region (McClanahan and Arthus 2001, McClanahan et al. 2007). However, the occurrence of this species within the marine protected areas needs further investigation.

South Africa
About 20 marine protected areas are established which encompass various habitat types and offer various level of protection to fish through zoning (e.g. no-take zone, controlled fishing zone) (Department of Environmental Affairs and Tourism 2008, SouthAfrica.info 2008). These protected areas represent about 18% of coastline in South Africa (WWF 2004). Although C. oxycephalus has not been reported from recent ichthyofaunal surveys in some of these marine protected areas (Wood et al. 2000, Mann et al. 2006), the relatively large area of coastline and the representation of various habitat types within this marine protected area network is likely to encompasses locations utilized by C. oxycephalus in South Africa.

Western Pacific Islands
There is no known fishery management on this species in Fiji, Tonga or Samoa. One and nine marine protected areas are established in Fiji and Tonga respectively (WWF 2006, Secretariat of the Convention on Biological Diversity 2007a). While in Samoa, two marine protected areas, covering 140 and 100 km2, are established and are co-managed between villagers and the government (Secretariat of the Convention on Biological Diversity 2007b, Conservation International 2008). The distribution of C. oxycephalus among Western Pacific Islands implies that the newly established Phoenix Island Protected Area in Kiribati, which is currently the largest marine protected area in the world, may provide protection to this species (Phoenix Island Protected Area 2007). However, occurrence data of this species within these marine protected areas are lacking.

Palau
There are seasonal ban, gear restriction on fishing and a licensing system for aquarium fish collection, but there is no specific management on this species (Secretariat of the Pacific Community and Bureau of Marine Resources 2007). Several marine protected areas are in place but the occurrence of this species within these areas is unknown (Golbuu 2005).

Papua New Guinea
There is no information on fishery management. The Kimbe Bay marine protected area may provide protection to this species (The Nature Conservancy 2008) but further investigation is needed.

Australia
Western Australia
Several marine parks and reserves, which have various level of fishing or no fishing, are established within Western Australia (Department of Environment and Conservation 2008). However the occurrence of C. oxycephalus within these marine parks and reserves is unknown.
For fishery management, a bag limit of two labrids applies to recreational fishery in Pilbara/Kimberley region (Department of Fisheries 2008). However there is no specific management for the commercial fishery.

Northern Territory
There is no specific management measure or regulation on this species in either commercial or recreational fishery. Marine parks are in place (Northern Territory Government 2007). However the occurrence of C. oxycephalus within these marine parks and reserves is unknown.

Queensland
Marine parks are established within Queensland including the well-know Great Barrier Reef. Marine parks are zoned for different purposes and offer different levels of protection from recreational and commercial fishing activities (Environmental Protection Agency 2008). For fishery management, a minimum size of 250 mm TL and a bag limit of 5 fish apply to all wrasses (Department of Primary Industries and Fisheries 2008a). There are three, nine-day closure to the taking of all coral reef fishes in Queensland east coast waters, which are in October, November and December each year around the new moon phase (Department of Primary Industries and Fisheries 2008b). There is no specific management measure or regulation on this species in commercial food fish fishery.

This species is collected as part of the international aquarium fish trade in Queensland. Both recreational and licensed commercial aquarium fish collectors are allowed to operate within certain zones in the Great Barrier Reef (Ryan and Clarke 2005). While SCUBA and hookah are allowed for commercial collectors, recreational collectors can only use mask and snorkel for collecting aquarium fish. There are also gear restrictions (only by hands, small fishing lines or seine-nets) and bag limits (20 fish per person) on aquarium fish collection for both recreational and commercial collectors (Ryan and Clarke 2005). There is no specific management or regulation on C. oxycephalus.

New Caledonia
Marine reserves are established within the natural range of C. oxycephalus (Wantiez et al. 1997) These reserves cover reef habitat which are suitable to C. oxycephalus (Lieske and Myers 1994). Though this species has not been recorded within these reserves, it is very likely that these no-take areas can provide protection to this C. oxycephalus. Regulation on either commercial or recreational fishing is lacking.

Maldives
There are management measures for shark and tuna fisheries, also a licensing system within some areas, however management measure is lacking for many other reef fisheries except for the export bans on rare species (Adam 2006). Marine protected areas are established, fishing is prohibited except for the traditional live bait fishing (Ministry of Hone Affairs, Housing and Environment 2003).

Mainland China
There is very limited information about the fisheries in Mainland China. There are seasonal protected area, mesh size limit in some fisheries, however enforcement is suggested to be weak (Chen 1999).

Japan
There is no fishery management or regulations on this species in Japan. About 60 marine parks (with no-fishing areas and buffer zones) are established in Japan (UNEP-WCMC 2008) but occurrence data of this species within these areas need further investigation.

Taiwan
There is no fishery management or regulations on this species in Taiwan. C. oxycephalus occurs within the Kenting National Park (Shao 2005). Its recorded occurrence in Tung Sha Tao (Pratas Island), which is now a protected area, offer protection to this species (Chen et al. 1995).

Philippines
There is no fishery management or regulation specific for the fin-fish fishery. There are over 400 marine protected areas, within which no-take zone, regulated fishing zones are established (Haribon Foundation 2002). And these areas may allow the build-up of reef fishes (Russ and Alcala 1998). This species may occur within these areas but further investigation is needed.

Vietnam
Fishermen have to be licensed and there are certain gear size and type restrictions, and seasonal closures but no specific fishery management for reef fisheries, however enforcement of these regulations are suggested to be weak (Flewwelling and Hosch 2007a). There are marine protected areas in Vietnam but information on enforcement is not available.

India
Fishery management seems lacking. There are about 30 marine protected areas in India encompassing various habitat types, however details of the enforcement and occurrence of species is lacking (Singh 2003)

Indonesia
There are licensing system, gear type restrictions, limited entry and total allowable catches for artisanal and coastal fisheries (Flewwelling and Hosch 2007b). Commercial fisheries such as the purse seine fisheries are not formally managed (Flewwelling and Hosch 2007b). There are marine protected areas in Indonesia but the occurrence of this species within these areas needs further investigation.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Relevance to Humans and Ecosystems

Benefits

Importance

fisheries: minor commercial; price category: very high; price reliability: very questionable: based on ex-vessel price for species in this family
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!