Overview
Comprehensive Description
Biology
High-oceanic, found between 475-1000 m during the day; nyctoepipelagic at surface and down to 250 m ( maximum abundance at 100 m) (Ref. 4479).
-
Hulley, P.A. 1990 Myctophidae. p. 398-467. In J.C. Quero, J.C. Hureau, C. Karrer, A. Post and L. Saldanha (eds.) Check-list of the fishes of the eastern tropical Atlantic (CLOFETA). JNICT, Lisbon; SEI; Paris; and UNESCO, Paris. Vol. 1. (Ref. 4479)
http://www.fishbase.org/references/FBRefSummary.php?id=4479&speccode=21
Trusted
Distribution
Atlantic Ocean: south of about 40°N to 30°S in the western Atlantic and to about 22°S in eastern Atlantic.
-
Hulley, P.A. 1990 Myctophidae. p. 398-467. In J.C. Quero, J.C. Hureau, C. Karrer, A. Post and L. Saldanha (eds.) Check-list of the fishes of the eastern tropical Atlantic (CLOFETA). JNICT, Lisbon; SEI; Paris; and UNESCO, Paris. Vol. 1. (Ref. 4479)
http://www.fishbase.org/references/FBRefSummary.php?id=4479&speccode=21
Trusted
Atlantic: south of about 40° N to 30°S in the western Atlantic
-
North-West Atlantic Ocean species (NWARMS)
http://www.marinespecies.org/aphia.php?p=sourcedetails&id=2901
Trusted
Azores Exclusive Economic Zone, European waters (ERMS scope), Gulf of Maine, Gulf of Mexico, North West Atlantic
-
North-West Atlantic Ocean species (NWARMS)
http://www.marinespecies.org/aphia.php?p=sourcedetails&id=2901
-
Felder, D.L. and D.K. Camp (eds.), Gulf of Mexico–Origins, Waters, and Biota. Biodiversity. Texas A&M Press, College Station, Texas.
http://www.marinespecies.org/porifera/porifera.php?p=sourcedetails&id=145245
-
van der Land, J.; Costello, M.J.; Zavodnik, D.; Santos, R.S.; Porteiro, F.M.; Bailly, N.; Eschmeyer, W.N.; Froese, R. (2001). Pisces, in: Costello, M.J. et al. (Ed.) (2001). European register of marine species: a check-list of the marine species in Europe and a bibliography of guides to their identification. Collection Patrimoines Naturels, 50: pp. 357-374
http://www.marbef.org/data/aphia.php?p=sourcedetails&id=1411
-
Borges, P.A.V., Costa, A., Cunha, R., Gabriel, R., Gonçalves, V., Martins, A.F., Melo, I., Parente, M., Raposeiro, P., Rodrigues, P., Santos, R.S., Silva, L., Vieira, P. & Vieira, V. (Eds.) (2010). A list of the terrestrial and marine biota from the Azores. Princípia, Oeiras, 432 pp.
http://www.marinespecies.org/ascidiacea/aphia.php?p=sourcedetails&id=149079
Trusted
Physical Description
Size
Max. size
6.1 cm SL (male/unsexed; (Ref. 4479))
-
Hulley, P.A. 1990 Myctophidae. p. 398-467. In J.C. Quero, J.C. Hureau, C. Karrer, A. Post and L. Saldanha (eds.) Check-list of the fishes of the eastern tropical Atlantic (CLOFETA). JNICT, Lisbon; SEI; Paris; and UNESCO, Paris. Vol. 1. (Ref. 4479)
http://www.fishbase.org/references/FBRefSummary.php?id=4479&speccode=21
Trusted
Ecology
Habitat
Environment
bathypelagic; marine; depth range 250 - 1000 m (Ref. 4479)
-
Hulley, P.A. 1990 Myctophidae. p. 398-467. In J.C. Quero, J.C. Hureau, C. Karrer, A. Post and L. Saldanha (eds.) Check-list of the fishes of the eastern tropical Atlantic (CLOFETA). JNICT, Lisbon; SEI; Paris; and UNESCO, Paris. Vol. 1. (Ref. 4479)
http://www.fishbase.org/references/FBRefSummary.php?id=4479&speccode=21
Trusted
nektonic
-
North-West Atlantic Ocean species (NWARMS)
http://www.marinespecies.org/aphia.php?p=sourcedetails&id=2901
Trusted
Occasionally found in Canadian Atlantic waters. Nyctoepipelagic species; migrates from daytime depth of 475- 1000 m, found from surface to 250 m at night.
-
North-West Atlantic Ocean species (NWARMS)
http://www.marinespecies.org/aphia.php?p=sourcedetails&id=2901
Trusted
Known from seamounts and knolls
-
Stocks, K. 2009. Seamounts Online: an online information system for seamount biology. Version 2009-1. World Wide Web electronic publication.
http://www.marinespecies.org/porifera/porifera.php?p=sourcedetails&id=145453
Trusted
Depth range based on 85 specimens in 1 taxon.
Water temperature and chemistry ranges based on 84 samples.
Environmental ranges
Depth range (m): 1 - 2415
Temperature range (°C): 3.164 - 24.532
Nitrate (umol/L): 0.122 - 34.674
Salinity (PPS): 33.833 - 36.739
Oxygen (ml/l): 1.958 - 5.969
Phosphate (umol/l): 0.028 - 2.111
Silicate (umol/l): 0.799 - 27.851
Graphical representation
Depth range (m): 1 - 2415
Temperature range (°C): 3.164 - 24.532
Nitrate (umol/L): 0.122 - 34.674
Salinity (PPS): 33.833 - 36.739
Oxygen (ml/l): 1.958 - 5.969
Phosphate (umol/l): 0.028 - 2.111
Silicate (umol/l): 0.799 - 27.851
Note: this information has not been validated. Check this *note*. Your feedback is most welcome.
Water temperature and chemistry ranges based on 84 samples.
Environmental ranges
Depth range (m): 1 - 2415
Temperature range (°C): 3.164 - 24.532
Nitrate (umol/L): 0.122 - 34.674
Salinity (PPS): 33.833 - 36.739
Oxygen (ml/l): 1.958 - 5.969
Phosphate (umol/l): 0.028 - 2.111
Silicate (umol/l): 0.799 - 27.851
Graphical representation
Depth range (m): 1 - 2415
Temperature range (°C): 3.164 - 24.532
Nitrate (umol/L): 0.122 - 34.674
Salinity (PPS): 33.833 - 36.739
Oxygen (ml/l): 1.958 - 5.969
Phosphate (umol/l): 0.028 - 2.111
Silicate (umol/l): 0.799 - 27.851
Note: this information has not been validated. Check this *note*. Your feedback is most welcome.
Trusted
Depth: 250 - 1000m.
From 250 to 1000 meters.
Habitat: bathypelagic. Depth range during daytime is from 475-1000 m; nyctoepipelagic at surface and down to 250 m ( max. abundance at 100 m) (Ref. 4479).
From 250 to 1000 meters.
Habitat: bathypelagic. Depth range during daytime is from 475-1000 m; nyctoepipelagic at surface and down to 250 m ( max. abundance at 100 m) (Ref. 4479).
Trusted
Trophic Strategy
High-oceanic, found between 475-1000 m during the day; nyctoepipelagic at surface and down to 250 m ( maximum abundance at 100 m) (Ref. 4479). Mesopelagic (Ref. 5951).
Trusted
Molecular Biology and Genetics
Molecular Biology
Barcode data: Hygophum taaningi
The following is a representative barcode sequence, the centroid of all available sequences for this species.

There is 1 barcode sequence available from BOLD and GenBank. Below is the sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species. See the BOLD taxonomy browser for more complete information about this specimen. Other sequences that do not yet meet barcode criteria may also be available.
Download FASTA File
There is 1 barcode sequence available from BOLD and GenBank. Below is the sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species. See the BOLD taxonomy browser for more complete information about this specimen. Other sequences that do not yet meet barcode criteria may also be available.
CCTATACCTGATTTTTGGTGCCTGAGCAGGCATAGTGGGCACTGCCCTAAGCCTCCTTATTCGCGCTGAACTAAGCCAACCCGGGGCCCTCCTCGGGGATGACCAGATCTATAATGTGATCGTAACAGCTCACGCCTTCGTAATAATCTTCTTTATAGTCATACCCATCATAATCGGAGGCTTTGGAAACTGACTAATTCCCCTAATAATCGGAGCCCCCGACATAGCATTCCCCCGAATAAATAACATAAGCTTCTGACTGCTCCCTCCCTCTTTCCTGCTTCTTCTCGCCTCTTCCGGCGTGGAAGCCGGAGCAGGAACCGGCTGAACAGTCTATCCCCCGCTCGCTGGCAATCTCGCACATGCCGGAGCCTCGGTTGACCTAACAATCTTCTCACTTCACCTAGCAGGTGTCTCATCAATCTTAGGCGCCATCAACTTTATTACAACCATTATTAATATGAAGTCCCCAGCAATCTCCCAATACCAGACCCCTCTATTTGTCTGAGCAGTCTTAATTACAGCTGTTCTTCTCCTCCTGTCCCTCCCCGTCCTGGCCGCTGGTATTACCATACTCCTAACAGACCGAAACCTAAATACAACTTTCTTTGACCCCGCAGGCGGGGGAGACCCTATCCTTTACCAACATCTA
-- end --
-- end --
Download FASTA File
Trusted
Statistics of barcoding coverage: Hygophum taaningi
Barcode of Life Data Systems (BOLDS) Stats
Public Records: 1
Specimens with Barcodes: 61
Species With Barcodes: 1
Public Records: 1
Specimens with Barcodes: 61
Species With Barcodes: 1
Trusted
Conservation
Threats
Not Evaluated
-
IUCN 2006 2006 IUCN red list of threatened species. www.iucnredlist.org. Downloaded July 2006.
http://www.fishbase.org/references/FBRefSummary.php?id=57073
Trusted
Disclaimer
EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.
To request an improvement, please leave a comment on the page. Thank you!


