Overview

Comprehensive Description

Biology

High-oceanic, found between 475-1000 m during the day; nyctoepipelagic at surface and down to 250 m ( maximum abundance at 100 m) (Ref. 4479).
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Distribution

Atlantic: south of about 40° N to 30°S in the western Atlantic
  • North-West Atlantic Ocean species (NWARMS)
Creative Commons Attribution 3.0 (CC BY 3.0)

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Atlantic.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Atlantic Ocean: south of about 40°N to 30°S in the western Atlantic and to about 22°S in eastern Atlantic.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Physical Description

Size

Maximum size: 61 mm SL
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Max. size

6.1 cm SL (male/unsexed; (Ref. 4479))
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Ecology

Habitat

Known from seamounts and knolls
  • Stocks, K. 2009. Seamounts Online: an online information system for seamount biology. Version 2009-1. World Wide Web electronic publication.
Creative Commons Attribution 3.0 (CC BY 3.0)

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

nektonic
  • North-West Atlantic Ocean species (NWARMS)
Creative Commons Attribution 3.0 (CC BY 3.0)

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Occasionally found in Canadian Atlantic waters. Nyctoepipelagic species; migrates from daytime depth of 475- 1000 m, found from surface to 250 m at night.
  • North-West Atlantic Ocean species (NWARMS)
Creative Commons Attribution 3.0 (CC BY 3.0)

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Environment

bathypelagic; marine; depth range 250 - 1000 m (Ref. 4479)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Depth range based on 85 specimens in 1 taxon.
Water temperature and chemistry ranges based on 84 samples.

Environmental ranges
  Depth range (m): 1 - 2415
  Temperature range (°C): 3.164 - 24.532
  Nitrate (umol/L): 0.122 - 34.674
  Salinity (PPS): 33.833 - 36.739
  Oxygen (ml/l): 1.958 - 5.969
  Phosphate (umol/l): 0.028 - 2.111
  Silicate (umol/l): 0.799 - 27.851

Graphical representation

Depth range (m): 1 - 2415

Temperature range (°C): 3.164 - 24.532

Nitrate (umol/L): 0.122 - 34.674

Salinity (PPS): 33.833 - 36.739

Oxygen (ml/l): 1.958 - 5.969

Phosphate (umol/l): 0.028 - 2.111

Silicate (umol/l): 0.799 - 27.851
 
Note: this information has not been validated. Check this *note*. Your feedback is most welcome.

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Depth: 250 - 1000m.
From 250 to 1000 meters.

Habitat: bathypelagic. Depth range during daytime is from 475-1000 m; nyctoepipelagic at surface and down to 250 m ( max. abundance at 100 m) (Ref. 4479).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Trophic Strategy

High-oceanic, found between 475-1000 m during the day; nyctoepipelagic at surface and down to 250 m ( maximum abundance at 100 m) (Ref. 4479). Mesopelagic (Ref. 5951).
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Partner Web Site: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Life History and Behavior

Behavior

Diet

Feeds on zooplankton
  • North-West Atlantic Ocean species (NWARMS)
Creative Commons Attribution 3.0 (CC BY 3.0)

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Hygophum taaningi

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There is 1 barcode sequence available from BOLD and GenBank.

Below is the sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.

See the BOLD taxonomy browser for more complete information about this specimen.

Other sequences that do not yet meet barcode criteria may also be available.

CCTATACCTGATTTTTGGTGCCTGAGCAGGCATAGTGGGCACTGCCCTAAGCCTCCTTATTCGCGCTGAACTAAGCCAACCCGGGGCCCTCCTCGGGGATGACCAGATCTATAATGTGATCGTAACAGCTCACGCCTTCGTAATAATCTTCTTTATAGTCATACCCATCATAATCGGAGGCTTTGGAAACTGACTAATTCCCCTAATAATCGGAGCCCCCGACATAGCATTCCCCCGAATAAATAACATAAGCTTCTGACTGCTCCCTCCCTCTTTCCTGCTTCTTCTCGCCTCTTCCGGCGTGGAAGCCGGAGCAGGAACCGGCTGAACAGTCTATCCCCCGCTCGCTGGCAATCTCGCACATGCCGGAGCCTCGGTTGACCTAACAATCTTCTCACTTCACCTAGCAGGTGTCTCATCAATCTTAGGCGCCATCAACTTTATTACAACCATTATTAATATGAAGTCCCCAGCAATCTCCCAATACCAGACCCCTCTATTTGTCTGAGCAGTCTTAATTACAGCTGTTCTTCTCCTCCTGTCCCTCCCCGTCCTGGCCGCTGGTATTACCATACTCCTAACAGACCGAAACCTAAATACAACTTTCTTTGACCCCGCAGGCGGGGGAGACCCTATCCTTTACCAACATCTA
-- end --

Download FASTA File

Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Hygophum taaningi

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 1
Specimens with Barcodes: 61
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Conservation

Threats

Not Evaluated
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!