Articles on this page are available in 1 other language: Spanish (1) (learn more)

Overview

Brief Summary

The bluefin tunas are among the largest and fastest open ocean fishes and are important economically and culturally in many parts of the world. There are three species of bluefin tuna- the prized and endangered Atlantic bluefin (Thunnus thynnus), the widespread but similarly overfished Pacific bluefin (Thunnus orientalis), and the smaller but also tasty Southern bluefin tuna (Thunnus mccoyi). Bluefin tunas are spectacular swimming machines with torpedo-shaped, streamlined bodies built for speed and high-powered muscle and tendon systems that have evolved for high endurance. Bluefin tunas are warm-blooded, a rare trait among fish, and are thus able to adjust their body temperature, keeping their body temperatures higher than the surrounding water, which is why they are so well adapted to cooler ocean waters. Bluefin tunas are considered exceptionally good to eat, particularly by those who enjoy various forms of raw fish such as sushi and sashimi, and all species of bluefin tuna are pursued constantly by the fishing industry and by sport fishermen. As a result, overfishing throughout their range has driven their numbers to critically low levels. Some populations of bluefin tuna are thought be extinct and others are critically endangered.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

 

Supplier: Mark Westneat

Trusted

Article rating from 2 people

Average rating: 5.0 of 5

Biology

The northern bluefin tuna spawns at just a few locations. In the Pacific Ocean, spawning takes place off the Philippines, while in the Atlantic, this tuna spawns only in the Mediterranean between June and August, and in the Gulf of Mexico, between April and June (2) (4). During these periods, females release up to ten million eggs into the ocean (4), which are carried substantial distances by currents. From these eggs hatch tiny larvae; initially measuring just three millimetres long, the larvae grow at a rate of one millimetre per day (2). The northern bluefin tuna is a slow growing and long-lived species, maturing between the ages of four and five years in the Mediterranean and at eight years in the Gulf of Mexico (5) and living for up to 30 years (3). In schools of similar-sized individuals, the northern bluefin tuna cruises the oceans in search of food, often joining schools with other tuna, such as albacore, yellowfin and bigeye (4). The northern bluefin tuna has two types of muscle; one suited to long-distance, continuous swimming (a bluefin tuna can cross the Atlantic Ocean in less than 60 days (2)), the other providing short, fast bursts of speed (3). Reaching speeds of 45 miles per hour (2), the northern bluefin tuna employs this explosive swimming power when in pursuit of small schooling fish, such as anchovies, while it swims slowly with its mouth open to catch small slow-moving prey, such as red crab (4). When wandering the expansive oceans, the northern bluefin tuna tends to stay fairly close to the surface, but it is capable of diving to depths of 1,000 metres when in pursuit of prey (3). A fascinating system of blood vessels prevents any heat created through exertion being lost to the surroundings, thus allowing this tuna to swim in water too cold for other fish (3). The northern bluefin tuna has been observed undertaking seasonal migrations in some areas of its range. During the summer months, bluefin tuna migrate northwards along the coast of Japan and the Pacific coast of North America (4), while migrations across the oceans have also been observed (2). Small deposits of magnetite in the heads of tuna are believed to act like a built-in compass, enabling the tuna to orientate itself in its vast habitat by picking up the earth's magnetic field (3).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Google Earth Tour Video

Experience the narrated Atlantic Bluefun Tuna
Google Earth Tour Video
.
  • This tour was created by Eduardo Garcia-Milagros, in collaboration with Atlantic Public Media, Randy Kochevar and Andre Boustany. Narrated by One Species at a Time host, Ari Daniel Shapiro.

    Narration produced by Atlantic Public Media.
Creative Commons Attribution 3.0 (CC BY 3.0)

© EOL Learning + Education

Supplier: eoleducation

Unreviewed

Article rating from 1 person

Average rating: 1.0 of 5

Comprehensive Description

Biology

Oceanic but seasonally coming close to shore. They school by size, sometimes together with albacore, yellowfin, bigeye, skipjack etc. Visual predators (Ref. 88866) preying on small schooling fishes (anchovies, sauries, hakes) or on squids and red crabs. Live up to 40 years in the western Atlantic (Ref. 88822). Weight up to 900 kg (Ref. 88823). Eggs and larvae are pelagic (Ref. 6769). Juvenile growth is rapid (about 30 cm / year) but slower than in other tuna and billfish species (Ref. 88867). Adult growth is considerably slower, with about 10 years needed to reach two thirds of maximum length. Commercially cultured in Japan. Utilized fresh for sashimi, also canned (Ref. 9988). Become rare because of massive overfishing (Ref. 35388).
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© WorldFish Center - FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Description

 One of the largest bony fish in the world, the northern bluefin tuna has a very streamlined and powerful body. It can reach up to 300 cm in length and weigh over 450 kg. The body is deepest near the middle of the first dorsal fin and tapers to a pointed snout. The upper body is dark blue in colour while the lower half is silvery white. Thunnus thynnus has a large and crescent-shaped tail and its dorsal and anal fins are yellowish in colour. Bluefin tuna are known for the finlets that run down the dorsal and ventral sides towards the anal fin.Northern bluefin tuna school by size, sometimes together with other species. It preys on small schooling fishes or on squids and red crabs. They are commercially cultured although not in the UK or Ireland (Frimodt, 1995), and have become rare elsewhere because of substantial overfishing (Muus & Nielsen, 1999).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

©  The Marine Biological Association of the United Kingdom

Source: Marine Life Information Network

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Description

One of the largest of the tunas (2), the northern bluefin tuna has been called a 'pinnacle of fish evolution', referring to its remarkable swimming ability (3). Its body, shimmering deep metallic blue above and silvery white on the underside (2), is well adapted for a life wandering the vast oceans. It is deep bodied, but flattened from side to side, and tapers to a point before the sickle-shaped tail fin, which can power the tuna with ease through the water (3). Colourless lines and rows of dots may be visible on the lower sides and belly (4). The northern bluefin tuna has two dorsal fins; the first may be yellow or blue, while the second, taller dorsal fin, is reddish-brown (2) (4). The second dorsal fin is followed by seven to ten yellow finlets, edged with black, which run down the back toward the tail (2).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Distribution

Geographic Range

Bluefin tuna are distributed throughout the Atlantic and Pacific Oceans in subtropical and temperate waters. In the western Atlantic Ocean, they are found from Labrador, in Canada, to northern Brazil, including the Gulf of Mexico. In the eastern Atlantic Ocean, they are found from Norway to the Canary Islands. In the western Pacific Ocean, they are found from Japan to the Philippines. In the eastern Pacific Ocean, they are found from the southern coast of Alaska to Baja California, Mexico.

Biogeographic Regions: atlantic ocean (Native ); pacific ocean (Native ); mediterranean sea (Native )

  • Agustin, L., A. Sampang, S. Luna. 2005. "Species Summary" (On-line). Accessed October 12, 2005 at http://www.fishbase.org/Summary/SpeciesSummary.php?id=147.
  • Figaro, L. 2005. "MEDITERRANEAN BLUEFIN TUNA ON ENDANGERED LIST?" (On-line). Accessed October 18, 2005 at http://www.spc.int/coastfish/News/Fish_News/100/NIAR_100_3.htm.
  • Gardieff, S. 2005. "Bluefin Tuna" (On-line). Accessed October 14, 2005 at http://www.flmnh.ufl.edu/fish/Gallery/Descript/BluefinTuna/BluefinTuna.html.
  • Marinebio.org, 2005. "Atlantic Bluefin Tuna" (On-line). Accessed October 12, 2005 at http://marinebio.org/species.asp?id=236.
  • Miyashita, S., Y. Sawada, T. Okada, O. Murata, H. Kumai. 2001. "Morphological development and growth of laboratory-reared larval and juvenile Thunnus thynnus" (On-line). Accessed October 12, 2005 at http://www.findarticles.com/p/articles/mi_m0FDG/is_4_99/ai_81790014.
  • Scott, S. 1997. "Ocean Watch" (On-line). Accessed October 13, 2005 at http://www.susanscott.net/OceanWatch1997/sep01-97.html.
  • Tudela, S. 2001. "Tuna Farming in the Mediterranian: The Coup de grace to a Dwindling Population" (On-line). Accessed October 17, 2005 at http://72.14.203.104/search?q=cache:x9DyDZgfi00J:www.wwf.no/english/aquaculture/wwf_medpo_tuna_farming_report.doc+bluefin+tuna+captivity+lifespan&hl=en.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Distribution

Newfoundland to Gulf of Mexico
Creative Commons Attribution 3.0 (CC BY 3.0)

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Distribution

Azores, Azores Exclusive Economic Zone, Belgian Exclusive Economic Zone, British Columbia, Canadian Exclusive Economic Zone [Pacific part], Coastal Waters of Southeast Alaska and British Columbia, European waters (ERMS scope), FAO fishing area 67, Greek Exclusive Economic Zone, Gulf of Maine, Gulf of Mexico, Israeli Exclusive Economic Zone [Mediterranean part], North East Pacific, North Pacific, North West Atlantic, Portugese Exclusive Economic Zone, South Africa (country), Spanish Exclusive Economic Zone, United Kingdom Exclusive Economic Zone, Wimereux
Creative Commons Attribution 3.0 (CC BY 3.0)

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Western Atlantic: Labrador and Newfoundland to Gulf of Mexico, and Caribbean Sea to Venezuela and Brazil. Eastern Atlantic: Lofoten Islands off Norway to Canary Islands, including the Mediterranean and the southern part of the Black Sea (Ref. 6769). Reported from Mauritania (Ref. 5377). There is a subpopulation off South Africa. Highly migratory species, Annex I of the 1982 Convention on the Law of the Sea (Ref. 26139).
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© WorldFish Center - FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

National Distribution

Canada

Origin: Native

Regularity: Regularly occurring

Currently: Present

Confidence: Confident

Type of Residency: Year-round

United States

Origin: Native

Regularity: Regularly occurring

Currently: Present

Confidence: Confident

Type of Residency: Year-round

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Western Atlantic: Canada, Gulf of Mexico, and the Caribbean Sea to Venezuela and Brazil. Eastern Atlantic: Lofoten I. off Norway to Canary I.; Mediterranean and the southern Black Sea.
  • Bigelow, H. B. and Schroeder, W. C., 1953; Collette, B. B., 1999; Collette, B. B., 1986.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Gulf of Maine - CoML

Source: Gulf of Maine Area Census of Marine Life

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Range

The northern bluefin tuna occurs in subtropical and temperate waters throughout the Atlantic and Pacific Oceans (4).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Physical Description

Morphology

Physical Description

Bluefin tuna are the largest of the tunas. They have a long pointed head and small eyes. Bluefin tuna have two dorsal fins with a small space between them and short pectorial fins. Their anal fin begins far behind the second dorsal fin and they have three keels on their caudal peduncle. Bluefin tuna have a metallic blue color on the top half of their bodies and silver from the middle of their sides down to the bottom. Their first dorsal fin is yellow or blue and their second is red or brown.  Their anal fin and finlets are yellow edged with black.  Their central caudal keel is black. Bluefin tuna are usually between .5 and 2.0 meters in length. They weigh on average between 136 kg and 680 kg

Range mass: 136 to 680 kg.

Average mass: 250 kg.

Range length: .5 to 4.5 m.

Average length: 2 m.

Other Physical Features: endothermic ; homoiothermic; bilateral symmetry

Sexual Dimorphism: sexes alike

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Dorsal spines (total): 12 - 14; Dorsal soft rays (total): 13 - 15; Analspines: 0; Analsoft rays: 13 - 16; Vertebrae: 39
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© WorldFish Center - FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Size

to 458 cm TL (male/unsexed); max. weight: 684 kg.
  • Bigelow, H. B. and Schroeder, W. C., 1953; Collette, B. B., 1999; Collette, B. B., 1986.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Gulf of Maine - CoML

Source: Gulf of Maine Area Census of Marine Life

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Max. size

458 cm TL (male/unsexed; (Ref. 26340)); max. published weight: 684.0 kg (Ref. 26340); max. reported age: 15 years (Ref. 4645)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© WorldFish Center - FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Diagnostic Description

A very large species, deepest near the middle of the first dorsal fin base. The second dorsal fin higher than the first; the pectoral fins are very short, less than 80% of head length. Swim bladder present. Lower sides and belly silvery white with colorless transverse lines alternated with rows of colorless dots. The first dorsal fin is yellow or bluish; the second reddish-brown; the anal fin and finlets dusky yellow and edged with black; the median caudal keel is black in adults. May be confused with several other tunas, these are typically much smaller and easily distinguished by specific patterns of stripes, bands or dots.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© WorldFish Center - FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Ecology

Habitat

Habitat and Ecology

Habitat and Ecology
This is a pelagic, oceanodromous species, that seasonally can be found close to shore and can tolerate a wide range of temperatures. This species schools by size, sometimes together with Albacore, Yellowfin, Bigeye, Skipjack etc. It preys on small schooling fishes (anchovies, sauries, hakes) or on squids and red crabs. A recent study on the Mediterranean diet of this species provided evidence that juveniles prey mainly on zooplankton and small pelagic coastal fishes, sub-adults prey on medium pelagic fishes, shrimps and cephalopods, while adults prey mainly on cephalopods and larger fishes (Sarà and Sarà 2007).

This species has a maximum size over 300 cm fork length (FL), but is more common to 200 cm. Longevity is at least 35 years and possibly to 50 years (Santamaria et al. 2009).

In the Western Atlantic, this species spawns in the Gulf of Mexico from mid-April to early June at temperatures of 22.6–27.5°C, starting at age 8–10 years at around 200 cm (FL), although most individuals first spawn closer to age 12 (Rooker et al. 2007, Rooker et al. 2008, Boustany et al. 2008, Diaz et al. 2009, Collette 2010). Recently, a few larvae were collected northeast of Campeche Bank suggesting that they were spawned outside of the Gulf of Mexico (Muhling et al. 2011). Maximum age is around 32 years (Neilson and Compana 2008), although age composition structure has also changed over time (e.g., there are more younger individuals). For the most recent stock assessment, an age of first maturity was estimated to be approximately 145 kg or about age nine years in the Gulf of Mexico (SRCS ICCAT 2010). For the western Atlantic stock, the generation length is therefore estimated to be approximately 13 years based on average survivorship and fecundity across known scombrid stocks (Collette et al. 2011).

The Eastern Atlantic stock spawns in the Mediterranean Sea from May to August at temperatures of 22.5–25.5°C, starting at age three years and full recruitment is reached by age five years. There are distinct behaviours during the spawning time, most noticeably with changes in diving times and depths. Estimated relative batch fecundity is greater (more than 90 oocytes/g of body weight) than estimated for other tunas in the genus Thunnus (Sissenwine et al. 1998, Corriero et al. 2003, Rooker et al. 2007, Boustany et al. 2008, Rooker et al. 2008, Collette 2010). Fromentin and Powers (2005) reported that there is spawning site fidelity for this species both in the Mediterranean Sea and in the Gulf of Mexico. There are several spawning grounds throughout the Mediterranean. In addition, there are genetically recognizable populations within the Mediterranean (Riccioni et al. 2010).

Median sexual maturity in the Mediterranean Sea was reached at 103.6 cm (FL), and females weighing between 270 and 300 kg produce as many as 10 million eggs per spawning season (Corriero et al. 2005).

In the Eastern Atlantic stock and in the Mediterranean Sea, age of first maturity is about 3–5 years (115–121 cm FL), with a longevity of 35 years or more (Corriero et al. 2003, Santamaria et al. 2009, Rooker et al. 2007, Rooker et al. 2008). For the most recent stock assessment, an age of first maturity was estimated to be approximately 25 kg or age four years in the Mediterranean (SRCS ICCAT 2010). For the eastern Atlantic stock, the generation length is therefore estimated to be approximately seven years based on average survivorship and fecundity across known scombrid stocks (Collette et al. 2011).

Maximum Size (in cms) 458 (TL). The all-tackle angling record is of a 678.58 kg fish caught off Aulds Cove, Nova Scotia, Canada in 1979 (IGFA 2011.)

Systems
  • Marine
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Habitat

Bluefin tuna are marine fishes, they occupy both coastal and pelagic waters. They occupy depths from the surface to 1000 meters. They live in tropical, subtropical, and temperate waters.

Range depth: 1000 (high) m.

Average depth: 30 m.

Habitat Regions: temperate ; tropical ; saltwater or marine

Aquatic Biomes: pelagic ; coastal

  • Jeffries, B. 2005. "Southern Bluefin Tuna" (On-line). Accessed October 16, 2005 at http://www.sardi.sa.gov.au/pages/aquafin/southern_bluefin_tuna_industry.htm.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Habitat

nektonic
Creative Commons Attribution 3.0 (CC BY 3.0)

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Habitat

Pelagic oceanic species found to depths of 100 m.
Creative Commons Attribution 3.0 (CC BY 3.0)

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Depth range based on 7530 specimens in 1 taxon.
Water temperature and chemistry ranges based on 7272 samples.

Environmental ranges
  Depth range (m): 0 - 3850
  Temperature range (°C): 2.291 - 27.594
  Nitrate (umol/L): 0.074 - 30.755
  Salinity (PPS): 31.913 - 37.035
  Oxygen (ml/l): 2.674 - 7.279
  Phosphate (umol/l): 0.022 - 2.041
  Silicate (umol/l): 0.728 - 29.569

Graphical representation

Depth range (m): 0 - 3850

Temperature range (°C): 2.291 - 27.594

Nitrate (umol/L): 0.074 - 30.755

Salinity (PPS): 31.913 - 37.035

Oxygen (ml/l): 2.674 - 7.279

Phosphate (umol/l): 0.022 - 2.041

Silicate (umol/l): 0.728 - 29.569
 
Note: this information has not been validated. Check this *note*. Your feedback is most welcome.
Public Domain

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Habitat Type: Marine

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Habitat

 Thunnus thynnus is a pelagic species but seasonally comes close to shore.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

©  The Marine Biological Association of the United Kingdom

Source: Marine Life Information Network

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Pelagic; brackish; marine ; depth range 0 - 100 m. Oceanic, Seasonally nearshore. Can tolerate wide temperature range. School by size, sometimes with similar species.
  • Bigelow, H. B. and Schroeder, W. C., 1953; Collette, B. B., 1999; Collette, B. B., 1986.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Gulf of Maine - CoML

Source: Gulf of Maine Area Census of Marine Life

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Habitat

This fast-swimming predator is an oceanic species, inhabiting the upper waters that are reached by sunlight, but it may also sometimes come near to shore. It can tolerate a wide range of temperatures (4).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Environment

pelagic-oceanic; oceanodromous (Ref. 51243); brackish; marine; depth range 0 - 985 m (Ref. 55291), usually 0 - 100 m
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© WorldFish Center - FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Migration

Non-Migrant: No. All populations of this species make significant seasonal migrations.

Locally Migrant: No. No populations of this species make local extended movements (generally less than 200 km) at particular times of the year (e.g., to breeding or wintering grounds, to hibernation sites).

Locally Migrant: No. No populations of this species make annual migrations of over 200 km.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Oceanodromous. Migrating within oceans typically between spawning and different feeding areas, as tunas do. Migrations should be cyclical and predictable and cover more than 100 km.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© WorldFish Center - FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Trophic Strategy

Food Habits

Bluefin tuna chase down their prey using their ability to swim at very high speeds. They can also use modified filter feeding to catch small, slow moving organisms. They have also been known to eat kelp. They form feeding aggregations throughout the Atlantic and Pacific outside of the spawning season. Very little feeding occurs during spawning season.

Larvae feed on small organisms such as brine shrimp, other fish larvae, and rotifers. Juveniles also feed on small organisms until they become large enough to start feeding on small fish. The prey of adults include smaller fish, squid, eels, and crustaceans.

Animal Foods: fish; mollusks; aquatic crustaceans; echinoderms; other marine invertebrates; zooplankton

Plant Foods: macroalgae

Foraging Behavior: filter-feeding

Primary Diet: carnivore (Piscivore , Eats other marine invertebrates)

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Bluefin tuna are highly migratory, fast swimmers capable of attaining speeds over 90 km / h (Ref. 88852), moving between cooler feeding grounds and warmer spawning areas (Ref. 88823). Trans-Atlantic movements related to feeding have been reported; juveniles originating from the Mediterranean Sea found in foraging grounds in the eastern coast of the USA (88870), conversely, juveniles originating from the western Atlantic have been found in foraging grounds in the central North Atlantic (88868). In the northeastern Pacific, they tend to migrate northward along the coast of Baja California and California, USA from June to September. Off the Pacific coast of Japan they migrate northward in summer and southward during winter. Large fish may enter the Sea of Japan from the south in early summer and move as far north as the Okhotsk Sea, most leave the Sea of Japan through Tsugara Strait, north of Honshu. Variations in the food spectrum are attributed primarily to behavioral differences in feeding: 'vigorous pursuit' would be required on small schooling fishes (anchovies, sauries, hakes) or on squids, while 'modified filter-feeding' is used to feed on red crabs and other less agile organisms (Ref. 168). Preyed upon by killer whales, Orcinus orca; mako sharks and pilot whales, Globicephala melaena. Parasites found were Hirundinella ventricosa, Hysterothylacium adunca, Hysterothylacium incurvum, Hysterothylacium reliquens, Anisakis simplex, Genitocotyle atlantica, Derogenes varicans, Caligus coryphaenae and Rhapidascaris camura (Ref. 5951).
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© WorldFish Center - FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Small schooling fishes (anchovies, sauries, hakes) or squids and red crabs.
  • Bigelow, H. B. and Schroeder, W. C., 1953; Collette, B. B., 1999; Collette, B. B., 1986.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Gulf of Maine - CoML

Source: Gulf of Maine Area Census of Marine Life

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Associations

Ecosystem Roles

Bluefin tuna are predators in their ecosystem and they are also a source of food for larger predators, including humans. They act as hosts for at least 72 parasites. These include: Euryphorus brachypterus, found in branchial cavities, Brachiella thynni, found on the fins, Pennella filosa, which inserts itself into the flesh of the fish, Pseudocycnus appendiculatus, found on the gill filaments, and Caligus bonito and C. productus which are found on the surface of the body and the wall of the branchial cavities.

They are also mutualists with other tuna species because tunas school in groups of similar sizes and mixed species, rather than groups of the same species.

Mutualist Species:

Commensal/Parasitic Species:

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Predation

Predators of bluefin tuna include sharks, large predatory fishes, humans, marine mammals, including killer whales and pilot whales. Their anti-predator behaviors are schooling and the ability to make a fast escape. Their countershaded coloration makes them camouflaged in aquatic environments, their blue coloration dorsally makes them less visible from above and their light ventral coloration makes them less visible when seen from below.

Known Predators:

Anti-predator Adaptations: cryptic

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Diseases and Parasites

Wedlia Infestation 3. Parasitic infestations (protozoa, worms, etc.)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© WorldFish Center - FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Wedlia Infestation 1. Parasitic infestations (protozoa, worms, etc.)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© WorldFish Center - FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Tristomella Infestation 3. Parasitic infestations (protozoa, worms, etc.)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© WorldFish Center - FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Tristomella Infestation 2. Parasitic infestations (protozoa, worms, etc.)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© WorldFish Center - FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Tristomella Infestation 1. Parasitic infestations (protozoa, worms, etc.)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© WorldFish Center - FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Tentacularia Disease of Coryphaena. Parasitic infestations (protozoa, worms, etc.)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© WorldFish Center - FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Sterrhurus Infection. Parasitic infestations (protozoa, worms, etc.)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© WorldFish Center - FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Sibitrema Infection. Parasitic infestations (protozoa, worms, etc.)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© WorldFish Center - FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Rhipidocotyle Infestation 6. Parasitic infestations (protozoa, worms, etc.)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© WorldFish Center - FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Pseudocycnus Disease. Parasitic infestations (protozoa, worms, etc.)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© WorldFish Center - FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Pennella Infestation 2. Parasitic infestations (protozoa, worms, etc.)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© WorldFish Center - FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Pelichnibothrium Infestation. Parasitic infestations (protozoa, worms, etc.)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© WorldFish Center - FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Oncophora Infestation 2. Parasitic infestations (protozoa, worms, etc.)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© WorldFish Center - FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Neohexostoma Infestation 4. Parasitic infestations (protozoa, worms, etc.)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© WorldFish Center - FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Neohexostoma infestation 2. Parasitic infestations (protozoa, worms, etc.)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© WorldFish Center - FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Nasicola Infestation 2. Parasitic infestations (protozoa, worms, etc.)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© WorldFish Center - FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Nasicola Infestation 1. Parasitic infestations (protozoa, worms, etc.)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© WorldFish Center - FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Metapseudaxine Infestation. Parasitic infestations (protozoa, worms, etc.)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© WorldFish Center - FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Lecithocladium Disease. Parasitic infestations (protozoa, worms, etc.)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© WorldFish Center - FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Lecithaster Infection. Parasitic infestations (protozoa, worms, etc.)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© WorldFish Center - FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Lacistorhynchus Disease. Parasitic infestations (protozoa, worms, etc.)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© WorldFish Center - FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Kuhnia Infestation 3. Parasitic infestations (protozoa, worms, etc.)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© WorldFish Center - FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Kudoa Infestation 4. Parasitic infestations (protozoa, worms, etc.)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© WorldFish Center - FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Köllikeria Infestation 4. Parasitic infestations (protozoa, worms, etc.)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© WorldFish Center - FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Köllikeria Infestation 2. Parasitic infestations (protozoa, worms, etc.)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© WorldFish Center - FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Köllikeria Infestation 1. Parasitic infestations (protozoa, worms, etc.)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© WorldFish Center - FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Koellikerioides Infestation 1. Parasitic infestations (protozoa, worms, etc.)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© WorldFish Center - FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Hysterothylacium Infection 6. Parasitic infestations (protozoa, worms, etc.)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© WorldFish Center - FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Hysterothylacium Infection 3. Parasitic infestations (protozoa, worms, etc.)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© WorldFish Center - FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Hirudinella Infestation. Parasitic infestations (protozoa, worms, etc.)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© WorldFish Center - FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Hirudinella Infestation 2. Parasitic infestations (protozoa, worms, etc.)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© WorldFish Center - FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Hirudinella clavata Disease. Parasitic infestations (protozoa, worms, etc.)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© WorldFish Center - FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Hexostoma thynni Disease. Parasitic infestations (protozoa, worms, etc.)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© WorldFish Center - FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Hexostoma dissmile Disease. Parasitic infestations (protozoa, worms, etc.)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© WorldFish Center - FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Hexostoma albsmithi Disease. Parasitic infestations (protozoa, worms, etc.)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© WorldFish Center - FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Hexostoma acutum Disease. Parasitic infestations (protozoa, worms, etc.)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© WorldFish Center - FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Euryphorous Infestation 1. Parasitic infestations (protozoa, worms, etc.)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© WorldFish Center - FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Distomum Infection. Parasitic infestations (protozoa, worms, etc.)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© WorldFish Center - FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Didymozoon Infestation 4. Parasitic infestations (protozoa, worms, etc.)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© WorldFish Center - FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Didymozoon Infestation 3. Parasitic infestations (protozoa, worms, etc.)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© WorldFish Center - FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Didymozoon Infestation 2. Parasitic infestations (protozoa, worms, etc.)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© WorldFish Center - FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Didymostoma Infestation. Parasitic infestations (protozoa, worms, etc.)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© WorldFish Center - FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Didymocystis Infestation 24. Parasitic infestations (protozoa, worms, etc.)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© WorldFish Center - FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Didymocystis Infestation 15. Parasitic infestations (protozoa, worms, etc.)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© WorldFish Center - FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Didymocystis Infestation 12. Parasitic infestations (protozoa, worms, etc.)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© WorldFish Center - FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Didymocystis Infestation 11. Parasitic infestations (protozoa, worms, etc.)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© WorldFish Center - FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Callitetrarhynchus Disease. Parasitic infestations (protozoa, worms, etc.)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© WorldFish Center - FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Caligus Infestation 7. Parasitic infestations (protozoa, worms, etc.)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© WorldFish Center - FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Caligus Infestation 22. Parasitic infestations (protozoa, worms, etc.)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© WorldFish Center - FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Caligus Infestation 2. Parasitic infestations (protozoa, worms, etc.)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© WorldFish Center - FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Caligus Infestation 18. Parasitic infestations (protozoa, worms, etc.)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© WorldFish Center - FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Caballerocotyla Infestation 6. Parasitic infestations (protozoa, worms, etc.)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© WorldFish Center - FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Caballerocotyla Infestation 5. Parasitic infestations (protozoa, worms, etc.)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© WorldFish Center - FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Caballerocotyla Infestation 3. Parasitic infestations (protozoa, worms, etc.)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© WorldFish Center - FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Caballerocotyla Disease. Parasitic infestations (protozoa, worms, etc.)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© WorldFish Center - FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Brachiella Infestation. Parasitic infestations (protozoa, worms, etc.)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© WorldFish Center - FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Ascaridatosis (adult and juvenile). Parasitic infestations (protozoa, worms, etc.)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© WorldFish Center - FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Life History and Behavior

Behavior

Communication and Perception

Bluefin tuna perceive their enviroment and communicate through visual and chemical cues. They also have a well-developed lateral line system.

Communication Channels: visual ; tactile ; chemical

Perception Channels: visual

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Life Cycle

Development

Bluefin tuna larvae hatch at 3.0 mm and have large heads, large jaws, and lack body pigmentation. They do have dorsal tail pigment. After hatching they grow 1 mm per day. The young are on average 5.80 mm after 10 days, 10.62 mm by 20 days, and 35.74 mm by 30 days after hatching. Growth is especially accelerated after 20 days after hatching, up to 2.10 mm/day. Young begin schooling with other species of tuna based on size.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Oviparous batch spawner, with an inter-spawning interval of 1-2 days in the Mediterranean Sea (Ref. 88871). Females larger than 205 cm fork length are estimated to have a mean fecundity of 30-60 and 13-15 million eggs, in the western and eastern Atlantic respectively (Ref. 40805, Ref. 88871). Spawning occurs when sea surface temperatures are between 22.6-27.5 ºC and 22.5-25.5 ºC in the Gulf of Mexico and Mediterranean Sea respectively (88868). Spawning occurs between June and August in the Mediterranean Sea (Ref. 88868). Eggs are released directly to the water column and hatch after 2 days (Ref. 88823). At 24°C, embryo development lasts about 32 hours and larval stages about 30 days. Egg size 1.0 mm, larval length at hatching 2.8 mm.Spawning grounds are mainly known from the Gulf of Mexico and the Mediterranean Sea, but the presence of mature individuals and larvae far from these areas (e.g. Bahamas and central North Atlantic Ocean) suggest that other spawning grounds may also be utilized (Ref. 88873, Ref. 88874, Ref. 88872). Appears to display homing behaviour with (western-tagged individuals migrating back to specific spawning sites either in the Gulf of Mexico or the Mediterranean Sea) (Ref. 88872, Ref. 88870). Fidelity to natal areas seem to occur once individuals reach maturity, i.e. after returning to either the western or eastern spawning grounds (Ref. 88868).
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© WorldFish Center - FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Life Expectancy

Lifespan/Longevity

In the wild bluefin tuna are expected to live about 15 years. It is estimated that the longest lifespan known in the wild is between 20 and 30 years. Tuna caught and placed in captivity have short life spans because they are kept for a short period of time while they are fattened before harvesting.

Range lifespan

Status: wild:
30 (high) years.

Typical lifespan

Status: wild:
10 to 25 years.

Average lifespan

Status: wild:
15 years.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Reproduction

Reproduction

Bluefin tuna form spawning aggregations. Males and females synchronously produce eggs and sperm (milt), resulting in mating among many individuals at the same time. This is also called broadcast spawning.

Mating System: polygynandrous (promiscuous)

Bluefin tuna migrate to either the Gulf of Mexico or the Mediterranean and form spawning aggregations. Females lay up to 10 million eggs each spawning period. Males fertilize the eggs as they are produced by the females. Water temperatures during spawning are 24.8°C to 29.5°C in the Gulf of Mexico and 18.9°C to 21.1°C in the Mediterranean.

Bluefin tuna become sexually mature between the ages of 4 and 8 years.

Breeding interval: Bluefin tuna breed once yearly.

Breeding season: Breeding occurs from April to June in the Gulf of Mexico and June to August in the Mediterranean.

Range number of offspring: 10,000,000 (high) .

Range gestation period: 1.5 to 4 days.

Average gestation period: 3 days.

Range age at sexual or reproductive maturity (female): 4 to 8 years.

Average age at sexual or reproductive maturity (female): 5 years.

Range age at sexual or reproductive maturity (male): 4 to 8 years.

Average age at sexual or reproductive maturity (male): 5 years.

Key Reproductive Features: iteroparous ; seasonal breeding ; gonochoric/gonochoristic/dioecious (sexes separate); broadcast (group) spawning; oviparous

No parental care is provided for the young.

Parental Investment: no parental involvement; pre-fertilization (Provisioning)

  • Agustin, L., A. Sampang, S. Luna. 2005. "Species Summary" (On-line). Accessed October 12, 2005 at http://www.fishbase.org/Summary/SpeciesSummary.php?id=147.
  • Figaro, L. 2005. "MEDITERRANEAN BLUEFIN TUNA ON ENDANGERED LIST?" (On-line). Accessed October 18, 2005 at http://www.spc.int/coastfish/News/Fish_News/100/NIAR_100_3.htm.
  • Gardieff, S. 2005. "Bluefin Tuna" (On-line). Accessed October 14, 2005 at http://www.flmnh.ufl.edu/fish/Gallery/Descript/BluefinTuna/BluefinTuna.html.
  • Jeffries, B. 2005. "Southern Bluefin Tuna" (On-line). Accessed October 16, 2005 at http://www.sardi.sa.gov.au/pages/aquafin/southern_bluefin_tuna_industry.htm.
  • Marinebio.org, 2005. "Atlantic Bluefin Tuna" (On-line). Accessed October 12, 2005 at http://marinebio.org/species.asp?id=236.
  • Miyashita, S., Y. Sawada, T. Okada, O. Murata, H. Kumai. 2001. "Morphological development and growth of laboratory-reared larval and juvenile Thunnus thynnus" (On-line). Accessed October 12, 2005 at http://www.findarticles.com/p/articles/mi_m0FDG/is_4_99/ai_81790014.
  • Scott, S. 1997. "Ocean Watch" (On-line). Accessed October 13, 2005 at http://www.susanscott.net/OceanWatch1997/sep01-97.html.
  • Tudela, S. 2001. "Tuna Farming in the Mediterranian: The Coup de grace to a Dwindling Population" (On-line). Accessed October 17, 2005 at http://72.14.203.104/search?q=cache:x9DyDZgfi00J:www.wwf.no/english/aquaculture/wwf_medpo_tuna_farming_report.doc+bluefin+tuna+captivity+lifespan&hl=en.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Large females can produce as many as 10 million eggs per spawning season. Eggs and larvae seen in June and July.
  • Bigelow, H. B. and Schroeder, W. C., 1953; Collette, B. B., 1999; Collette, B. B., 1986.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Gulf of Maine - CoML

Source: Gulf of Maine Area Census of Marine Life

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Thunnus thynnus

The following is a representative barcode sequence, the centroid of all available sequences for this species. 

 
There are 34 barcode sequences available from BOLD and GenBank.  Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen and other sequences.
 
GBGC0803-06|AY302574|Thunnus thynnus| ACACGCTGATTTTTCTCAACCAACCATAAAGACATCGGCACCCTCTATCTAGTATTCGGTGCATGAGCTGGAATAGTTGGCACGGCCTTA---AGCTTGCTCATCCGAGCTGAACTAAGCCAACCAGGTGCCCTTCTTGGGGAC---GACCAGATCTACAATGTAATCGTTACGGCCCATGCCTTCGTAATGATTTTCTTTATAGTAATACCAATTATGATTGGAGGATTTGGAAACTGACTTATTCCTCTAATG---ATCGGAGCCCCCGACATGGCATTCCCACGAATGAACAACATGAGCTTCTGACTCCTTCCCCCTTCTTTCCTTCTGCTCCTAGCTTCTTCAGGAGTTGAGGCTGGAGCCGGAACCGGTTGAACAGTCTACCCTCCCCTTGCCGGCAACCTAGCCCACGCAGGGGCATCAGTTGACCTA---ACTATTTTCTCACTTCACTTAGCAGGGGTTTCCTCAATTCTTGGGGCAATTAACTTCATCACAACAATTATCAATATGAAACCTGCAGCTATTTCTCAGTATCAAACACCACTGTTTGTATGAGCTGTACTAATTACAGCTGTTCTTCTCCTACTTTCCCTTCCAGTCCTTGCCGCT---GGTATTACAATGCTCCTTACAGACCGAAACCTAAATACAACCTTCTTCGACCCTGCAGGAGGGGGAGACCCAATCCTTTACCAACACCTATTCTGATTCTTTGGACATCCAGAAGTCTACATTCTTATTCTTCCTGGGTTCGGAATGATCTCCCACATTGTTGCCTACTACTCAGGTAAAAAA---GAACCTTTCGGCTACATGGGTATGGTATGAGCCATGATGGCCATCGGCCTACTAGGGTTCATCGTATGAGCCCACCACATGTTCACGGTAGGAATGG 
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Statistics of barcoding coverage: Thunnus thynnus

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 34
Species: 46
Species With Barcodes: 1

Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Conservation

Conservation Status

IUCN Red List Assessment


Red List Category
EN
Endangered

Red List Criteria
A2bd

Version
3.1

Year Assessed
2011

Assessor/s
Collette, B., Amorim, A.F., Boustany, A., Carpenter, K.E., de Oliveira Leite Jr., N., Di Natale, A., Die, D., Fox, W., Fredou, F.L., Graves, J., Viera Hazin, F.H., Hinton, M., Juan Jorda, M., Kada, O., Minte Vera, C., Miyabe, N., Nelson, R., Oxenford, H., Pollard, D., Restrepo, V., Schratwieser, J., Teixeira Lessa, R.P., Pires Ferreira Travassos, P.E. & Uozumi, Y.

Reviewer/s
Russell, B., Worm, B., Richards, W., MacKenzie, B. & Polidoro, B.

Contributor/s

Justification
This Atlantic species has experienced declines in range and reported catch per unit effort (CPUE) since the 1960s. Although a number of uncertainties exist in the reported data, especially from the Mediterranean region, the best estimates from the most recent 2010 stock assessment indicate that there has been a global decline of between 29% and 51% based on summed spawning stock biomass (SSB) from both the Western and Eastern stocks over the past 21–39 years (three generations, based on a generation length of between seven and 13 years). Pre-exploitation longevity is not known for the Eastern Atlantic, but it is assumed that at one point that this species had a similar longer generation length across its global range. Therefore, this species is estimated to have declined at least 51% over the past three generation lengths (39 years) and is listed as Endangered under Criterion A2. In the Eastern Atlantic stock, current fishing mortality is far above maximum sustainable yield (MSY) and estimated SSB is far below MSY. The Western Atlantic stock has experienced severe declines in the past, is also below MSY, and has not recovered under current fishing regimes. Management of the eastern Atlantic stock is essential to the future of this species, as it represents the majority of this species global population.

History
  • 1996
    Data Deficient
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Conservation Status

Many are concerned that bluefin tuna could easily become endangered due to high demand as a food source and resultant overfishing. Because bluefin tuna are migratory, they are often fished in international waters which caused the International Commission for the Conservation of Atlantic Tunas to be created in 1966. The ICCAT proposes management methods, conservation methods, and conducts reseach. Also in 2001 helicopter spotting was banned in the Mediterranean to try to control the amount harvested. Bluefin tuna cannot be breed in captivity. Bluefin tuna farms are not real farms. Tuna are instead caught and fattened rapidly, then processed.

US Federal List: no special status

CITES: no special status

IUCN Red List of Threatened Species: endangered

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

National NatureServe Conservation Status

Canada

Rounded National Status Rank: NNR - Unranked

United States

Rounded National Status Rank: NNR - Unranked

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

NatureServe Conservation Status

Rounded Global Status Rank: GNR - Not Yet Ranked

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Status

Classified as Data Deficient (DD) on the IUCN Red List (1). The Western Atlantic stock is classified as Critically Endangered (CR) and the Eastern Atlantic stock is classified as Endangered (EN) on the IUCN Red List (1).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Population

Population
This species has become rare relative to historical levels because of massive overfishing (Fromentin and Powers 2005, Majkowski 2007, MacKenzie et al. 2009). The Center for Biological Diversity (CBD 2010) petitioned the U.S. Government to list the Atlantic Bluefin Tuna under the U.S. Endangered Species Act. The U.S. government agreed to conduct a status review for this species (Schwaab 2010), but decided not to list it as Endangered or Threatened but as a Species of Concern (NMFS 2011) with plans to review its status again in 2013.

Genetic differentiation and homing to breeding sites indicates that there are at least three reproductively isolated stocks (Boustany et al. 2008, Carlsson et al. 2007) although there is considerable trans-Atlantic migration of individuals from the Mediterranean and western North Atlantic stocks (Rooker et al. 2008, Dickhut et al. 2009). The western Atlantic stock is found from Labrador and Newfoundland south into the Gulf of Mexico and Caribbean Sea; the eastern Atlantic stock from Norway south to the Canary Islands and the Mediterranean Sea. There is a distinct Mediterranean/East Atlantic stock but there is some mixing with the western Atlantic stock in the North Atlantic (Block et al. 2005); in addition, there are genetically recognizable populations within the Mediterranean (Riccione et al. 2010).

Worldwide reported landings show fluctuating, but relatively stable landings from 1950–1993, of between 15,000 and 39,000 tonnes per year. Reported catches increased to a peak of 52,785 tonnes in 1996, and then fell again to 38,830 tonnes in 2006 (FAO 2009). However, in many regions, the catch statistics for this species are considered to be unreliable because catches are not reported from some countries and landings data are confounded by ranching harvests occurring months to years after the fish have been caught (STEFC 2009). Based on the most recent stock assessment (ICCAT 2010), summed SBB biomass for both the Eastern and Western Atlantic stocks has declined at least 51% since 1970.

Western Atlantic Stock
In the western North Atlantic, the reported catch from 2000–2004 averaged 2,000–3,000 tonnes/year, and the status of the stock is Depleted (Majkowski 2007, ICCAT 2010). Western Atlantic Bluefin Tuna fisheries have been managed since the early 1980s (as of when 1982 quota restrictions were imposed) and catches have been relatively stable at around 2,500 tonnes (t) until 2001. They increased in 2002 to 3,319 t and have been declining since then, reaching 1,624 t in 2007. In 2008, catches increased again to 2,015 t. The most recent stock assessment (ICCAT 2010) is consistent with previous analyses in that spawning stock biomass (SSB) declined steadily between the early 1970s and early 1990s. Since then, SSB is estimated to have fluctuated between 21% and 28% of the 1970 level, but with a gradual increase in recent years from the low of 21% in 2003 to 29% in 2009. The stock has experienced different levels of fishing mortality over time, depending on the fish targeted by various fleets. A key factor in estimating MSY-related benchmarks is the highest level of recruitment that can be achieved in the long term. Assuming that average recruitment cannot reach the high levels from the early 1970s, recent F (2006–2008) is 70% of the MSY level and SSB2009 is about 10% higher than the MSY level. However, estimates of stock status are more pessimistic if a high recruitment scenario is considered (F/FMSY=1.9 and B/BMSY=0.15) (SCRS ICCAT 2010).

As linear regression did not provide the best fit for the steep declines observed in SSB over time in the Western Atlantic, using endpoints of the base case (ICCAT 2010) there has been an estimated 72% decline in SSB over the past 39 years (1970–2009), and a less than 1% decline in SSB over the past 21 years (1988–2009).

Eastern Atlantic and Mediterranean stock
In the Eastern Atlantic and Mediterranean stock, the reported catch from 2000–2004 averaged 32,000–35,000 tonnes/year, and the status of the stock is Over-Exploited (Majkowski 2007, ICCAT 2010). Currently this stock is fished at levels above FMSY, and estimated SSB is only about 35% of the biomass that is expected under a MSY (SRCS ICCAT 2010). The increase in mortality for large Bluefin Tuna is consistent with an apparent shift in targeting larger individuals destined for fattening and/or farming in the region. A quota system has been put in place to set levels for maximum sustainable yield (MSY) of 29,000 mt (STECF 2009), but current models put the MSY at 13,500 mt (SCRS ICCAT 2010). The current management structure has established TACs for the entire Mediterranean; however, recent genetic studies suggest multiple populations within the Mediterranean (Riccione et al. 2010). This is problematic because there is the potential for overfishing of segments of the Mediterranean population. In addition, information available has demonstrated that catches of Bluefin Tuna from the East Atlantic and Mediterranean were seriously under-reported between the mid-1990s through 2007. The lack of compliance with TAC and underreporting of the catch may have severely undermined the conservation of the stock (SRCS ICCAT 2010).

In the most recent stock assessment (SCRS ICCAT 2010), final estimated spawning biomass differs slightly between the two satisfactory model runs. The spawning biomass peaked at over 300,000 tonnes in the late 1950s and early 1970s, followed by a decline. Under run 13, the biomass continued to decline slightly to about 150,000 tonnes, while under run 15 biomass slightly increased during the late 2000s to about 2000,000 tonnes. Considering both runs, the analyses indicated that recent (2007–2009) SSB is about 57% of the highest estimated SSB levels (1957–1959).

Using endpoints of the base case (ICCAT 2010) there has been an estimated 45% decline in SSB over the past 39 years (1970–2009), and a 30% decline in SSB over the past 21 years (1988–2009) in the Eastern Atlantic stock.

Population Trend
Decreasing
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Threats

Threats

Major Threats
This species is mainly caught by purse-seine, longline and traps. It is also used for commercial fish farming in the Mediterranean Sea.

The eastern Atlantic Bluefin Tuna stock is taken by a variety of vessels and types of fishing gears, with landing sites located in many countries. The main gears are longline, trap and baitboat for the east Atlantic, and purse-seine, longline and traps for the Mediterranean. Recreational fishing may also be a relevant but unquantified source of fishing mortality on juvenile Bluefin Tuna. The paucity of reliable data from various fisheries has compromised the stock assessments of the eastern Atlantic Bluefin Tuna stock for many years (see for example SCRS ICCAT 2010, STECF 2009). Size composition data from purse seine fisheries was missing for many years, particularly in the 1990s. For most of the 2000s, tuna farming compounded the problem of obtaining accurate catch and size-composition data because the fish cannot be accurately sampled until harvesting, which takes place from four months to several years after the fish are caught in the wild. The accuracy of overall catches has also been affected over time by under-reporting or over-reporting associated with quotas. In addition, data on juvenile Bluefin Tuna catches from the Mediterranean were also unavailable for many years. Since 2008, ICCAT has adopted several measures that should address these concerns, such as an increase in minimum size, and 100% observer coverage on purse seiners and transfers of fish to cages. However, despite the expectation that these measures will improve fishery statistics, substantial gaps remain in the historical data used for stock assessments.

In the western Atlantic, the fishery is conducted by the US, Canada and Japan. There are concerns over the potential impacts on the 2010 year class from the Deep Horizon oil spill that occurred in the Gulf of Mexico between April–August of that year (Campagna et al. 2011, Richards 2011).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Threats

With its large size and high quality flesh, the northern bluefin tuna has long been a favourite of fishermen and a highly valued delicacy in Japan (3). Its popularity has led to severe exploitation in several areas, particularly the North Atlantic Ocean (2). Despite catch quotas being in place, limits are often not respected and catches are frequently under-reported (5). Unless adequate management measures are quickly implemented and, most importantly, enforced, the collapse of some northern bluefin tuna stocks is a real possibility (5). It is thought that the Critically Endangered western Atlantic stock may have already collapsed, the result of overfishing and poor management. This stock is now in grave danger of extinction (6). In the Mediterranean, where adult northern bluefin tuna decreased by 80 percent between around 1979 and 1999, tuna ranching now poses the greatest threat to the survival of this species. Tuna are captured alive and taken to one of the many ranches that have spread along the Mediterranean coast, where they are fed and fattened for months; the enormous amounts of fish needed to feed the tuna during this time is itself a matter of great concern. The tuna is then sold, primarily to Japan, creating a lucrative business that is considered to be the main force driving illegal and unreported fishing (7).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Data deficient (DD)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© WorldFish Center - FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Management

Conservation Actions

Conservation Actions
There are several conservation measures for this species mainly based on regulation of fisheries activities. The International Commission for the Conservation of the Atlantic Tuna (ICCAT) was established in 1967. Fisheries quotas have been set up since 1982, and a comprehensive pluri-annual recovery action plan adopted by the ICCAT contracting parties in 2007, including time closure for fishing activities and mandated reduction in fishing capacity. However, many conservation measures are not fully enforced and illegal catch continues. Enforcement of the existing measures is needed to prevent extinction of this species. Also, although the Bluefin Tuna probably has more data collected on it than most other fish species, uncertainties in the data make much of it unreliable. It is crucial to improve the quality of data if fisheries managers are going to be able to improve their methods.

High priority also needs to be given to protecting spawning adults in the Gulf of Mexico and Mediterranean Sea. Large adults in the northern foraging region in the Gulf of Maine and Gulf of St. Lawrence also need protection because this region represents critical refugia (Rooker et al. 2008).

Eastern Atlantic and Mediterranean
For EU Member States, driftnet fishing for tuna has been banned since 1st January 2002, while the ban entered into force in 2004 for all the other Contracting Parties to ICCAT, as well as the GFCM Member States, but a driftnet fishing activity is still officially permitted in Morocco. The ICCAT further believes that a time area closure could greatly facilitate the implementation and the monitoring of rebuilding strategies. In 2006, ICCAT established a management plan to rebuild the stock to Bmsy by 2022 with 50% or greater probability (Rec. 06-05). As various issues related to implementation of the plan have come up, the plan has been amended and strengthened every year since. In [Rec. 09-06] the Commission established a total allowable catch for eastern Atlantic and Mediterranean Bluefin Tuna at 13,500 t for 2010. The current management plan (Rec. 10-04) calls for rebuilding to be achieved with at least 60% probability. It includes a number of conservation measures (country-specific TACs, minimum size limit, closed fishing seasons, management controls of fishing and farming capacity) as well as Monitoring, Control and Surveillance (MCS) measures (vessel registers, vessel monitoring systems, observer programs, transshipment prohibitions, weekly catch reporting, etc.). ICCAT has also approved a research program with different components aimed at improving data and knowledge of Bluefin Tuna biology and behaviour. It is still early to see what practical improvements these efforts will have on rebuilding the stock and improving stock assessments, but it is generally agreed that investments in research and MCS need to be sustained if overfishing is to be avoided.

Deferring effective management measures will likely result in even more stringent measures being necessary in the future to achieve the ICCAT objectives. STECF agrees with the ICCAT-SCRS that the minimum catch size should be set at 25 kg in order to avoid misreporting and/or discarded catches of mature fish between 25 kg and 30 kg. There remains an urgent need to have more reliable and complete size frequency data (particularly, but not only, for early year-classes 1–3) for the period following the introduction of a TAC in the Mediterranean. Tagging programs, fishery independent surveys and mining of historical data will all contribute to a better understanding of the status of this species and should be encouraged (STECF 2009).

Western Atlantic
In 1998, the Commission initiated a 20-year rebuilding plan designed to achieve BMSY with at least 50% probability. In response to recent assessments, in 2008 the Commission recommended a total allowable catch (TAC) of 1,900 t in 2009 and 1,800 t in 2010 [Rec. 08-04] (SRCS ICCAT 2010). Probabilities of achieving BMSY within the Commission rebuilding period were projected for alternative catch levels. The "low recruitment scenario" suggests that biomass is currently sufficient to produce MSY, whereas the "high recruitment scenario" suggests that BMSY has a very low probability of being achieved within the rebuilding period. Despite this large uncertainty about the long term future productivity of the stock, under either recruitment scenario current catches (1,800 t) should allow the biomass to continue to increase. Also, catches in the order of 2,500 t (the level established in previous TACs) would prevent the stock from rebuilding (SRCS ICCAT 2010).

As noted previously by the SCRS, both the productivity of western Atlantic Bluefin and western Atlantic Bluefin fisheries are linked to the eastern Atlantic and Mediterranean stock. Therefore, management actions taken in the eastern Atlantic and Mediterranean are likely to influence the recovery in the western Atlantic, because even small rates of mixing from East to West can have significant effects on the West due to the fact that Eastern plus Mediterranean resource is much larger than that of the West (SRCS ICCAT 2010, STECF 2009).

Directed longline fishing for bluefin in the Gulf of Mexico is prohibited although a bycatch of one Bluefin Tuna is allowed during fishing directed at Yellowfin Tuna. Effective 5th May 2011, NMFS requires the use of “weak hooks” by pelagic longline vessels fishing in the Gulf of Mexico with the hopes that smaller Yellowfin Tuna will be retained on the hook and larger Bluefin Tuna will pull free (NMFS 2011). It is not yet clear if this technique will avoid adding to the thermal stress that longline-caught bluefins face on the spawning grounds in the Gulf of Mexico (Block et al. 2005).

It is strongly recommended that long-term larval studies in the Gulf of Mexico continue to assess the size of the population and to determine the potential impact of the Deepwater Horizon Oil Spill on the western Atlantic population, especially as the oil spill occurred during spawning season in May and June 2010. In addition, all tuna long-lining should be prohibited in the Gulf of Mexico during the spawning season in order to try to rebuild the population.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Conservation

In 1966, the International Commission for the Conservation of Atlantic Tunas (ICCAT) was formed, taking responsibility for the conservation of tunas in the Atlantic Ocean and its adjacent seas (5). Since 1998, catch limits have been in place for the northern bluefin tuna in the eastern Atlantic and Mediterranean, but until 2006, it was believed that these limits were not respected and were largely ineffective (5). In 2006, ICCAT adopted a 15 year recovery plan for the highly threatened stocks of the eastern Atlantic and Mediterranean. The plan includes stricter catch limits and more extensive closures of fisheries in certain areas and at certain times (5). As the northern bluefin tuna is such a slow-growing and long-lived species, it will take years, possibly over ten, before any benefits of these measures are observed (5). Hopefully this recovery plan will have some success, and prevent the eastern Atlantic stock falling into the same dire situation as the western Atlantic stock. Unless catches of this stock are reduced to near zero, the extinction of this large, economically valuable fish in the western Atlantic seems sadly inevitable (6).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Relevance to Humans and Ecosystems

Benefits

Economic Importance for Humans: Negative

Tuna fishing practices often result in harm to other species, including dolphins and sea turtles. There are potential health risks to humans that come from consuming large amounts of tuna due to mercury contamination in their flesh. Mercury contamination can result in damage to the nervous system, digestive system, respiratory system and kidneys. It can also have damaging effects on the male reproductive system and on developing fetuses. Mercury contamination is usually the result of bioaccumulation of toxins in water as a result of human activities.

  • Hightower, J., R. Rider. 2005. "NRDC: Mercury Contamination in Fish" (On-line). NDRC. Accessed December 01, 2005 at http://www.nrdc.org/health/effects/mercury/effects.asp.
  • Jeantheau, M. 2004. "Mercury in Fish" (On-line). Grinning Planet. Accessed December 01, 2005 at http://www.grinningplanet.com/2004/08-10/mercury-in-fish-article.htm.
  • Shwartz, M., K. Peterson. 2005. "Electronic tags reveal transatlantic migrations and breeding grounds of Atlantic bluefin tuna" (On-line). Accessed December 02, 2005 at http://www.stanford.edu/dept/news/pr/01/tunastudy822.html.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Economic Importance for Humans: Positive

Bluefin tuna are a popular sport fish. A very large and profitable industry has developed around bluefin tuna. They are a popular food item worldwide.

Positive Impacts: food

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Importance

fisheries: commercial; aquaculture: commercial; gamefish: yes
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© WorldFish Center - FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Wikipedia

Atlantic bluefin tuna

The Atlantic bluefin tuna (Thunnus thynnus) is a species of tuna in the Scombridae family. It is variously known as the northern bluefin tuna (mainly when including Pacific bluefin as a subspecies), giant bluefin tuna (for individuals exceeding 150 kilograms or around 330 pounds) and formerly as the tunny. Atlantic bluefin are native to both the western and eastern Atlantic Ocean, as well as the Mediterranean Sea. Atlantic bluefin have become extinct in the Black Sea. The Atlantic bluefin tuna is a close relative of the other two bluefin tuna species—the Pacific bluefin tuna and the southern bluefin tuna.

Atlantic bluefin tuna are capable of reaching well over 450 kilograms (990 lb) in weight, and rival the black marlin, blue marlin and swordfish as the largest Perciformes. Throughout recorded history, the Atlantic bluefin tuna has been highly prized as a food fish. Bluefin have been a valuable commercial catch from the time of the ancient Greeks and Phoenicians to the modern era. Besides their commercial value as food, their great size and the speed and power they display as apex predators has attracted the admiration and respect of both ancient and modern fishermen, as well as writers, sport anglers and scientists.

The Atlantic bluefin tuna has been the foundation of one of the world's most lucrative commercial fisheries. Medium-sized and large individuals are heavily targeted for the Japanese raw fish market, where all bluefin species are highly prized for sushi and sashimi. This commercial importance has led to severe overfishing. The International Commission for the Conservation of Atlantic Tunas (ICCAT) affirmed in October 2009 that Atlantic bluefin tuna stocks have declined dramatically over the last 40 years, by 72% in the Eastern Atlantic, and by 82% in the Western Atlantic.[2] On October 16, 2009, Monaco formally recommended Endangered Atlantic bluefin tuna for an Appendix I CITES listing and international trade ban. In early 2010, European officials, led by the French ecology minister, increased pressure to ban the commercial fishing of bluefin tuna internationally.[3] European Union nations, who are responsible for most bluefin tuna overfishing, later abstained from voting to protect the species from international trade.[4]

Bluefin are captured for the commercial market by professional fishermen using purse seine gear, assorted hook-and-line gear, most importantly the longline, and in certain areas by harpooners. Atlantic bluefin are also taken commercially by heavy rod and reel gear. Since the 1930s the bluefin tuna has long been one of the most important big-game species sought by sports fishermen, particularly in the United States but also in Canada, Spain, France and Italy.

Contents

Taxonomy

The Atlantic bluefin tuna is most closely related to the Pacific bluefin tuna (Thunnus orientalis) and the southern bluefin tuna (Thunnus maccoyii), and more distantly to the other large tunas of the genus Thunnus - the bigeye tuna (Thunnus obesus) and the yellowfin tuna (Thunnus albacares).[5] For many years the Pacific and Atlantic bluefin tuna species were considered to be the same, or subspecies, and referred to as the "northern bluefin tuna".[5] This name occasionally gives rise to some confusion as the longtail tuna (Thunnus tonggol) can in Australia sometimes be known under the name "northern bluefin tuna".[6][7] This is also true in New Zealand and Fiji.

Bluefin tuna were often referred to as the common tunny, especially in the UK, Australia and New Zealand. The name tuna, a derivative of the Spanish atún, was widely adopted in California in the early 1900s and has since become accepted for all tunas, including the bluefin, throughout the English-speaking world. In some languages the bluefin's name refers to its red meat: atún rojo (Spanish), tonno rosso (Italian), amongst others.

Description

The body of the Atlantic bluefin tuna is rhomboidal in profile and robust. The head is conical and the mouth rather large. The head contains a "pineal window" that allows the fish to navigate over its multiple thousands of mile range.[8] The color is dark blue above and gray below with a gold coruscation covering the body and bright yellow caudal finlets. Bluefin tuna can be distinguished from other family members by the relatively short length of their pectoral fins. Their livers have a unique characteristic in that they are covered with blood vessels (striated). In other tunas with short pectoral fins, such vessels are either not present or present in small numbers along the edges.

Fully mature adult specimens average 2–2.5 metres (6 ft 7 in–8 ft 2 in) long. The species can reach a maximum length of almost 4.6 metres (15 ft).[9] The largest recorded specimen taken under International Game Fish Association rules was caught off Nova Scotia, an area renowned for huge Atlantic bluefin, by Ken Fraser and weighed 679 kilograms (1,500 lb). The longest contest between man and tuna fish occurred near Liverpool, Nova Scotia in 1934, when 6 men, taking turns, fought the 795 pounds (361 kg) tuna in a terrific battle that lasted sixty-two hours.[10]

Atlantic bluefin tuna reach maturity relatively quickly. In a survey that included specimens up to 2.55 metres (8 ft 4 in) in length and 247 kilograms (540 lb) in weight, none was believed to be older than 15 years.[11] However, very large specimens may, at least theoretically, be up to 50 years old.[11]

The bluefin possesses enormous muscular strength which it channels through a pair of tendons to its lunate shaped caudal fin. In contrast to many other fish, the body stays rigid while the tail flicks back and forth, increasing stroke efficiency.[12]

Thermoregulation

To keep its core muscles warm (used for power and steady swimming), the Atlantic bluefin uses countercurrent exchange to prevent heat from being lost to the surrounding water. The heat in the arterial blood transfers to the venous blood. This keeps the core muscles warm so they can function efficiently.[13]

All members of the tuna family are warm-blooded (have the ability to thermoregulate). This ability, however, is more highly developed in bluefin tuna than in any other fish, allowing them to seek food in the chilly waters of the north Atlantic.[8]

Circulation

Bluefin tuna have a very efficient circulatory system. It possesses one of the highest blood hemoglobin concentrations among fish, which allows them to efficiently deliver oxygen to their tissues; this is combined with their exceptionally thin blood-water barrier to ensure rapid oxygen uptake.[13]

Behavior

Bluefin dive to depths of 1,000 metres (550 fathoms).[14] They can reach speeds of 40 miles per hour (64 km/h).[8]

Diet and foraging

The Atlantic bluefin tuna typically hunts small fish and invertebrates such as sardines, herring, mackerel, squid and crustaceans.

Parasites

The tetraphyllidean tapeworm Pelichnibothrium speciosum parasitizes this species (Scholz et al. 1998). As the tapeworm's definite host is the blue shark which does not generally seem to feed on tuna[citation needed], it is likely that the Atlantic bluefin tuna is a dead-end host for P. speciosum.

Reproduction

Female bluefin are thought to produce up to 30 million eggs.

Atlantic bluefin tuna spawn in two widely separated areas. One spawning ground exists in the western Mediterranean, particularly in the area of the Balearic Islands. The other important spawning ground of the Atlantic bluefin is the Gulf of Mexico. Pop-up satellite tracking results appear to confirm in large measure the belief held by many scientists and fishermen that although bluefin that were spawned in each area may forage widely across the Atlantic, they return to the same area to spawn.

Atlantic bluefin group together in large concentrations to spawn, and at such times are highly vulnerable to commercial fishing. This is particularly so in the Mediterranean where the groups of spawning bluefin can be spotted from the air by light aircraft and purse seines directed to set around the schools.

The western and eastern populations of Atlantic bluefin tuna are thought to mature at different ages. It is thought that bluefin born in the east reach maturity a year or two earlier than those spawned in the west.[14]

Threats

Global appetites for fish, especially Japanese appetite for sushi, is the predominant threat to Atlantic bluefin. Bluefin aquaculture, which arose in response to declining wild stocks, has yet to achieve a sustainability, in part because it predominantly relies on harvesting and ranching juveniles rather than captive breeding.

The 2010 Gulf of Mexico oil spill may threaten the spawning grounds of the bluefin tuna.[15] Later assessments using models estimated that the population loss would not be significant, ranging from .4-4% of juveniles, which is within the range of annual variations.[16]

Sushi

The bluefin species are listed by the Monterey Bay Aquarium on its Seafood Watch list and pocket guides as fish to avoid due to overfishing.[17]

This tuna is one of the most highly-prized fish used in Japanese raw fish dishes. About 80% of the Atlantic and Pacific bluefin tunas are consumed in Japan.[18] Bluefin tuna sashimi is a particular delicacy in Japan. For example, an Atlantic bluefin caught off eastern United States sold for US$15,400 at the Tsukiji fish market in Tokyo in 2008.[19] This high price is considerably less than the highest prices paid for Pacific bluefin.[18][19] Prices were highest in the late 1970s and 1980s.[citation needed]

Japanese began eating tuna sushi in the 1840s, when a large catch came into Edo one season. A chef marinated a few pieces in soy sauce and served it as “nigiri sushi.” At that time these fish were nicknamed shibi — “four days” — because chefs would bury them for four days to mellow their bloody taste.[8]

Originally, fish with red flesh were looked down on in Japan as a low-class food, and white fish were much preferred....Fish with red flesh tended to spoil quickly and develop a noticeable stench, so in the days before refrigeration the Japanese aristocracy despised them, and this attitude was adopted by the citizens of Edo [old Tokyo]. - Michiyo Murata[8]

By the 1930s, tuna sushi was commonplace in Japan. After World War II Japanese fishermen needed more fish to eat and to export for European and U.S. canning industries. They expanded their ranged and perfected industrial long-lining, a practice that employs thousands of baited hooks on miles-long nets. In the 1970s Japanese manufacturers developed lightweight, high-strength polymers that were spun into drift nets. Though they were banned on the high seas by the early 1990s, in the 1970s hundreds of miles of them were often deployed in a single night. At-sea freezing technology then allowed them to bring frozen sushi-ready tuna from the farthest oceans to market after as long as a year.[8]

The initial target was yellowfin tuna. Japanese did not value bluefin before the 1960s. By the late 1960s, sportfishing for giant bluefin tuna was burgeoning off Nova Scotia, New England and Long Island. North Americans, too, had little appetite for bluefin, usually discarding them after taking a picture. Bluefin sportfishing’s rise, however, coincided with Japan’s export boom. In the 1960s and ’70s, Cargo planes were returning to Japan empty. A Japanese entrepreneur realized he could buy New England and Canadian bluefin cheaply, and started filling Japan-bound holds with tuna. Exposure to beef and other fatty meats during the U.S. occupation had prepared the Japanese palate for bluefin’s fatty belly (otoro). The Atlantic bluefin was the biggest and the favorite. The appreciation rebounded across the Pacific when Americans started to eat raw fish in the late 1970s.[8]

Prior to the 1960s, Atlantic bluefin fisheries were relatively small scale, and populations remained stable. Although some local stocks, such as those in the North Sea, were decimated by unrestricted commercial fishing, other populations were not at risk. However, in the 1960s purse seiners catching fish for the canned tuna market in United States coastal waters removed huge numbers of juvenile and young Western Atlantic bluefin, taking out several entire year classes. Mediterranean fisheries have historically been poorly regulated and catches under-reported, with French, Spanish, Italian fishermen competing with North African nations for a diminishing population.[citation needed] The fish's migratory habits complicate the task of regulating the fishery, because they spend time in the national waters of multiple countries as well as the open ocean outside of any national jurisdiction.[8]

Aquaculture

Tuna farming began as early as the 1970s. Canadian fishermen in St Mary's Bay[disambiguation needed ] captured young fish and raised them in pens. In captivity, they grow to reach hundreds of kilos, eventually fetching premium prices in Japan. Farming enables farmers to exploit the unpredictable supply of wild-caught fish. Ranches across the Mediterranean and off South Australia grow bluefin offshore. Annual revenues are $220 million. A large proportion of juvenile and young Mediterranean fish are taken to be grown on tuna farms. Because the tuna are taken from the wild to the pens before they are old enough to reproduce, farming is one of the most serious threats to the species.[citation needed] The bluefin's slow growth and late sexual maturity compound its problems. The Atlantic population has declined by nearly 90 percent since the 1970s.[20]

In Europe and Australia, scientists have used light-manipulation technology and time-release hormone implants to bring about the first large-scale captive spawning of Atlantic and southern bluefin.[8] The technology involves implanting gonadotropin-releasing hormone in the fish to stimulate fertile egg production and may push the fish to reach sexual maturity at younger ages.[21]

Since bluefin require so much food to add a pound of weight (10x that of salmon), if we farm bluefin at the level of twenty-first century salmon-farming, we may wipe out their prey species. As of 2010, 30 million tons of small forage fish were removed from the oceans yearly, with the majority of it going to feed farmed fish.[8]

Market entry by many North African Mediterranean countries, such as Tunisia and Libya in the 1990s, along with the increasingly widespread practice of tuna farming in the Mediterranean and other areas such as southern Australia (for southern bluefin tuna) depressed prices. One result is that fishermen must now catch up to twice as many fish to maintain their revenues.[citation needed]

Conservation

Capture of Atlantic bluefin tuna in tonnes from 1950 to 2009

Overfishing continues despite repeated warnings of the current precipitous decline. In 2007, researchers from the International Commission for the Conservation of Atlantic Tunas (ICCAT)—the regulators of Atlantic bluefin fishing—recommended a global quota of 15,000 tonnes to maintain current stocks or 10,000 tonnes to allow the fisheries recovery. ICCAT then chose a quota of 36,000 tonnes, however surveys indicated that up to 60,000 tonnes was actually being taken (1/3 of the total remaining stocks) and the limit was reduced to 22,500 tonnes. Their scientists now say that 7500 tonnes is the sustainable limit. In November, 2009 ICCAT set the 2010 quota at 13,500 tonnes and said that if stocks were not rebuilt by 2022 it would consider closing some areas.[4]

In 2010, Greenpeace International added the northern bluefin tuna to its seafood red list.[22]

On March 18, 2010 the United Nations rejected a U.S.-backed effort to impose a total ban on Atlantic Bluefin tuna fishing and trading.[23] The Convention on International Trade in Endangered Species (CITES) vote was 68 to 20 with 30 European abstentions. The leading opponent, Japan, claimed that ICCAT was the proper regulatory body.[4]

In 2011, the USA's National Oceanic and Atmospheric Administration (NOAA) decided not to list the Atlantic bluefin tuna as an endangered species. It is still considered a "species of concern," but NOAA officials claimed that the more stringent international fishing rules created in November 2010 would be enough for the Atlantic bluefin tuna to recover. NOAA agreed to reconsider the species endangered status in 2013.[24]

Culture

The Atlantic bluefin tuna is depicted on the reverse of the Croatian 2 kuna coin, minted since 1993.[25]

See also

Footnotes

  1. ^ Collette, B., Amorim, A.F., Boustany, A., Carpenter, K.E., de Oliveira Leite Jr., N., Di Natale, A., Die, D., Fox, W., Fredou, F.L., Graves, J., Viera Hazin, F.H., Hinton, M., Juan Jorda, M., Kada, O., Minte Vera, C., Miyabe, N., Nelson, R., Oxenford, H., Pollard, D., Restrepo, V., Schratwieser, J., Teixeira Lessa, R.P., Pires Ferreira Travassos, P.E. & Uozumi, Y. (2011). "Thunnus thynnus". IUCN Red List of Threatened Species. Version 2011.2. International Union for Conservation of Nature. http://www.iucnredlist.org/apps/redlist/details/21860. Retrieved 14 December 2011. 
  2. ^ "Endangered Atlantic bluefin tuna formally recommended for international trade ban". October 2009. http://www.wildlifeextra.com/go/news/bluefin-tuna938.html. Retrieved October 17, 2009. 
  3. ^ Jolly, David (February 3, 2010). "Europe Leans Toward Bluefin Trade Ban". NYTimes.com. http://www.nytimes.com/2010/02/04/world/europe/04tuna.html. 
  4. ^ a b c Jolly, David; Broder, John M. (March 18, 2010). "U.N. Rejects Export Ban on Atlantic Bluefin Tuna". New York Times. http://www.nytimes.com/2010/03/19/science/earth/19species.html?src=sch&pagewanted=all. Retrieved March 19, 2010. 
  5. ^ a b Collette, B.B. (1999). Mackerels, molecules, and morphology. In: Proceedings of the 5th Indo-Pacific Fish Conference, Noumea. pp. 149-164
  6. ^ Hutchins, B. & Swainston, R. (1986). Sea Fishes of Southern Australia. pp. 104 & 141. ISBN 1-86252-661-3
  7. ^ Allen, G. (1999). Marine Fishes of Tropical Australia and South-East Asia. p. 230. ISBN 0-7309-8363-3
  8. ^ a b c d e f g h i j Greenberg, Paul (27 June 2010). "Tuna's End". The New York Times: p. 28. http://www.nytimes.com/2010/06/27/magazine/27Tuna-t.html. 
  9. ^ Froese, Rainer, and Daniel Pauly, eds. (2011). "Thunnus thynnus" in FishBase. December 2011 version.
  10. ^ Johnston, Gordon (1973). It Happened in Canada. Scholastic. ASIN B000VUPG1M. 
  11. ^ a b Santamaria, N., G. Bello, A. Corriero, M. Deflorio, R. Vassallo-Agius, T. Bök, and G. De Metrio. 2009. Age and growth of Atlantic bluefin tuna, Thunnus thynnus (Osteichthyes: Thunnidae) in the Mediterranean Sea. J. Appl. Ichthyol. 25: 38-45.
  12. ^ Piper, Ross (2007), Extraordinary Animals: An Encyclopedia of Curious and Unusual Animals, Greenwood Press.
  13. ^ a b Hill, Richard W.; Gordon A. Wyse, Margaret Anderson (2004). Animal Physiology. Sinauer Associates, Inc.. ISBN 0-87893-315-8. 
  14. ^ a b Barbara A. Block, Heidi Dewar, Susanna B. Blackwell, Thomas D. Williams, Eric D. Prince, Charles J. Farwell, Andre Boustany, Steven L. H. Teo, Andrew Seitz, Andreas Walli, Douglas Fudge (17 AUGUST 2001). "Migratory Movements, Depth Preferences, and Thermal Biology of Atlantic Bluefin Tuna". Science 293. doi:10.1126/science.1061197. http://www.tunaresearch.org/reprints/migratory2001.pdf. Retrieved 12 September 2009. 
  15. ^ Steven Mufson (2010-04-27). "Gulf of Mexico oil spill creates environmental and political dilemmas". Washington Post. http://www.washingtonpost.com/wp-dyn/content/article/2010/04/26/AR2010042604308.html. Retrieved 2010-05-03. 
  16. ^ titanbite writes:. "Bluefin tuna probably OK after BP oil spill, fed agency says » Naples Daily News". Naplesnews.com. http://www.naplesnews.com/news/2011/dec/04/bp-oil-spill-bluefin-tuna-ok/?gulfdrilling=1. Retrieved 2012-02-13. 
  17. ^ Tuna, Bluefin - Seafood Watch
  18. ^ a b Washington Post (5 January 2011). Swank sushi: Bluefin tuna nets $736,000 at Tokyo auction, easily beating old record. Accessed 6 January 2011
  19. ^ a b MSNBC (1 January 2009). Premium tuna fetches $100,000 at auction. Accessed 6 January 2011
  20. ^ "Bluefin Tuna". Monterey Bay Aquarium. http://www.mbayaq.org/cr/SeafoodWatch/web/sfw_factsheet.aspx?fid=60. Retrieved February 2012.  }}
  21. ^ "Breeding the Overfished Bluefin Tuna". LiveScience. 2008-03-17. http://www.livescience.com/4862-breeding-overfished-bluefin-tuna.html. Retrieved 2012-02-13. 
  22. ^ "Greenpeace International Seafood Red list". Greenpeace.org. 2003-03-17. http://www.greenpeace.org/international/seafood/red-list-of-species. Retrieved 2010-04-13. 
  23. ^ Black, Richard (2010-03-18). "Bluefin tuna ban proposal meets rejection". BBC News. http://news.bbc.co.uk/2/hi/science/nature/8574775.stm. Retrieved 2010-04-13. 
  24. ^ Harris, Richard (27 May 2011). "Sorry, Charlie! Better Luck Next Time Getting Endangered Species Status". NPR. http://www.npr.org/blogs/health/2011/05/27/136719390/sorry-charlie-better-luck-next-time-getting-endangered-species-status. Retrieved 30 May 2011. 
  25. ^ Croatian National Bank. Kuna and Lipa, Coins of Croatia: 2 Kuna Coin. – Retrieved on 31 March 2009.

References

Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

 

Source: Wikipedia

Unreviewed

Article rating from 0 people

Average rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!