Articles on this page are available in 1 other language: Chinese (Simplified) (4) (learn more)

Overview

Comprehensive Description

Biology

Occurs in the vicinity of sand or rubble patches of exposed outer reef flats, lagoon reefs, and seaward reefs (Ref. 1602), often in semi-exposed surge zones (Ref. 48636). Adults solitary. Juveniles common in shallow tide pools (Ref. 30573). Feeds mainly on hard-shelled invertebrates including crustaceans, mollusks and sea urchins (Ref. 9823). Minimum depth reported from Ref. 27115. Randall (1999, Ref. 33411) question identity of specimens exceeding 70 cm.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Distribution

Range Description

This species is found from the Red Sea and East Africa in the west (Randall 1986) to the Line and Ducie Islands in the east, northward to southern Japan, southward to Lord Howe Island, Rapa Islands and also in Pohnpei (G. Allen unpublished survey).

Indo-Pacific distribution achieves its highest abundance on the Australian plate, especially in Western Australia (J.H. Choat pers. comm. 2008).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Indo-Pacific: Red Sea and East Africa (Ref. 4392) to the Line and Ducie islands, north to southern Japan, south to Lord Howe and Rapa islands.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Geographic Range

Coris aygula, the clown wrasse, is found primarily near Eastern Africa and Southern Asia. More specifically, they occupy areas near Comores, Madagascar, Cargados Carajos/St. Brandon’s Shoals, Aldabra, Sychelles, Maldives, as well as from the Chagos Archipelago to the Ducie Islands. They are also found in the area up to and including Southern Japan, Ryukyu, the Bonin and Ogawawara Islands, and South to the Lord Howe and Rapa Islands.

(Fricke, 1999; Shirai, 1986)

Biogeographic Regions: oriental (Native ); ethiopian (Native )

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Red Sea, Indo-West Pacific: East Africa, South Africa, Madagascar and Mascarenes east to Wake Atoll, Line Islands and Pitcairn Group, north to southern Japan and Ogasawara Islands, south to northwestern Australia, New South Wales (Australia), New Caledoni
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Physical Description

Morphology

Dorsal spines (total): 9; Dorsal soft rays (total): 12 - 13; Analspines: 3; Analsoft rays: 12
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Physical Description

C. aygula has 9 dorsal spines, between 12 and 13 dorsal soft rays, 3 anal spines, 14 pectoral rays, and 12 anal soft rays. The first two spines lie closer together than others. They also have between 59 and 67 lateral line scales. Males and females are slightly different. Males develop a hump on the forehead. The caudal fin of the famale is slightly more rounded than that of the male. Also, males have very long pelvic fins. Females have a white-colored streak in front of the anal fin. They also have light yellow or green coloring on the body with small, maroon spots and scales with dark edges, while males are blue-green in color. Onmales there are often broad, pale, green bars along the middle of the body. Juveniles have an extremely different appearance than adults. They are white and have black spots on each dorsal fin. They also have 2 circular orange/red spots on their back.

(Westneat, 2002; Shirai, 1986; Randall, 1990)

Range length: 120 (high) cm.

Other Physical Features: bilateral symmetry ; polymorphic

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Size

Maximum size: 1200 mm TL
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Max. size

120 cm TL (male/unsexed; (Ref. 5213))
  • Fischer, W., I. Sousa, C. Silva, A. de Freitas, J.M. Poutiers, W. Schneider, T.C. Borges, J.P. Feral and A. Massinga 1990 Fichas FAO de identificaçao de espécies para actividades de pesca. Guia de campo das espécies comerciais marinhas e de águas salobras de Moçambique. Publicaçao preparada em collaboraçao com o Instituto de Investigaçao Pesquiera de Moçambique, com financiamento do Projecto PNUD/FAO MOZ/86/030 e de NORAD. Roma, FAO. 1990. 424 p. (Ref. 5213)   http://www.fishbase.org/references/FBRefSummary.php?id=5213&speccode=151 External link.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Diagnostic Description

Description

Lives in the vicinity of sand or rubble patches of exposed outer reef flats, lagoon reefs, and seaward reefs (Ref. 1602). Juveniles are common in shallow coral reefs and lagoons. Solitary when adults. Feeds mainly on hard-shelled invertebrates including crustaceans, molluscs and sea urchins (Ref. 9823).
  • Anon. (1996). FishBase 96 [CD-ROM]. ICLARM: Los Baños, Philippines. 1 cd-rom pp.
Creative Commons Attribution 3.0 (CC BY 3.0)

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Caudal fin slightly rounded in females, truncate and with filamentous rays in large males; pelvic fins of males very long. Large males also become uniformly dark-green and develop a gibbus forehead and an elongate first dorsal spine (Ref. 1602). Juveniles distinct with the false eyes, shaded by orange (Ref. 48636).
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Ecology

Habitat

Habitat and Ecology

Habitat and Ecology
This species occurs in the vicinity of sand or rubble patches of exposed outer reef flats, lagoon reefs, and seaward reefs (Myers 1991), often in semi-exposed surge zones (Kuiter and Tonozuka 2001). Adults are solitary. Juveniles are common in shallow tide pools (Sommer et al. 1996). It feeds mainly on hard-shelled invertebrates including crustaceans, molluscs and sea urchins (Westneat 2001). Minimum depth reported of three m from Baensch and Debelius (1997). Randall (1999) questioned the identity of specimens exceeding 70 cm. Size recorded to 120 cm but this record is questionable. Largest size recorded from GBR was at 47.8 cm (FL).

It is a reef front species generally occurring on outer slopes of reefs to at least 45m (1-26m in Western Australia). Juveniles are found in shallow water of sheltered habitats. Maximum recorded age 16 yrs (J.H. Choat pers. comm.). It is a rare fast growing wrasses achieving large size by rapid growth of males (J.H. Choat pers. comm.) This species is probably protogynous but this needs confirmation.

Systems
  • Marine
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Environment

reef-associated; marine; depth range 2 - 30 m (Ref. 1602), usually 2 - 30 m (Ref. 27115)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

C. aygula is a marine reef-associated fish, inhabiting rocky reef and coral areas. It lives in depth from 2 to 30 meters. It is tropical fish requiring a temperature between 24 and 28 degrees Celsius.

(Westneat, 2002; Randall, 1990)

Range depth: 2 to 30 m.

Habitat Regions: tropical ; saltwater or marine

Aquatic Biomes: reef

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Depth range based on 29 specimens in 1 taxon.
Water temperature and chemistry ranges based on 24 samples.

Environmental ranges
  Depth range (m): 0.4575 - 51
  Temperature range (°C): 25.282 - 28.954
  Nitrate (umol/L): 0.043 - 1.018
  Salinity (PPS): 34.080 - 36.142
  Oxygen (ml/l): 4.483 - 4.757
  Phosphate (umol/l): 0.087 - 0.301
  Silicate (umol/l): 1.072 - 4.612

Graphical representation

Depth range (m): 0.4575 - 51

Temperature range (°C): 25.282 - 28.954

Nitrate (umol/L): 0.043 - 1.018

Salinity (PPS): 34.080 - 36.142

Oxygen (ml/l): 4.483 - 4.757

Phosphate (umol/l): 0.087 - 0.301

Silicate (umol/l): 1.072 - 4.612
 
Note: this information has not been validated. Check this *note*. Your feedback is most welcome.

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Depth: 2 - 30m.
From 2 to 30 meters.

Habitat: reef-associated. Occurs in the vicinity of sand or rubble patches of exposed outer reef flats, lagoon reefs, and seaward reefs (Ref. 1602). Adults solitary. Feeds mainly on hard-shelled invertebrates including crustaceans, molluscs and sea urchins (Ref. 9823).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Trophic Strategy

Occurs inshore (Ref. 75154).
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Food Habits

C. aygula eat shelled mollusks, hermit crabs, other crabs, and sea urchins.

(Randall 1990)

Animal Foods: mollusks; aquatic crustaceans

Primary Diet: carnivore (Eats non-insect arthropods, Molluscivore )

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Associations

Ecosystem Roles

C. aygula is eaten by large piscivores which also eat small fish-feeders, detritus-feeders, coral-feeders, and midwater piscivores. Therefore, C. aygula helps to sustain the large piscivore population inhabiting reefs. C. aygula also help to control the populations of those reef invertebrates at lower trophic levels. In turn, they allow the species that these animals feed on to survive.

(Lowe-McConnell, 1987; Randall, 1990)

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Predation

C. aygula is brightly colored, which may camoflauge it among the bright colors of its natural reef habitat.

(Lowe-McConnell 1987)

Known Predators:

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Known predators

Coris aygula is prey of:
Chondrichthyes
Serranidae
Carangidae
Lutjanidae
Sphyraena

This list may not be complete but is based on published studies.
Creative Commons Attribution 3.0 (CC BY 3.0)

© SPIRE project

Source: SPIRE

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Known prey organisms

Coris aygula preys on:
non-insect arthropods
Mollusca
Crustacea

This list may not be complete but is based on published studies.
Creative Commons Attribution 3.0 (CC BY 3.0)

© SPIRE project

Source: SPIRE

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Diseases and Parasites

Camallanus Disease. Parasitic infestations (protozoa, worms, etc.)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Bacterial Infections (general). Bacterial diseases
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Life History and Behavior

Behavior

Communication and Perception

C. aygula uses body coloration to signal either members of their own species or other species. This would not be possible without the extreme clarity of reef water. This subject is somewhat controversial, but the colors may be a warning signal or camouflauge against the reef.

(Lowe-McConnell 1987)

Communication Channels: visual

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Life Cycle

Development

Large C. aygula males change color and form as they develop. Juveniles start out with white coloration. There are orange or red colored spots on the back. Each dorsal fin has a large black spot. They eventually become a dark-green color, with less variation in color over the body. The first dorsal spine becomes elongated and a hump on the forehead becomes apparent.

(Westneat, 2002; Randall, 1990)

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Reproduction

When spawning, wrasses gather in loose aggregations where one dominant male oversees many females within a general territory. If the dominant male dies then usually the largest female will transform into the resident male.

(Thresher 1984)

C. aygula is a member of the wrasse family. Members of this family are protogynous hermaphrodites. This means that most members of the population begin life as females and some transform and function as males later. The differences between the primary males (born male) and secondary males (born female) are evident in the structure of the gonads, which are located in the upper sides of the abdominal cavity between the viscera and the coelomic wall. In primary males, the gonads are elongate, white, and solid with a small, tubular sperm duct extending posteriorly. This sperm duct extends to the urogenital opening. In secondary males, the gonads are hollow, short, thick, and yellowish because the gonads began as ovaries and later developed into testes. The secondary male testes have a large central space referred to as the lumen. The lumen has a ring of lobe-like projections around it. These are the ovarian lamellae. In females, when the eggs are ripe, they burst free from the lamellae and enter the lumen. They are then expelled through the urogenital opening.

Members of the wrasse family spawn along the outer edge of a reef patch. In more extensive reef complexes, fish will spawn along the outer slope.

(Thresher 1984)

Key Reproductive Features: iteroparous ; seasonal breeding ; sequential hermaphrodite (Protogynous ); sexual ; fertilization (External ); oviparous

Parental Investment: no parental involvement

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Statistics of barcoding coverage: Coris aygula

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 10
Specimens with Barcodes: 11
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Barcode data: Coris aygula

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 13 barcode sequences available from BOLD and GenBank.  Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

CACCCTTTATTTAGTATTCGGTGCCTGAGCCGGGATAGTGGGCACAGCTTTAAGTCTCCTCATTCGAGCTGAGCTGAGTCAACCCGGCGCACTCCTTGGAGACGACCAAATTTATAACGTAATCGTTACAGCCCACGCCTTCGTAATAATCTTCTTTATAGTAATACCAATTATGATTGGCGGGTTCGGAAACTGGCTAATTCCTTTAATAATTGGAGCGCCTGACATGGCCTTCCCTCGAATAAACAACATGAGCTTCTGGCTCTTGCCCCCTTCTTTCCTTCTTCTCCTTGCATCTTCTGGCGTAGAAGCAGGGGCTGGTACTGGTTGAACAGTTTACCCTCCTCTAGCAGGAAACCTCGCCCACGCGGGTGCATCCGTAGACCTCACTATTTTCTCTCTTCATTTGGCCGGTATTTCATCGATTCTAGGGGCAATTAACTTTATCACAACCATTATTAACATGAAACCTCCTGCCATTTCCCAGTATCAAACACCCCTCTTCGTCTGAGCTGTCCTAATTACAGCAGTACTACTCCTCCTCTCCCTGCCCGTCCTTGCTGCTGGCATTACAATGCTCCTCACAGACCGAAATTTAAATACCACCTTCTTCGACCCTGCAGGAGGAGGAGATCCCATCCTGTACCAACACCTA
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Conservation

Conservation Status

IUCN Red List Assessment


Red List Category
LC
Least Concern

Red List Criteria

Version
3.1

Year Assessed
2010

Assessor/s
Choat, J.H. & Pollard, D.

Reviewer/s
Sadovy, Y. & Carpenter, K.E.

Contributor/s

Justification
This species is a large widespread wrasse with a highly distinctive juvenile phase. As with all large wrasses, this species is relatively rare and never abundant in any part of its geographical range. Threats include collection of juvenilles for the aquarium trade and also fisheries, however, it is a very widely distributed species. It is listed as Least Concern. This species requires monitoring to assess its status under conditions of increased fishing in most coral reef environments.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

IUCN Red List of Threatened Species: least concern

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Population

Population
This is a common species although not always abundant. Abundance estimates (mean number per hectare) in Seychelles 0.3-0.5, Cocos Keeling 0.1-0.9, West Australia off shore 0.4-1.8 , GBR 0.4-0.9, and Coral Sea 0.33 with highest numbers on WA Offshore reefs (Rowley Shoals) (JH Choat pers. comm. 2008).

This is one of the large tropical wrasses with a broad geographic distribution. As with most of the other widely distributed tropical species, it is relatively rare in any particular locality (0.1-1.8 individuals per hectare) over much of its range and we do not have a very good handle on numbers or trends. For the large wrasses, wide-spread tropical species such as C.undulatus, C.aygula, L.maximus and possibly C.schoenleinii have been impacted by fisheries over much of their ranges.

Population Trend
Unknown
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Threats

Major Threats
Threats to this species include harvesting of juveniles for the aquarium trade (Wood 2001), artisanal and subsistence fishing in the Indo-Pacific.

For the large wrasses, wide spread tropical species, such as C. undulatus, C. aygula, L. maximus and possibly C. schoenleinii, have been impacted by fishing over much of their ranges. Threats must be considered in the context of local rarity but widespread distribution (J.H. Choat pers. comm. 2008).

This species consistently shows up in subsistence and recreational fisheries in Guam (every year since 1985 -2007), caught mainly by hook and line and spear (R. Myers pers. comm. 2008, Guam Division of Aquatic and Wildlife Resources data, unpublished annual reports).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Least Concern (LC)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Management

Conservation Actions

Conservation Actions
There are no specific conservation measures in place for this species. Its distribution overlaps several marine protected areas within its range.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Relevance to Humans and Ecosystems

Benefits

Importance

fisheries: minor commercial; gamefish: yes; aquarium: commercial; price category: very high; price reliability: very questionable: based on ex-vessel price for species in this family
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Economic Importance for Humans: Positive

C. aygula is a valuable and popular aquarium species. They are also considered to be a game fish.

(Randall, 1990, Westneat, 2002)

Positive Impacts: pet trade ; food

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Wikipedia

Clown coris

The clown coris, Coris aygula, is a species of wrasse native to the Indian Ocean and the western Pacific Ocean.

Description[edit]

This species can reach a total length of 120 cm (47 in). A marked difference in appearance is noted between juveniles and adults; juveniles are white and orange with false eyes on the dorsal fin, while adults are uniformly dark green or with light banding and developing a prominent forehead.[2]

Habitat[edit]

C. aygula is an inhabitant of coral reefs where they prefer areas of sand or rubble at depths from 2 to 30 m (6.6 to 98 ft). They are generally solitary as adults, while juveniles can often be found in tide pools.[2]

Distribution[edit]

This species can be found from the Red Sea and the African coast eastward to the Line Islands and Ducie Island and from southern Japan to Lord Howe Island.[2]

Synonyms[edit]

These specific names have been determined to be junior synonyms of C. aygula:[2]

References[edit]

  1. ^ Choat, J.H. & Pollard, D. 2010. Coris aygula. In: IUCN 2013. IUCN Red List of Threatened Species. Version 2013.1. <www.iucnredlist.org>. Downloaded on 05 November 2013.
  2. ^ a b c d Froese, Rainer and Pauly, Daniel, eds. (2013). "Coris aygula" in FishBase. August 2013 version.
Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

Source: Wikipedia

Unreviewed

Article rating from 0 people

Average rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!