Articles on this page are available in 1 other language: Dutch (1) (learn more)

Overview

Brief Summary

Three-spined sticklebacks can live in fresh as well as salt water. Most spend the winter in coastal waters or river mouths. They migrate in the spring to inland waters where they make a nest and lay eggs. The male has to work hard. He builds the nest, defends his territory against other males, lures the females with a complicated zigzag dance, fans the eggs with oxygen-rich water using his fins and protects the eggs and later the young sticklebacks with all its might from voracious predators.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© Copyright Ecomare

Source: Ecomare

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

The threespine stickleback (Gasterosteus aculeatus) is a species of fish in the family Gasterosteidae, which includes five genera and 15 other species. The threespine stickelback is small, between 4-6 cm, and is found in a circumpolar distribution that includes northern Europe, northern Asia and North America. It has also been introduced to central and southern Europe. Threespine sticklebacks are primarily and historically anadromous marine fish that feed on plankton for most of their adult lives in coastal waters and return to freshwater to mate and lay eggs. Threespine sticklebacks do not have scales, but have bony armor plates along their sides. In addition to the marine forms, threespine sticklebacks also exist in freshwater forms found in landlocked lakes. These many freshwater populations are thought to have derived from migratory anadromous G. aculeatus in many independent events, such as marine individuals permanently moving into a freshwater area or getting caught in land-locked lakes after the ice age, and subsequently adapting to an entirely freshwater existence. Freshwater threespine sticklebacks have notably reduced numbers of lateral armor plates as compared to marine populations and also show huge morphological diversity among different populations, so much that some populations living in the same lake do not interbreed. Gasterosteus aculeatus has contributed much to the study of species formation and are a research organism for evolutionary biologists and geneticists studying adaptation to new environments. Currently the IUCN (International Union for Conservation of Nature) recognizes three subspecies of threespine stickleback: Gasterosteus aculeatus aculeatus; G.a. williomsoni, the unarmored threespine stickeback; and G. a. santaeannae, the Santa Ana stickleback, but some taxonomists would classify the sticklebacks inhabiting isolated lakes into many more subspecies. Although the species itself is abundant and in no threat of extinction, various populations that represent specific diversity are in danger of local extirpation.

Froese and Pauly 2010; Hammerson et al 2012; Natureserve 2011; US Fish and Wildlife Service 2012; Wikipedia 4 January 2012; Wikipedia 6 February 2012)

Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

Supplier: Dana Campbell

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Comprehensive Description

Gasterosteus aculeatus ZBK Linnaeus, 1758

Inland water: 9500-613 (2 spc.), 26.05.1978 , Mert Lagoon , Kirklareli , N. Meriç ; 9500-170 (1 spc.), 26.05.1978 , Mert Lagoon , Kirklareli , N. Meriç .

  • Nurettin Meriç, Lütfiye Eryilmaz, Müfit Özulug (2007): A catalogue of the fishes held in the Istanbul University, Science Faculty, Hydrobiology Museum. Zootaxa 1472, 29-54: 41-41, URL:http://www.zoobank.org/urn:lsid:zoobank.org:pub:428F3980-C1B8-45FF-812E-0F4847AF6786
Public Domain

MagnoliaPress via Plazi

Source: Plazi.org

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Biology

Adults occur in fresh waters, estuaries and coastal seas (Ref. 4119). Anadromous, with numerous non-anadromous populations in brackish or pure freshwater, rarely in marine waters. In the sea, confined to coastal waters. In freshwater, adults prefer to live in small stream but may occur in a variety of habitats including lakes and large rivers (Ref. 59043). Inhabit shallow vegetated areas, usually over mud or sand (Ref. 5723). Form schools. Young associated with drifting seaweed (Ref. 12114, 12115). Juveniles move to the sea (anadromous populations) or to deeper, larger water bodies (freshwater populations) in July-August, forming large feeding schools (Ref. 59043). Feed on worms, crustaceans, larvae and adult aquatic insects, drowned aerial insects, and small fishes; has also been reported to feed on their own fry and eggs (Ref. 1998). Eggs are found in nests constructed from plant material (Ref. 41678). Males build, guard and aerate the nest where the eggs are deposited (Ref. 205). Maximum length in freshwater is 8 cm while in saltwater is 11 cm (Ref. 35388). Occasionally taken commercially in Scandinavia and processed into fishmeal and oil (Ref. 28219, 28964). Commonly used as a laboratory animal (Ref. 1998). A large bibliography is available at www.geocities.com/CapeCanaveral/Hall/1345/stickbibl.html.
  • Page, L.M. and B.M. Burr 2011 A field guide to freshwater fishes of North America north of Mexico. Boston : Houghton Mifflin Harcourt, 663p. (Ref. 86798)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Description

 A small torpedo-shaped fish with a slender tail and broad fan-like tail fin, usually 5-7 cm long but occasionally up to 10 cm in length. Two to four, usually three, sharp spines are born on its back in front of the dorsal fin. The first two spines are long and strong while the third is small. The pelvic fin is reduced to a single fin-ray and one sharp spine. The dorsal fin is longer than the anal fin. The sides bear a few bony plates, the number of plates increasing with increasing salinity. The body is greeny brown in colour, sometimes black dorsally and often bluish with silvery scales and belly in brackish waters.The three-spined stickleback breeds in early spring and summer. In the breeding season the males develop a bright orange to red colouration on the throat. The males build hollow nests from seaweeds and aquatic plants, into which they drive females to lay eggs that the males then guard until they hatch and the young leave the nest (see Wheeler, 1969; Dipper, 2001).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

©  The Marine Biological Association of the United Kingdom

Source: Marine Life Information Network

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Distribution

The threespine stickleback fish (Gasterosteus aculeatus) are in marine, brackish and coastal freshwater habitats of the northern hemisphere. They are found in boreal and temperate regions of the northern hemisphere and in marine waters and lowland freshwater habitats in the Atlantic and Pacific basins.

In the Atlantic Ocean, threespine sticklebacks are distributed from the Iberian Peninsula through the British Isles to Iceland and southern Greenland, and south along the east coast of North America to Chesapeake Bay. Freshwater populations are found throughout most of this range, but do not go farther south than Maine, USA. Freshwater populations are also distributed along the coast of the Mediterranean and in inland waters across Eastern Europe to the Baltic Sea.

In the Pacific Ocean, threespine sticklebacks are found from Baja California, Mexico northward along the coast of North America, across the Bering Strait, and then along the coast of mainland Asia and Japan to the southwest coast of Korea. Marine and freshwater populations are found in Japan, but the limit of marine populations in Asia is unclear. Freshwater populations are restricted to coastal areas in both Asia and North America.

Biogeographic Regions: nearctic (Native ); palearctic (Native ); atlantic ocean (Native ); pacific ocean (Native )

  • Baker, J., S. Foster, M. Bell. 1995. Armor morphology and reproductive output in threespine stickleback, Gasterosteus aculeatus. Environmental Biology of Fishes, 44: 225-233.
  • Bell, M., S. Foster, P. Bowne, D. Buth, T. Haglund, H. Guderley, R. Wootton, J. Baker, F. Whoriskey, G. FitzGerald, P. Hart, A. Gill, T. Reimchen, F. Huntingford, P. Wright, J. Tierney, W. Rowland, T. Bakker, J. McPhail. 1994. The Evolutionary Biology of the Threespine Stickleback. New York: Oxford University Press.
  • Cresko, W., K. McGuigan, P. Phillips, J. Postlethwait. 2007. Studies of threespine stickleback developmental evolution: progress and promise. Genetica, 129: 105-126.
  • Walker, J. 1997. Ecological morphology of lacustrine threespine stickleback Gasterosteus aculeatus L. Biological Journal of the Limnean Society, 61: 3-50.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Range Description

The range of Gasterosteus aculeatus encompasses the coastal waters of Eurasia, Iceland, eastern Asia and Northern America. In North America, this fish ranges from Alaska to Baja California on the west coast, from Baffin Island and the west side of Hudson Bay to Chesapeake Bay, Virginia, along east coast, and it occurs also in inland areas (including Lake Ontario) along both coasts. Sometimes this species occurs in the open ocean. This species has been introduced and is established in certain areas of California, Massachusetts, and the Great Lakes (Lakes Huron, Michigan, Erie and Superior) (Fuller et al. 1999; Stephenson and Momot 2000). In Eurasia it is found along North Sea coasts of Scotland and Scandinavia; coasts of Iceland and White Sea; Atlantic coasts from Ireland northward; southeastern shore of Baltic Sea and its basin (Odra and Vistula drainages); shores of Black Sea and its northern basin (from Danube to Kuban drainages). Almost absent inland in Finland, except north of 68°N. There is a hybrid zone with G. gymnurus in the English Channel, southern North Sea, Baltic Sea and their basins. It has been introduced to northern Italy.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

occurs (regularly, as a native taxon) in multiple nations

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

National Distribution

Canada

Origin: Native

Regularity: Regularly occurring

Currently: Present

Confidence: Confident

Type of Residency: Year-round

United States

Origin: Native

Regularity: Regularly occurring

Currently: Present

Confidence: Confident

Type of Residency: Year-round

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Global Range: (>2,500,000 square km (greater than 1,000,000 square miles)) Range encompasses coastal waters of Eurasia, Iceland, Greenland, eastern Asia, and North America. In North America, this fish ranges from Alaska to Baja California on the west coast, from Baffin Island and the west side of Hudson Bay to Chesapeake Bay, Virginia, along east coast, and it occurs also in inland areas (including Lake Ontario) along both coasts. Sometimes it occurs in the open ocean. The species has been introduced and is established in certain areas of California, Massachusetts, and the Great Lakes (lakes Huron, Michigan, Erie, and Superior) (Fuller et al. 1999, Stephenson and Momot 2000). It also has been introduced in Europe, Iceland, Greenland, and the Pacific coast of Asia (Page and Burr 2011).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Circumarctic and temperate regions: Extending south to the Black Sea, southern Italy, Iberian Peninsula, North Africa; in Eastern Asia north of Japan (35°N), in North America north of 30-32°N; Greenland.
  • Monod, T. 1979 Gasterosteidae. p. 280-286. In J. C. Hureau and Th. Monod (eds.) Check-list of the Fishes of the north-eastern Atlantic and of the Mediterranean (CLOFNAM). UNESCO, Paris. Vol. 1. (Ref. 12841)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Atlantic, Baltic Sea, North Sea, Mediterranean Sea, Black Sea and adjacent watersheds: Widespread in northern Europe and North America.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Physical Description

Morphology

Physical description varies widely with age and habitat. In general, threespine sticklebacks tend to be streamlined and less than 10 cm long (usually from 3 to 8 cm). Freshwater populations vary in body shape, depending on the habitat they occupy. Limnetic ecotypes tend to have slender bodies with narrow mouths, long snouts, and large eyes. Benthic ecotypes tend to be deep-bodied, with a wide, terminal gape.

The fish can have a robust set of spines, a pelvic girdle, and numerous lateral bony plates (up to thirty or more on each side), but the extent of these features varies by population. Dorsal and pelvic spines vary in number, placement, and length, and the spines tend to be longer in populations that co-occur with predatory fishes. The pelvic girdle consists of a bilateral structure with an anterior process that has an ascending branch on each side, a posterior process and a spine and fin ray. The abdomen is ringed in bony armor. Marine fish almost always possess a fully developed pelvic girdle and a full complement of bony lateral plates. However, many freshwater populations have reduced armor plates and pelvic girdles, and some populations have lost these features entirely.

Although body color also varies among populations, threespine sticklebacks are generally cryptic, with brown-to-green barring above and paler coloring below. As males approach reproductive condition, they become less cryptic, and their eyes become an iridescent blue. In some populations, red coloration may expand onto the flanks behind the pectoral fin.

Range length: 3 to 8 cm.

Average length: 5 cm.

Other Physical Features: ectothermic ; heterothermic ; bilateral symmetry

Sexual Dimorphism: sexes alike; sexes colored or patterned differently; male more colorful

  • Day, T., J. Pritchard, D. Schluter. 1994. A comparison of two sticklebacks. Evolution, 48/5: 1723-1734.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Dorsal spines (total): 2 - 4; Dorsal soft rays (total): 10 - 14; Analspines: 1; Analsoft rays: 8 - 10; Vertebrae: 29 - 33
  • Banister, K. 1986 Gasterosteidae. p. 640-643. In P.J.P. Whitehead, M.-L. Bauchot, J.-C. Hureau, J. Nielsen and E. Tortonese (eds.) Fishes of the north-eastern Atlantic and the Mediterranean. volume 2. UNESCO, Paris. (Ref. 4119)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Size

Length: 10 cm

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Maximum size: 102 mm ---
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Max. size

11.0 cm TL (male/unsexed; (Ref. 35388)); max. reported age: 8 years (Ref. 72489)
  • Muus, B.J. and J.G. Nielsen 1999 Sea fish. Scandinavian Fishing Year Book, Hedehusene, Denmark. 340 p. (Ref. 35388)
  • Reimchen, T.E. 1992 Extended longevity in a large-bodied stickleback, Gasterosteus, population. Canadian Field Naturalist 106:129-131. (Ref. 72489)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Diagnostic Description

Differs from other sticklebacks in having fewer dorsal spines (usually 3 vs. 4 or more).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Distinguished uniquely from its congeners in Europe by having trunk and caudal peduncle covered by a complete series of 29-35 bony scutes. Other characters important to separate this species from other species of the genus include posterior edge of scutes crenulated and scutes forming a lateral keel on caudal peduncle. Scutes may be missing on posterior part of trunk in hybrid zone with Gasterosteus gymnurus and in some isolated freshwater populations of northeastern Europe (Ref. 59043). Identified by the 3 to 4 sharp, free spines before the dorsal fin, the pelvic fin reduced to a sharp spine and a small ray, and the series of plates along the sides of the body (Ref. 27547). Gill rakers long and slender, 17 to 25 on the first arch or strictly freshwater forms, 1 or 2 more in anadromous forms; lateral line with microscopic pores (Ref. 27547). The anadromous form is fully plated, with up to 37 plates on the sides and a rather pronounced keel on each side of the caudal peduncle (Ref. 27547). Dorsal spines separated from each other and from the soft-rayed fins, each spine having a reduced membrane attached to its posterior side; anal spine free from rest of the fin; posterior margin of pectorals nearly truncate; caudal truncate to slightly indented (Ref. 27547). Freshwater forms usually mottled brown or greenish; anadromous forms silvery green to bluish black (Ref. 27547). A few isolated populations are black (Ref. 27547). Sides usually pale; belly yellow, white or silvery (Ref. 27547). Fins pale; pectoral rays often have dark dots (Ref. 27547). Breeding males (except for black forms) become brilliant bluish or green with blue or green eyes, and the forward part of the body, especially the breast region, turns bright red or orange (Ref. 27547). Caudal fin with 12 rays (Ref. 2196).
  • Banister, K. 1986 Gasterosteidae. p. 640-643. In P.J.P. Whitehead, M.-L. Bauchot, J.-C. Hureau, J. Nielsen and E. Tortonese (eds.) Fishes of the north-eastern Atlantic and the Mediterranean. volume 2. UNESCO, Paris. (Ref. 4119)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Ecology

Habitat

Gasterosteus aculeatus occupy a wide range of habitats. They have been found in small, ephemeral streams in southern California and in more permanent flowing waters of variable sizes. These fish do not tolerate high-gradient streams, and they are rarely found in habitats more than a few hundred meters above sea level. In freshwater lakes, they are divided into benthic and limnetic ecotypes. Benthic environments include shallow, relatively eutrophic lakes or the littoral zone of deeper lakes. Limnetic ecotypes are typically found in the water column of deep oligotrophic lakes. Marine fish inhabit the open ocean.

Habitat Regions: temperate ; saltwater or marine ; freshwater

Aquatic Biomes: pelagic ; benthic ; lakes and ponds; rivers and streams; coastal ; brackish water

Other Habitat Features: estuarine ; intertidal or littoral

  • Mattern, M., D. Kingsley, C. Peichel, J. Boughman, F. Huntingford, S. Coyle, S. Ostlund-Nilsson, D. McLennan, B. Borg, I. Mayer, M. Pall, I. Barber, I. Katsiadaki. 2007. Biology of the three-spined stickleback. Boca Raton: CRC Press.
  • Shaw, K., M. Scotti, S. Foster. 2007. Ancestral plasticity and the evolutionary diversification of courtship behavior in threespine sticklebacks. Animal Behaviour, 73: 415-422.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Habitat and Ecology

Habitat and Ecology
This species is typically found in quiet weedy pools and backwaters. It is also found in the marginal vegetation of streams, over sand and mud bottom substrates. Marine populations are pelagic, and usually found inshore along the coast, in estuaries and coastal lagoons. In some lakes, two morphologically and ecologically distinct forms may occur, differing in habitat (one littoral, the other mainly limnetic). Eggs are deposited in freshwater in a nest of plant material made by the male on the bottom in shallow water. The female will typically lay a few hundred eggs and may lay eggs in several nests over a period of several days (Morrow 1980).

Anadromous, with numerous resident populations in brackish or pure freshwater, rarely in marine waters. Usually forages at sea until two years old, then moves to lower part of rivers in March-April to reproduce. Freshwater populations usually spawn for the first time at one year. In spawning season, males develop a bright orange to red belly and blue-green flank and eyes. They defend territories, in which in April-June they construct a nest on the bottom, in relatively shallow areas, very rarely attached to plants. They make a depression up to 14 × 10 cm to which they bring plant materials (especially filamentous algae), which are glued together with kidney secretions. Several females are individually led to the nest to spawn, then chased away. Males guard and fan eggs to provide them with oxygenated water. Spawning behaviour is very stereotyped. Eggs hatch in 7-8 days and juveniles are guarded for a few days after which male abandons the nest. Anadromous individuals usually die of exhaustion after spawning cycle while freshwater individuals are able to complete several cycles within one year or sometimes over several years. Juveniles move to sea (anadromous populations) or to deeper, larger water bodies (freshwater populations) in July-August where they form large feeding schools. Feeds on small aquatic invertebrates, especially insects and crustaceans.

Systems
  • Freshwater
  • Marine
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Habitat Type: Freshwater

Comments: In freshwater areas, this fish typically inhabits quiet weedy pools and backwaters, or occurs among emergent plants at stream edges, over bottoms of sand and mud (Lee et al. 1980, Page and Burr 2011). Marine populations apparently are pelagic, usually staying close to shore. In some lakes, two morphologically and ecologically distinct forms may occur, differing in habitat (one littoral, the other mainly limnetic). Eggs are deposited in freshwater in a nest of plant material made by the male on the bottom in shallow water.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Environment

benthopelagic; anadromous (Ref. 51243); freshwater; brackish; marine; depth range 0 - 100 m (Ref. 50550)
  • Fedorov, V.V., I.A. Chereshnev, M.V. Nazarkin, A.V. Shestakov and V.V. Volobuev 2003 Catalog of marine and freswater fishes of the northern part of the Sea of Okhotsk. Vladivostok: Dalnauka, 2003. 204 p. (Ref. 50550)
  • Riede, K. 2004 Global register of migratory species - from global to regional scales. Final Report of the R&D-Projekt 808 05 081. Federal Agency for Nature Conservation, Bonn, Germany. 329 p. (Ref. 51243)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Depth range based on 1382 specimens in 2 taxa.
Water temperature and chemistry ranges based on 631 samples.

Environmental ranges
  Depth range (m): -9 - 323
  Temperature range (°C): -0.481 - 13.162
  Nitrate (umol/L): 1.139 - 22.184
  Salinity (PPS): 6.180 - 35.270
  Oxygen (ml/l): 0.573 - 8.164
  Phosphate (umol/l): 0.252 - 3.328
  Silicate (umol/l): 1.984 - 72.643

Graphical representation

Depth range (m): -9 - 323

Temperature range (°C): -0.481 - 13.162

Nitrate (umol/L): 1.139 - 22.184

Salinity (PPS): 6.180 - 35.270

Oxygen (ml/l): 0.573 - 8.164

Phosphate (umol/l): 0.252 - 3.328

Silicate (umol/l): 1.984 - 72.643
 
Note: this information has not been validated. Check this *note*. Your feedback is most welcome.

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

 Found in shallow waters amongst seaweeds, seagrasses and pondweeds in freshwater, estuaries, rock pools and saline lagoons or coastal waters.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

©  The Marine Biological Association of the United Kingdom

Source: Marine Life Information Network

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Depth: 0 - 27m.
Recorded at 27 meters.

Habitat: benthopelagic. Inhabits vegetated areas, usually over mud or sand (Ref. 5723). In the sea, confined to coastal waters. Forms schools. Juveniles associate with drifting seaweed (Ref. 12114, 12115). Feeds on worms, crustaceans, larvae and adult aquatic insects, drowned aerial insects, and small fishes; has also been reported to feed on their own fry and eggs (Ref. 1998). Eaten by fishes, seals and sea birds (Ref. 2850). Used as a laboratory animal (Ref. 1998).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Migration

Non-Migrant: Yes. At least some populations of this species do not make significant seasonal migrations. Juvenile dispersal is not considered a migration.

Locally Migrant: Yes. At least some populations of this species make local extended movements (generally less than 200 km) at particular times of the year (e.g., to breeding or wintering grounds, to hibernation sites).

Locally Migrant: No. No populations of this species make annual migrations of over 200 km.

Salt water populations migrate into freshwater for spawning (Moyle 1976).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Anadromous. Fish that ascend rivers to spawn, as salmon and hilsa do. Sub-division of diadromous. Migrations should be cyclical and predictable and cover more than 100 km.
  • Riede, K. 2004 Global register of migratory species - from global to regional scales. Final Report of the R&D-Projekt 808 05 081. Federal Agency for Nature Conservation, Bonn, Germany. 329 p. (Ref. 51243)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Trophic Strategy

Threespine sticklebacks are generalist carnivores and prey on limnetic and littoral invertebrates. Limnetic ecotypes in lentic environments feed on zooplankton, while benthic ecotypes feed on bottom-dwelling invertebrates in the littoral zone. Common benthic prey items include crustaceans (Amphipoda) and larval insects (Chironomidae). Threespine stickleback exhibit a predation cycle that consists of search, pursuit, attack, and capture components.

Animal Foods: eggs; insects; aquatic or marine worms; aquatic crustaceans; zooplankton

Foraging Behavior: stores or caches food

Primary Diet: carnivore (Insectivore , Eats non-insect arthropods, Vermivore); planktivore

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Shoaling species outside the breeding season, especially when young. Inhabits vegetated areas, usually over mud or sand (Ref. 5723). In the sea, confined to coastal waters. Forms schools. Eggs are found in nests constructed from plant material (Ref. 41678). Anadromous and nerito-pelagic (Ref. 58426). Feeds on worms, crustaceans, larvae and adult aquatic insects, drowned aerial insects, and small fishes; has also been reported to feed on their own fry and eggs (Ref. 1998). Length in freshwater is 8 cm while in saltwater is 11 cm (Ref. 35388). Preyed upon by American mergansers.
  • Banister, K. 1986 Gasterosteidae. p. 640-643. In P.J.P. Whitehead, M.-L. Bauchot, J.-C. Hureau, J. Nielsen and E. Tortonese (eds.) Fishes of the north-eastern Atlantic and the Mediterranean. volume 2. UNESCO, Paris. (Ref. 4119)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Partner Web Site: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Comments: Eats various invertebrates and fish eggs and fry. Freshwater populations feed primarily on bottom organisms or organisms living on aquatic plants (limnetic form in some lakes feeds mainly on plankton). Anadromous populations feed more on free-swimming crustaceans, also bottom organisms.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Associations

Threespine sticklebacks have many predators and are thus an important source of food for many different animals. They also act as predators for benthic invertebrates, such as amphipods and insect larvae.

Commensal/Parasitic Species:

  • Ward, A., A. Duff, J. Krause, I. Barber. 2005. Shoaling behaviour of sticklebacks infected with the microsporidian parasite, Glugea anomala. Environmental Biology of Fishes, 72/2: 155-160.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Threespine sticklebacks are small, abundant, and slow swimmers, all of which combine to make them suitable prey for many different predators. However, they have evolved several predator defenses in their morphology and behavior. Anti-predator morphology includes dorsal spines, bony lateral plates, and a pelvic girdle that consists of a pair of anterior processes with ascending branches, posterior processes and pelvic spines. Behavioral responses to predation risk include schooling, remaining close to protective cover, and predator inspection. Anti-predator morphology and behaviors tend to be more well-developed in fish from environments that contain predators.

Known predators of threespine sticklebacks include fish in the families Percidae, Esocidae, and Salmonidae. Some lakes in Alaska and British Columbia have been stocked with rainbow trout (Oncorhynchus mykiss) and silver salmon (Oncorhynchus kisutch) for game, and these fish prey on sticklebacks in those lakes. Avian piscivores that prey on stickleback fish include loons (Gaviiformes), grebes (Podicipediformes), the common merganser (Mergus merganser), herons (Ardeidae), and kingfishers (Alcedinidae). Piscivorous macroinvertebrates, such as dragonfly naiads (Odonata) and beetles (Coleoptera) feed on eggs, fry and juvenile sticklebacks. Leeches (Hirudinea) prey on stickleback eggs and have also been found to consume adult sticklebacks stuck in traps.

Known Predators:

Anti-predator Adaptations: cryptic

  • Grand, T. 2000. Risk-taking by threespine stickleback (Gasterosteus aculeatus) pelvic phenotypes: does morphology predict behavior?. Behaviour, 137: 889-906.
  • Marchinko, K. 2008. Predation's role in repeated phenotypic and genetic divergence of armor in threespine stickleback. Evolution, 63/1: 127-138.
  • Messler, A., M. Wund, B. John, S. Foster. 2007. The effects of relaxed and reversed selection by predators on the antipredator behavior of the threespine stickleback, Gasterosteus aculeatus. Ethology, 113: 853-863.
  • Reimchen, T. 2000. Predator handling failures of lateral plate morphs in Gasterosteus aculeatus: functional implications for the ancestral plate condition. Behaviour, 137: 1081-1096.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

In Great Britain and/or Ireland:
Animal / parasite / endoparasite
Acanthocephalus clavula endoparasitises anterior intestine of Gasterosteus aculeatus

Animal / parasite / ectoparasite
Argulus foliaceus ectoparasitises scale of Gasterosteus aculeatus

Animal / parasite / ectoparasite
fluke of Dactylogyrus ectoparasitises skin of Gasterosteus aculeatus

Animal / parasite / endoparasite
metacercarium of Diplostomum endoparasitises vitreous humour of Gasterosteus aculeatus

Animal / parasite / endoparasite
metacaria (diplostomula) of Diplostomum gasterostei endoparasitises retina of Gasterosteus aculeatus
Other: major host/prey

Animal / parasite / endoparasite
Echinorhynchus clavula endoparasitises intestine of Gasterosteus aculeatus

Animal / parasite / ectoparasite
colony of Glugea anomala ectoparasitises white cysted skin of Gasterosteus aculeatus

Animal / parasite / ectoparasite
fluke of Gyrodactylus ectoparasitises skin of Gasterosteus aculeatus

Animal / parasite / ectoparasite
colony of Ichthyophthirius multifilis ectoparasitises white spotted skin of Gasterosteus aculeatus

Animal / parasite / endoparasite
Neoechinorhynchus rutili endoparasitises intestine of Gasterosteus aculeatus

Animal / parasite / ectoparasite
tapeworm of Proteocephalus filicollis ectoparasitises intestine of Gasterosteus aculeatus

Animal / parasite / ectoparasite
plerocercoid of Schistocephalus solidus ectoparasitises distended body cavity of Gasterosteus aculeatus

Animal / parasite / ectoparasite
colony of Trichodina ectoparasitises skin of Gasterosteus aculeatus
Other: minor host/prey

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Known predators

Gasterosteus aculeatus (Gasterosteus aculeatus 3-spined stickleback) is prey of:
Esocidae
Podocotyle staffordi
Hysterothylacium aduncum

Based on studies in:
England, River Cam (River)
Scotland (Estuarine)

This list may not be complete but is based on published studies.
  • Huxham M, Beany S, Raffaelli D (1996) Do parasites reduce the chances of triangulation in a real food web? Oikos 76:284–300
  • P. H. T. Hartley, Food and feeding relationships in a community of fresh-water fishes, J. Anim. Ecol. 17(1):1-14, from p. 12 (1948).
Creative Commons Attribution 3.0 (CC BY 3.0)

© SPIRE project

Source: SPIRE

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Known prey organisms

Gasterosteus aculeatus (Gasterosteus aculeatus 3-spined stickleback) preys on:
plant fragments
Chironomidae
Trichoptera
Gobio gobio
Crangon crangon
Ostracoda
Balanus balanoides
Corophium volutator
Gammarus
Hydrobia ulvae

Based on studies in:
England, River Cam (River)
Scotland (Estuarine)

This list may not be complete but is based on published studies.
  • Hall SJ, Raffaelli D (1991) Food-web patterns: lessons from a species-rich web. J Anim Ecol 60:823–842
  • Huxham M, Beany S, Raffaelli D (1996) Do parasites reduce the chances of triangulation in a real food web? Oikos 76:284–300
  • P. H. T. Hartley, Food and feeding relationships in a community of fresh-water fishes, J. Anim. Ecol. 17(1):1-14, from p. 12 (1948).
Creative Commons Attribution 3.0 (CC BY 3.0)

© SPIRE project

Source: SPIRE

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Population Biology

Number of Occurrences

Note: For many non-migratory species, occurrences are roughly equivalent to populations.

Estimated Number of Occurrences: > 300

Comments: This species is represented by a very large number of occurrences (subpopulations).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Global Abundance

>1,000,000 individuals

Comments: Total adult population size is unknown but presumably exceeds 1,000,000. This fish is common and locally abundant in many areas. However, several unique populations have declined to very low levels of abundance including G. a. williamsoni (unarmored form from southern California) and 4 species pairs in British Columbia, one of which is now extinct (Hadley Lake, Lasqueti Island, B.C.; Hatfield 2001a, Wood 2003).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

General Ecology

Forms loose schools except when spawning (Moyle 1976).

Available density estimates include 7-28 fish/m² in suitable habitat in Wales, 24-63 fish/m² in northwestern England, 2 fish/m² in Kamchatka, Russia, and 4-21 fish/m² in British Columbia (see sources in Wootton and Smith 2000).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Life History and Behavior

Behavior

Threespine sticklebacks rely on visual cues for mating behavior. Females tend to be attracted to more reddish coloring of males during mating seasons. They also use olfactory signals to detect the presence of conspecifics, prey, and predators. Like many other fish, threespine sticklebacks use alarm cues to avoid predation and sex pheromones during breeding. Lab-raised sticklebacks have been found to rely heavily on olfactory cues of kinship, habitat and diet, and shoal size. However, the sensory organs and pathways utilized in this communication are not well understood.

Communication Channels: visual ; chemical

Other Communication Modes: pheromones

Perception Channels: visual ; tactile ; chemical

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Life Cycle

Once eggs are fertilized, they take between 5 and 10 days to hatch, depending on the temperature of the water. Upon hatching, threespine stickleback larvae are about 4 mm in length. The larvae will continue to grow by absorption of the yolk, which they will completely consume about four days after hatching. Approximately nine days after hatching, the larvae reach a length of about 8 mm and assume the shape of the adult fish. This is the juvenile stage, in which the immature young become independent of their father. Juveniles become adults when they reach sexual maturity, which is usually within 1 to 2 years of hatching.

  • Swarup, H. 1958. Stages in the development of the stickleback Gasterosteus aculeatus. Development, 6: 373-383.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Spawning behavior is similar for both freshwater and anadromous forms (Ref. 28966). Just before breeding, males become very territorial. The male builds a nest of plant-material glued together with spiggin, a protein produced in the kidney (Ref. 52349). Once a nest is built, the male entices the female into the nest by performing a courtship dance which is a series of zigzag movements (Ref. 1998). A receptive female follows the male who points the opening of the nest by posing above it with his head down. The female enters the nest, deposits up to a few hundred eggs, and is driven out by the male after eggs have been deposited. The male then enters the nest to fertilize the eggs. The male can choose to court another female to enter the nest and lay eggs before entering himself to fertilise the deposited eggs. Females may lay eggs in several nests over a period of several days or may be courted by the same male (Ref. 27547). The male guards and ventilates the eggs and young (Ref. 1998). During spawning season, males develop a bright orange to red belly and blue-green flank and eyes. Eggs hatch in 7-8 days. Anadromous forms usually die of exhaustion after spawning cycle. Freshwater individuals are able to complete several cycles within one year or sometimes over several years (Ref. 59043).
  • Balon, E.K. 1990 Epigenesis of an epigeneticist: the development of some alternative concepts on the early ontogeny and evolution of fishes. Guelph Ichthyol. Rev. 1:1-48.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Life Expectancy

Lifespans of threespine sticklebacks have been recorded in a large number of studies, but the results vary. A definitive pattern for the lifespan has not been determined. Threespine sticklebacks can live to approximately five years in the laboratory. One individual reached eight years of age in captivity.

Range lifespan

Status: captivity:
8 (high) years.

Average lifespan

Status: captivity:
5 years.

Average lifespan

Status: captivity:
5 years.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Lifespan, longevity, and ageing

Maximum longevity: 8 years (wild)
Creative Commons Attribution 3.0 (CC BY 3.0)

© Joao Pedro de Magalhaes

Source: AnAge

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Reproduction

Prior to the onset of breeding, males will develop a reproductive phenotype, including blue eyes, red throats, and red fore-bellies. During the breeding season, a male will leave the shoal and settle on the bottom in shallow water, where he will construct a nest and establish a territory. The males are are generally not monogamous, and a male often tries to lead numerous females into his nest to lay eggs. Afterward, he will fertilize all the eggs at once.

Males attract females with zig-zag-like courtship dances, and females respond with a form of dancing, as well as a "head-up" posture. The male will then lead the female to his nest, lying on the substrate next to the entrance to signify that she may enter and lay her eggs. Females lay their eggs in the male’s nest and then leave the male alone to attend to the eggs until they hatch. Once eggs are fertilized, they may take five to ten days to hatch, depending on the temperature of the water. The male nesting cycle consists of a sexual phase for 1 to 4 days, and then a parental phase after the eggs are fertilized.

Mating System: polygynous

Threespine sticklebacks breed in sloughs, ponds, rivers, lakes, drainage canals, marshes, tidal creeks and sublittoral zones of the sea. Individuals reach sexual maturity at between 1 and 2 years of age, and breeding occurs annually from late April to July.

Breeding interval: Threespine stickleback generally breed once yearly

Breeding season: late April to July

Range gestation period: 5 to 10 days.

Average time to independence: 2 weeks.

Range age at sexual or reproductive maturity (female): 1 to 2 years.

Range age at sexual or reproductive maturity (male): 1 to 2 years.

Key Reproductive Features: iteroparous ; seasonal breeding ; gonochoric/gonochoristic/dioecious (sexes separate); sexual ; fertilization (External ); oviparous

Once males shift to their parental phase, they provide all the care for their young. This includes fanning eggs with their pectoral fins to provide oxygen for the developing embryos and protecting them from predators. They also convert the nest into a nest pit, which consists of tangled vegetation where newly hatched fry can hide and rest. The males typically defend the fry up to two weeks after hatching. Paternal care has been identified as an important social factor in threespine stickleback development and learning. Sticklebacks with no paternal contact tend to fail avoiding predators later in life. These anti-predator behaviors may be stimulated at an early age as stickleback fathers chase and catch their fry when they first emerge from the nest.

Parental Investment: male parental care ; pre-hatching/birth (Provisioning: Male, Protecting: Male); pre-weaning/fledging (Provisioning: Male, Protecting: Male); pre-independence (Provisioning: Male, Protecting: Male)

  • Bell, M., S. Foster, P. Bowne, D. Buth, T. Haglund, H. Guderley, R. Wootton, J. Baker, F. Whoriskey, G. FitzGerald, P. Hart, A. Gill, T. Reimchen, F. Huntingford, P. Wright, J. Tierney, W. Rowland, T. Bakker, J. McPhail. 1994. The Evolutionary Biology of the Threespine Stickleback. New York: Oxford University Press.
  • Huntingford, F., P. Wright. 1993. Behavioral Ecology of Fishes. Switzerland: Harwood Academic Press.
  • Mattern, M., D. Kingsley, C. Peichel, J. Boughman, F. Huntingford, S. Coyle, S. Ostlund-Nilsson, D. McLennan, B. Borg, I. Mayer, M. Pall, I. Barber, I. Katsiadaki. 2007. Biology of the three-spined stickleback. Boca Raton: CRC Press.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Spawns in spring and summer. In most populations, most adults are 1-2 years old, do not live beyond 4 years, and presumably die at the end of their first breeding season. Reimchen (1992) described a population in Drizzle Lake, Queen Charlotte Islands, British Columbia, in which individuals lived up to 8 years. Male guards eggs and fry. Eggs hatch in about a week. Nest may contain eggs of several females.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Evolution and Systematics

Functional Adaptations

Functional adaptation

Armor protects against predators: threespine stickleback
 

The plate-based armor of the threespine stickleback confers resistance to penetrating attacks due to local structure of individual plates, interlocking mechanisms, plate geometry, porosity, compositional gradients, and surface topology.

       
    

  

   
 
 
"The dermal armor of Gasterosteus aculeatus serves to protect the fish in different ways, including: (1) resistance to penetrating attacks (e.g., bites from toothed predators), (2) increasing swallowing difficulty and damage to soft mouthparts of predators, and (3) increasing body size when spines are erect, which is an effective deterrent to gape-limited piscivores (Reimchen, 2000; Hoogland et al., 1956). Regarding (1), a penetrating attack generally results in a complex multiaxial stress field below the loading point, as well as potential displacement of the armor unit as a whole via the armor-to-armor unit interconnections (Bruet et al., 2008). Both the local structure of the individual armor units, as well as the microscopic geometry and articulating mechanisms contribute to the effectiveness of protection." (Song et al. 2010:329)

"Aside from evolutionary relevance, detailed studies of the structure and properties of biological armor hold broad applicability to the development of synthetic engineered, protective penetration-resistant materials (e.g., human body, vehicle, and building structure), protective coatings (e.g., exterior paint of automobiles, motorcycles, etc.), construction applications (e.g., pipelines that need resistance to rock penetration/abrasion), and sporting equipment (e.g., helmets, chest protection, etc.) (Arciszewski and Cornell, 2006; Bruet et al., 2008; Ortiz and Boyce, 2008; Yao et al., 2010). Particularly relevant are interlocking mechanisms, plate geometry, porosity, compositional gradients, surface topology, and their relation to penetration resistance and biomechanical mobility (mechanical mechanisms of movement in living organisms, e.g., joint degrees of freedom, ranges of motion, etc.)." (Song et al. 2010:320)
 
 

  Learn more about this functional adaptation.
  • Song J; Reichert S; Kallai I; Gazit D; Wund M; Boyce MC; Ortiz C. 2010. Quantitative microstructural studies of the armor of the marine threespine stickleback (Gasterosteus aculeatus). Journal of Structural Biology. 171: 318-331.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© The Biomimicry Institute

Source: AskNature

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Gasterosteus aculeatus

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 17 barcode sequences available from BOLD and GenBank.

Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.

See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

GTGGCCATCACACGATGATTCTTCTCAACTAATCACAAAGACATTGGCACCCTCTATCTAGTATTTGGTGCCTGGGCCGGAATAGTCGGAACAGCTTTAAGCCTTCTAATTCGAGCTGAACTAAGTCAACCCGGAGCTCTTCTTGGAGACGACCAAATTTATAACGTAATTGTTACAGCCCATGCTTTCGTAATAATCTTCTTTATAGTTATACCAATCATGATCGGAGGCTTTGGCAACTGACTTATCCCCCTAATGATTGGAGCTCCCGATATAGCATTTCCACGAATAAACAACATGAGCTTCTGATTGCTCCCACCCTCTTTCTTACTTCTCCTTGCCTCTTCAGGAGTTGAAGCTGGTGCAGGAACGGGGTGAACAGTTTATCCACCCCTCTCTGGGAACCTCGCCCATGCAGGTGCTTCGGTAGACCTAACAATCTTTTCACTCCATCTTGCTGGTATCTCATCAATTCTGGGGGCAATCAACTTCATTACCACAATTATTAACATGAAACCTCCCGCTATTTCTCAGTACCAAACACCCCTTTTCGTCTGATCTGTGCTCATCACTGCAGTCCTTCTCCTCCTATCCCTGCCCGTCCTTGCAGCCGGAATCACTATGCTTTTAACAGACCGAAACTTAAACACCACTTTCTTTGACCCAGCAGGGGGTGGGGACCCAATTCTTTACCAACACTTATTTTGATTCTTTGGCCACCCTGAAGTTTATATTCTTATTCTTCCAGGCTTCGGAATAATCTCGCACATTGTTGCATATTACTCTGGAAAAAAGGAACCTTTTGGCTACATGGGTATGGTATGGGCAATGATGGCCATTGGCCTTCTAGGGTTTATTGTCTGAGCACATCACATGTTTACAGTAGGGATAGACGTGGACACACGAGCCTATTTCACCTCCGCCACCATAATTATTGCAATCCCAACAGGTGTTAAGGTTTTTAGCTGACTAGCTACACTTCATGGAGGCTCAATCAAATGAGAAACACCCCTTCTGTGAGCACTTGGTTTCATTTTCCTATTTACTGTCGGGGGTCTAACAGGCATTGTTCTTGCCAATTCTTCCCTTGATATTGTTCTTCATGATACTTACTACGTTGTTGCTCACTTCCATTATGTACTTTCCATGGGAGCCGTATTTGCTATTATTGCAGGCTTTGTACACTGATTCCCTCTGTTTTCAGGTTACACTCTTCACAGCACCTGAACAAAAGTTCATTTCGGTGTTATGTTTGCAGGTGTAAACCTAACTTTCTTCCCTCAACATTTCCTAGGCTTAGCCGGAATACCTCGGCGATACTCGGACTATCCAGATGCCTACACACTCTGAAACACAGTCTCTTCAATTGGTTCACTTGTGTCCTTAGTTGCAGTAATTATGTTCCTGTTCATTATCTGAGAAGCATTTGCTGCTAAACGTGAAGTTTTAGCAGTTGAAATAACAACAACAAACGTCGAGTGACTTCACGGCTGCCCTCCTCCCTACCACACTTTCGAAGAGCCTGCATTTGTTCAAGTTCAATCAAACTAA
-- end --

Download FASTA File

Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Gasterosteus aculeatus

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 26
Specimens with Barcodes: 60
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Conservation

Conservation Status

The unarmored threespine stickleback, Gasterosteus aculeatus williamsoni, a subspecies found in California, are listed as endangered in the United States.

US Federal List: endangered; no special status

CITES: no special status

State of Michigan List: no special status

IUCN Red List of Threatened Species: least concern

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

IUCN Red List Assessment


Red List Category
LC
Least Concern

Red List Criteria

Version
3.1

Year Assessed
2013

Assessor/s
NatureServe

Reviewer/s
Smith, K. & Darwall, W.R.T.

Contributor/s
Freyhof, J., Kottelat, M. & Lukey, J.R.

Justification
Gasterosteus aculeatus has been assessed as Least Concern. This species has an extremely broad native distribution, with a large number of subpopulations. This species is not known to be impacted by any major threat processes and is reported to be common to abundant throughout most of its distribution: Consequently the population is considered to be stable.

History
  • 2010
    Least Concern
  • 2008
    Least Concern
  • 2007
    Least Concern
    (IUCN 2008)
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

National NatureServe Conservation Status

Canada

Rounded National Status Rank: N5 - Secure

United States

Rounded National Status Rank: N5 - Secure

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

NatureServe Conservation Status

Rounded Global Status Rank: G5 - Secure

Reasons: Widespread, abundant, secure.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Population

Population
This is an abundant species.

Population Trend
Stable
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Global Short Term Trend: Relatively stable (=10% change)

Comments: Overall, extent of occurrence, area of occupancy, number of subpopulations, and population size probably are relatively stable or declining at a rate of less than 10% over 10 years or three generations.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Threats

Major Threats
No major widespread threats known. However, the species has been listed as threatened in some of its range states, for example it is listed as Endangered in Croatia.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Degree of Threat: Low

Comments: On a range-wide scale, no major threats are known.

Locally, threats include human impacts on spawning habitat and water quality, stocking or other introduction of non-native, predatory fishes, including introductions of certain forms of G. aculeatus itself.

Craig (1984) noted that large-scale industrial and petroleum extraction development in the Beaufort Sea could cause direct mortality as a result of intake of juvenile fishes with seawater and indirectly harm populations by altering coastal habitat, including water circulation patterns.

The California Department of Fish and Game (CDFG) recognized that increasing development along and recreational uses of the Santa Clara River were threats to the existence of the endangered G. a. williamsoni population (CDFG 1974).

In British Columbia, beaver activity has resulted in fluctuating water levels that have reduced access to some spawning sites used by the giant stickleback (currently recognized as G. aculeatus, but considered by some scientists to be a separate species, this fish is black in color and more than twice as long as threespine stickleback; occurs only in Mayer Lake, Queen Charlotte Islands; see sources in Rubidge 2000, Species at Risk Canada 2004). Increasing human recreational use of lake habitat also threatens this population (Species at Risk Canada 2004).

In Alaska and elsewhere, non-native species such as the northern pike (Esox lucius) and stocked salmonids may threaten sticklebacks through predation and competition for juvenile food resources (Hatfield 2001a, Hatfield and Ptolemy 2001, Foster et al. 2003, Wood 2003).

Hybridization between different forms of G. aculeatus threatens the unique genetic characteristics of specific populations recognized as rare or divergent; extensive hybridization between the native G. a. williamsoni (unarmored) and introduced G. a. microcephalus (armored) forms in California contributed to declines in the now endangered G. a. williamsoni (CDFG 1974, Moyle 1976b, Fuller 2005).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Least Concern (LC)
  • IUCN 2006 2006 IUCN red list of threatened species. www.iucnredlist.org. Downloaded July 2006.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Management

Conservation Actions

Conservation Actions
There are no species-specific conservation measures in place, or needed, for Gasterosteus aculeatus.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Biological Research Needs: Studies of systematics and clarification of taxonomyshould be continued; identification of distribution and characteristics of rare/unique populations will contribute to this work. Threats posed by habitat degradation and introduction of non-native species, especially to unique populations, should be investigated.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Relevance to Humans and Ecosystems

Benefits

Threespine sticklebacks have been widely studied in terms of speciation and evolutionary history because of their phylogeny and adaptive radiations. Their abundance and the relative ease to cross, raise, and maintain in the lab make them an excellent animal model for a variety of studies. Threespine sticklebacks have also served as subjects in research on environmental effects since they are considered bioindicators.

Positive Impacts: research and education

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Importance

fisheries: minor commercial; aquarium: public aquariums; price category: unknown; price reliability:
  • Morrow, J.E. 1980 The freshwater fishes of Alaska. University of. B.C. Animal Resources Ecology Library. 248p. (Ref. 27547)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Economic Uses

Comments: Has been used in carcinogenesis testing (Metcalfe 1989).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Wikipedia

Three-spined stickleback

The Three-Spined Stickleback, Gasterosteus aculeatus,[1] is a fish native to most inland coastal waters north of 30°N. It has long been a subject of scientific study for many reasons. It shows great morphological variation throughout its range, ideal for questions about evolution and population genetics. Most populations are anadromous (they live in seawater but breed in fresh or brackish water) and very tolerant of changes in salinity, a subject of interest to physiologists. It displays elaborate breeding behavior (defending a territory, building a nest, taking care of the eggs and fry) and it can be social (living in shoals outside the breeding season) making it a popular subject of enquiry in fish ethology and behavioral ecology. Its antipredator adaptations, host-parasite interactions, sensory physiology, reproductive physiology, and endocrinology have also been much studied. Facilitating these studies is the fact that the three-spined stickleback is easy to find in nature and easy to keep in aquaria.

Characteristics[edit]

Among the larger sticklebacks, it is usually 5 cm (2 in) long (but may reach, exceptionally, twice that length). The body is laterally compressed. The base of the tail is slender. The caudal fin has 12 rays. The dorsal fin has 10-14 rays; in front of it are the three spines that give the fish its name (though some individuals may have only two or four). The third spine (the one closest to the dorsal fin) is much shorter than the other two. The back of each spine is joined to the body by a thin membrane. The anal fin has eight to 11 rays and is preceded by a short spine. The pelvic fins consist of just a spine and one ray. All spines can be locked in an erect position, making the fish extremely hard to swallow by a predator. The pectoral fins are large, with 10 rays. The body bears no scales, but is protected by bony plates on the back, flanks, and belly. Only one ventral plate is present, but the number of flank plates varies greatly across the distribution range and across habitat types (see below); it is normally higher in marine populations (some freshwater populations may in fact lack lateral plates altogether).

Dorsal coloration varies, but tends towards a drab olive or a silvery green, sometimes with brown mottling. The flanks and belly are silvery. In males during the breeding season, the eyes become blue and the lower head, throat, and anterior belly turn bright red. The throat and belly of breeding females can turn slightly pink. A few populations, however, have breeding males which are all black[2] or all white.[3]

Habitat and distribution[edit]

The three-spined stickleback is found only in the Northern Hemisphere, where it usually inhabits coastal waters or freshwater bodies well connected (or once well connected) to the coasts. It can live in either fresh, brackish, or salt water. It prefers slow-flowing water with areas of emerging vegetation. It can be found in ditches, ponds, lakes, backwaters, quiet rivers, sheltered bays, marshes, and harbours.

In North America, it ranges along the East Coast from Chesapeake Bay to the southern half of Baffin Island and the western shore of Hudson Bay, and along the West Coast from southern California to the western shore of Alaska and the Aleutian Islands. It can be found throughout Europe between 35 and 70°N. In Asia, the distribution stretches from Japan and the Korean peninsula to the Bering Straits.

Its distribution could be said to be circumpolar were it not for the fact that it is absent from the north coast of Siberia, the north coast of Alaska, and the Arctic islands of Canada.

Variation in morphology and distribution[edit]

Gasterosteus aculeatus 1879.jpg

Three subspecies are currently recognized by the IUCN:

  • G. a. aculeatus is found in most of the species range, and is the subspecies most strictly termed the three-spined stickleback; its common name in Britain is the tiddler, although "tittlebat" is also sometimes used.
  • G. a. williamsoni, the unarmored threespine stickleback, is found only in North America; its recognised range is southern California, though isolated reports have been made of it occurring in British Columbia and Mexico;
  • G. a. santaeannae, the Santa Ana stickleback, is also restricted to North America.

These subspecies actually represent three examples from the enormous range of morphological variation present within three-spined sticklebacks. These fall into two rough categories, the anadromous and the freshwater forms.

The anadromous form spends most of its adult life eating plankton and fish in the sea, and returns to freshwater to breed. The adult fish are typically between 6 and 10 cm long, and have 30 to 40 lateral armour plates along their sides. They also have long dorsal and pelvic spines. The anadromous form is morphologically similar all around the Northern Hemisphere, such that anadromous fish from the Baltic, the Atlantic and the Pacific all resemble each other quite closely.

Three-spined stickleback populations are also found in freshwater lakes and streams. These populations were probably formed when anadromous fish started spending their entire lifecycle in fresh water, and thus evolved to live there all year round. Freshwater populations are extremely morphologically diverse, to the extent that many observers (and some taxonomists) would describe a new subspecies of three-spined stickleback in almost every lake in the Northern Hemisphere. One consistent difference between freshwater populations and their anadromous ancestors is the amount of body armour, as the majority of freshwater fish only have between none and 12 lateral armour plates, and shorter dorsal and pelvic spines. However, also large morphological differences occur between lakes. One major axis of variation is between populations found in deep, steep-sided lakes and those in small, shallow lakes. The fish in the deep lakes typically feed in the surface waters on plankton, and often have large eyes, with short, slim bodies and upturned jaws. Some researchers refer to this as the limnetic form. Fish from shallow lakes feed mainly on the lake bed, and are often long and heavy bodied with relatively horizontal jaws and small eyes. These populations are referred to as the benthic form.

Since each watershed was probably colonised separately by anadromous sticklebacks, morphologically similar populations in different watersheds or on different continents are widely believed to have evolved independently. A unique population is found in the meromictic Pink Lake in Gatineau Park, Quebec.

One aspect of this morphological variation is that a number of lakes contain both a limnetic and a benthic type, and these do not interbreed with each other. Evolutionary biologists often define species as populations that do not interbreed with each other (the biological species concept), thus the benthics and limnetics within each lake would constitute separate species. These species pairs are an excellent example of how adaptation to different environments (in this case feeding in the surface waters or on the lake bed) can generate new species. This process has come to be termed ecological speciation. This type of species pair is found in British Columbia. The lakes themselves only contain three-spined sticklebacks and cutthroat trout, and all are on islands. Tragically, the pair in Hadley Lake on Lasqueti Island was destroyed in the mid-1980s by the introduction of a predatory catfish, and the pair in Enos Lake on Vancouver Island has started to interbreed and are no longer two distinct species.[4] The two remaining pairs are on Texada Island, in Paxton Lake and Priest Lake, and they are listed as Endangered in the Canadian Species At Risk Act.[5]

Other species pairs which consist of a well-armored marine form and a smaller, unarmored freshwater form are being studied in ponds and lakes in south-central Alaska that were once marine habitats such as those uplifted during the 1964 Alaska earthquake. The evolutionary dynamics of these species pairs are providing a model for the processes of speciation which has taken place in less than 20 years in at least one lake. In 1982, a chemical eradication program intended to make room for trout and salmon at Loberg Lake, Alaska, killed the resident freshwater populations of sticklebacks. Oceanic sticklebacks introduced through nearby Cook Inlet recolonized the lake. In just 12 years beginning in 1990, the frequency of the oceanic form dropped steadily, from 100% to 11%, while a variety with fewer plates increased to 75% of the population, with various intermediate forms making up another small fraction.[6] This rapid evolution is thought to be possible through genetic variations that confer competitive advantages for survival in fresh water when conditions shift rapidly from salt to fresh water. However, the actual molecular basis of this evolution still remains unknown.

Although sticklebacks are found in many locations around the coasts of the Northern Hemisphere and are thus viewed by the IUCN as species of least concern, the unique evolutionary history encapsulated in many freshwater populations indicates further legal protection may be warranted. The IUCN indicated this evaluation may be out of date.[7]

Diet[edit]

The three-spined stickleback is a bottom-feeder, basically on benthic prey, normally the chironomid larvae being the most abundant prey; however, this fish species can also consume terrestrial prey on the surface.[8] It can cannibalize eggs and fry.[9]

Life history[edit]

Male stickleback with red throat and shiny blue eye

Many populations take two years to mature and experience only one breeding season before dying, and some can take up to three years to reach maturity. However, some freshwater populations and populations at extreme latitudes can reach maturity in only one year.

Reproduction[edit]

From late April until July, males and females move from deeper waters to shallow areas. There, each male defends a territory where he builds a nest on the bottom. He starts by digging a small pit. He then fills it with plant material (often filamentous algae), sand, and various debris which he glues together with spiggin, a proteinaceous substance secreted from the kidneys (the word spiggin comes from spigg, the Swedish name for the three-spined stickleback). He then creates a tunnel through the more or less spherical nest by swimming vigorously through it. Nest building typically takes 5–6 hours[10] though it may also be spread out over several days. After this, the male courts gravid females that pass by with a zigzag dance. He approaches a female by swimming very short distances left and right, and then swims back to the nest in the same way. If the female follows, the male often pokes his head inside the nest, and may swim through the tunnel. The female then swims through the tunnel as well, where she deposits 40−300 eggs. The male follows to fertilize the eggs. The female is then chased away by the male. For the duration of the eggs' development, the male will chase away other males and nongravid females. He may, however, court other gravid females (more than one batch of eggs can be deposited in the same nest).

The sequence of territorial courtship and mating behaviours was described in detail by Niko Tinbergen in a landmark early study in ethology. Tinbergen showed that the red colour on the throat of the territorial male acts as a simple sign stimulus, releasing aggression in other males and attracting females.[11] The red colouration may also be used by females as a way to assess male quality. Red colouration is produced from carotenoids found in the diet of the fish. As carotenoids cannot be synthesised de novo, the degree of colouration gives an indication of male quality (ability to find food), with higher-quality males showing more intense colouration. Also, males that bear fewer parasites tend to exhibit brighter red colours. Many studies have shown that females prefer males with brighter red colouration.[12][13][14][15] However, the response to red is not universal across the entire species,[16][17] with black throated populations often found in peat-stained waters.

The male takes care of the developing eggs by fanning them. He lines himself up with the entrance of the nest tunnel and swims on the spot. The movement of his pectoral fins creates a current of water through the nest, bringing fresh (well-oxygenated) water to the eggs. He does this not only during the day, but throughout the night, as well.[18] Fanning levels tend to increase until the eggs are about to hatch, which takes 7–8 days at 18−20 °C. Fanning levels also increase when the water is poorly oxygenated.[19] Towards the end of the egg development phase, the male often makes holes in the roof and near the rim of the nest, presumably to improve ventilation of the nest during fanning at a time when the eggs are more metabolically active. Once the young hatch, the male attempts to keep them together for a few days, sucking up any wanderers into his mouth and spitting them back into the nest. Afterwards, the young disperse and the nest is either abandoned by the male, or repaired in preparation for another breeding cycle.

In Nova Scotia, a form of three-spined stickleback departs from the usual pattern of parental care. Unlike other sticklebacks that nest on the substrate, Nova Scotian male sticklebacks build nests in mats of filamentous algae. Surprisingly, almost immediately after fertilization, the males disperse the eggs from the nest and resume soliciting females for eggs. Hence, there appears to have been a loss of parental care in this population. Because these males have reduced dorsal pigmentation, resulting a pearlescent white appearance, they have been dubbed "white sticklebacks". It is currently unknown whether they are a distinct species, or simply a morph of the common Atlantic stickleback.[20][21]

Cooperative Behavior[edit]

Some evidence indicates the existence of cooperative behavior among three-spined sticklebacks, mainly cooperative predator inspection. Predator inspection appears to allow acquisition of information about the risk a potential predator presents, and may deter attack, with the cost being an increased chance of being attacked if the predator proves to be hungry.

Tit-For-Tat Strategy[edit]

Sticklebacks are known to cooperate in a tit-for-tat (TFT) strategy when doing predator inspection. The idea behind TFT is that an individual cooperates on the first move and then does whatever its opponent does on the previous move. This allows for a combination of collaborative (it starts by cooperating), retaliatory (punishes defection), and forgiving (respond to cooperation of others, even if they had defected previously) behavioral responses.[22] When three-spined sticklebacks approaching a live predator were provided with either a stimulated cooperating companion or a stimulated defecting one, the fish behaved according to tit-for-tat strategy, supporting the hypothesis that cooperation can evolve among egoists. [23]

Typically, sticklebacks operate in pairs. Individuals have partners with which they repeatedly perform pairwise predator inspection visits. Two reciprocal pairs per trial occur significantly more often than what was expected due to chance. These results provide further evidence for a tit-for-tat cooperation strategy in sticklebacks.[24]

Stickleback behavior is often cited as an archetypal example of cooperative behavior during predator inspection. Fish from three sites differing in predation risk inspected a model predator in pairs and reciprocated both cooperative moves and defections by the partner, but not on every opportunity. [25] Sticklebacks that originated in the two sites containing piscivorous fish were more likely to reciprocate following a cooperative move than following a defection. Individuals from higher-risk sites were generally more cooperative.[25] Individuals accompanied by a model companion show reciprocal moves of cooperation and defection in response to the model's movements about a third of the time. Both examples of stickleback behavior demonstrate the elements of a strategy of cooperation that may resemble tit-for-tat. [25]

Partner-Dependence[edit]

The tit-for-tat cooperation strategy has been shown to be evident in sticklebacks. In addition, the size of a stickleback's partner fish may also be a factor in determining what a stickleback will do when both fish are faced with a predator. Two sticklebacks simultaneously presented to a rainbow trout, a predator much larger in size, will have differing risks of being attacked. Usually, the larger of the two sticklebacks has a higher risk of being attacked.[26] Individual sticklebacks are more likely to move closer to a trout (or some other predator) when a larger potential partner moves close to the trout than when a smaller partner approaches the trout. [26] Although both large and small partners behave similarly, a small partner's behavior affects the strategy of the test fish more than that of the large partner.[26] Regardless of whether it is alone or with a partner that cooperates, a larger fish will approach a predator more closely than does a smaller fish.[26] If a partner defects, then a stickleback's condition-factor (i.e. its ability to flee) determines how closely it approaches the predator rather than the stickleback's size. [26] Both the strategy and reaction to different-sized partners seem to be dependent on whether the partner cooperates or defects.

Sensory biology[edit]

A three-spined stickleback with stained neuromasts that form the lateral line system.

Sticklebacks have four colour photoreceptor cells in their retina, making them potentially tetrachromatic. They are capable of perceiving ultraviolet wavelengths of light invisible to the human eye and use such wavelengths in their normal behavioural repertoire.

Parasites[edit]

The three-spined stickleback is a known intermediate host for the hermaphroditic parasite Schistocephalus solidus, a tapeworm of fish and fish-eating birds.[27]

Genetics[edit]

Three-spined sticklebacks have recently become a major research organism for evolutionary biologists trying to understand the genetic changes involved in adapting to new environments. The entire genome of a female fish from Bear Paw Lake in Alaska was recently sequenced by the Broad Institute and many other genetic resources are available.[28] This population is under risk from the presence of introduced northern pike in a nearby lake.

In popular culture[edit]

The three-spined stickledback is also known as a tittlebat, and was featured in The Pickwick Papers by Charles Dickens. Samuel Pickwick is said to have published a treatise on the subject of tittlebats, specifically the ones living in the ponds of Hampstead.

References[edit]

  1. ^ Froese, Rainer and Pauly, Daniel, eds. (2006). "Gasterosteus aculeatus" in FishBase. February 2006 version.
  2. ^ Reimchen, T.E., 1989, "Loss of nuptial colour in three-spined sticklebacks (Gasterosteus aculeatus)", Evolution 43: 450.
  3. ^ Haglund, T.R., Buth, D.G., Blouw, D.M., 1990, "Allozyme variation and the recognition of the white stickleback", Biochemistry and Systematic Ecology 18: 559.
  4. ^ Behm, J. E., A. R. Ives and J. W. Boughman. 2010. "Breakdown in postmating isolation and the collapse of a species pair through hybridization" American Naturalist 175:11–26.
  5. ^ Canada - Species At Risk Act
  6. ^ Carroll, Sean B. (2006). The Making of the Fittest: DNA and the Ultimate Forensic Record of Evolution. W.W. Norton & Co. pp. 56–57. ISBN 978-0-393-06163-5. 
  7. ^ World Conservation Monitoring Centre (1996). Gasterosteus aculeatus. 2006. IUCN Red List of Threatened Species. IUCN 2006. www.iucnredlist.org. Retrieved on 12 May 2006.
  8. ^ Sánchez-Hernández, J., Servia, M.J., Vieira-Lanero, R. & Cobo, F. (2012). Aplicación del análisis de los rasgos biológicos (“traits”) de las presas para el estudio del comportamiento alimentario en peces bentófagos: el ejemplo del espinoso (Gasterosteus gymnurus Cuvier 1829). Limnetica, 31 (1): 59–76.
  9. ^ Whoriskey, F. G. & FitzGerald, G. J. (1985). Sex, cannibalism and sticklebacks. Behavioral Ecology and Sociobiology, 18: 15–18.
  10. ^ van Iersel, J.J.A., 1953, "An analysis of the parental behaviour of the malethree-spined stickleback (Gasterosteus aculeatus L.)", Behaviour Supplement 3: 1-159.
  11. ^ Tinbergen, N., 1951, The study of instinct, Clarendon Press, Oxford.
  12. ^ Milinski, M., and Bakker, T.C.M., 1990, "Female sticklebacks use male coloration in mate choice and hence avoid parasitized males", Nature 344: 330
  13. ^ McLennan, D.A., and McPhail, J.D., 1990, "Experimental investigations of the evolutionary significance of sexually dimorphic nuptial coloration in Gasterosteus aculeatus (L.): the relationship between color and female behaviour", Canadian Journal of Zoology 68: 482
  14. ^ Bakker, T.C.M. and Mundwiler, B., 1994, "Female mate choice and male red coloration in a natural three-spined stickleback (Gasterosteus aculeatus)", Behavioural Ecology 5: 74
  15. ^ Baube, C.L., Rowland, W.J., and Fowler, J.B., 1995, "The mechanismsof colour-based mate choice in female threespine sticklebacks: hue, contrast and configurational cues", Behaviour 132: 979-996.
  16. ^ McKinnon, J.S., 1995, "Video mate preferences of female three-spined sticklebacks from population with divergent male coloration", Animal Behaviour 50: 1645
  17. ^ Braithwaite, V.A., and Barber, I., 2000, "Limitations to colour-based sexual preferences in three-spined sticklebacks (Gasterosteus aculeatus)", Behavioural Ecology and Sociobiology 47: 413-416.
  18. ^ Reebs, S.G., F.G. Whoriskey, and G.J. FitzGerald, 1984, "Diel patterns of fanning activity, egg respiration, and the nocturnal behavior of male three spined sticklebacks, Gasterosteus aculeatus L. (f. trachurus)", Canadian Journal of Zoology 62: 329 334.
  19. ^ Seventer, P., 1961, "A causal study of a displacement activity (fanning in Gasterosteus aculeatus L.)", Behaviour Supplement 9: 1-170.
  20. ^ MacDonald, J.F., Bekkers, J., MacIsaac, S.M., and Blouw, D.M., 1995, "Intertidal breeding and aerial development of embryos of a stickleback fish (Gasterosteus)", Behaviour 132, 1183-1206; MacDonald, J.F., MacIsaac, S.M., Bekkers, J., and Blouw, D.M., 1995, Experiments on embryo survivorship, habitat selection, and competitive ability of a stickleback fish (Gasterosteus) which nests in the rocky intertidal zone, Behaviour 132, 1207-1221
  21. ^ Jamieson, I.G., Blouw, D.M., and Colgan, P.W., 1992, "Field observation on the reproductive biology of a newly discovered stickleback Gasterosteus", Canadian Journal of Zoology 70: 1057.
  22. ^ West, Nicholas B. Davies, John R. Krebs, Stuart A. An introduction to behavioural ecology (4th ed. ed.). Oxford: Wiley-Blackwell. ISBN 978-1-4051-1416-5. 
  23. ^ Milinksi, Manfred (1987). "TIT FOR TAT in sticklebacks and the evolution of cooperation". Nature 325 (29): 433–435. doi:10.1038/325433a0. 
  24. ^ Milinski, Manfred; D. Pfluger; D. Kulling; R. Kettler (1990). "Do sticklebacks cooperate repeatedly in reciprocal pairs?". Behavioral Ecology and Sociobiology 27 (1): 17–21. doi:10.1007/bf00183308. 
  25. ^ a b c Huntingford, Felicity; John Lazarus; Brian Barrie; Sally Webb (1994). "A dynamic analysis of cooperative predator inspection in sticklebacks". Animal Behavior 47 (2): 413–423. doi:10.1006/anbe.1994.1055. 
  26. ^ a b c d e Kulling, David; Manfred Milinski (1992). "Size-dependent predation risk and partner quality in predator inspection of sticklebacks". Animal Behavior 44 (5): 949–955. doi:10.1016/s0003-3472(05)80590-1. 
  27. ^ LoBue, C. P. and M. A. Bell. 1993. "Phenotypic manipulation by the cestode parasite Schistocephalus solidus of its intermediate host, Gasterosteus aculeatus, the threespine stickleback" American Naturalist 142:725–735.
  28. ^ "Stickleback Genome at ENSEMBL". 
  • Wootton, R.J. 1976. The biology of the sticklebacks. Academic Press, London.
  • Bell, M.A., and Foster, S.A. (eds.) 1994. The evolutionary biology of the three-spined stickleback. Oxford University Press, New York.
  • Ostlund-Nilsson, S., Mayer, I., and Huntingford, F.A. (eds.) 2007. Biology of the three-spined stickleback. CRC Press, Boca Raton.
Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

Source: Wikipedia

Unreviewed

Article rating from 0 people

Default rating: 2.5 of 5

Names and Taxonomy

Taxonomy

Comments: Complex patterns of variation make taxonomic treatment difficult. This stickleback may be considered a species complex with many unique and reproductively isolated populations, subspecies or species.

Populations exist that are strictly marine, anadromous, and freshwater resident. The marine and anadromous forms have given rise to diverse resident phenotypes. Subspecies have been recognized in the past, but current scientific discussion of this species complex recognizes multiple distinct species within evolutionary radiations; current genetic research is underway to determine relationships between evolutionary groups and species before names can be assigned (Hatfield 2001a, 2001b). Lateral plate morphs of resident freshwater forms are recognized as lows (i.e., lateral plates on anterior parts of the fish only), partials (i.e., lateral plates on anterior and posterior ends of the fish with a gap between), and completes (i.e., lateral plates in a continuous row anterior to posterior). In a rare form, plates are entirely absent; G. a. williamsoni is an endangered plateless form exhibiting reduction in pelvic structure, and only occurs in drainages in southern California. Lows from the Pacific coast of North America have been called G. a. microcephalus, Pacific coast completes are G. a. aculeatus, and Penczak (1964, in Wootton 1976) designated lows from Iceland as G. a. islandicus. A plateless form occurring in Shay Creek, San Bernardino County, California, has been identified as G. a. santaeannae (or santa-annae) but is currently recognized as synonymous with G. a. williamsoni (Ross 1973, Moyle et al. 1989).

Studies of allozyme variation (Haglund et al. 1992) and mitochondrial DNA sequences (Orti et al. 1994) in Asian, North American, and European populations recognized two primary clades: (1) European, North American, and some Japanese samples, which could be divided into an (1a) Atlantic basin clade comprising the eastern North American and European populations, and a (1b) basal Pacific basin assemblage comprising western North American and some Japanese populations; and (2) a divergent group of Japanese populations. The divergent Japanese clade deserves further study and possible taxonomic recognition.

Sympatric species pairs bearing "limnetic" and "benthic" life histories and distinct morphologies have evolved in several British Columbian lake systems (Thompson et al 1997, Hatfield 2001, Hatfield and Ptolemy 2001). Some populations of these are endangered or already extinct (Wood 2003).

Several low-lying lakes and streams in the Cook Inlet area contain rare and evolutionarily divergent populations of G. aculeatus including three populations polymorphic for lateral plate morphs, several populations polymorphic for pelvic armor morphs, one lake containing 2 freshwater morphs of the species (a benthic and a limnetic feeder), and one lake containing both anadromous and resident freshwater forms of the species (von Hippel, pers. comm.). Bell and Orti (1994) viewed divergent populations in freshwater habitats around Cook Inlet as parts of an endemic radiation warranting special consideration for conservation as a unit.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!