Overview

Comprehensive Description

Biology

Parasitic adults are found in estuaries and the ocean, migrating to clear gravel riffles of streams to spawn (Ref. 5723). Ammocoetes burrow into the mud where they live for an unknown period and migrate to the sea only after transformation (Ref. 1998). Adults feed by ripping flesh from other fishes (Ref. 2850), ammocoetes feed on microscopic plants and animals just like other members of this family (Ref. 1998). Parasitism can take place at a length of 16.2 cm TL (Ref. 1998). Preyed upon by a number of fishes, e.g. lingcod, and birds (Ref. 1998). Because of its small size, it is unlikely to pose a threat to economically important fish (Ref. 1998). Utilized fresh or smoked by some cultures (Ref. 27436).
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Distribution

occurs (regularly, as a native taxon) in multiple nations

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

National Distribution

Canada

Origin: Native

Regularity: Regularly occurring

Currently: Present

Confidence: Confident

Type of Residency: Year-round

United States

Origin: Native

Regularity: Regularly occurring

Currently: Present

Confidence: Confident

Type of Residency: Year-round

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Global Range: (20,000-200,000 square km (about 8000-80,000 square miles)) The river lamprey occurs as widely scattered, isolated populations (Moyle et al. 1995, Moyle 2002) along the Pacific Slope, from the Sacramento-San Joaquin drainage, California, to Tee Harbor near Juneau, Alaska (Lee et al. 1980, Page and Burr 2011).

In California, this species has been recorded from the lower Sacramento and San Joaquin rivers (especially the Stanislaus and Tuolumne rivers); the Napa River, Sonoma Creek, and Alameda Creek (tributaries to San Francisco Bay); in Salmon Creek and in tributaries to the lower Russian River (Sonoma County, where the species appears to be a regular spawner); a single adult female was captured at Cape Horn Dam in the Eel River; this species has not been adequately surveyed in most California streams (Moyle 2002).

In Oregon, river lampreys have been found in sites 182 km apart in the Columbia and Yaquina rivers (Moyle 2002). According to the Center for Biodiversity, the species has not been documented in the Columbia River or anywhere in Oregon since 1980.

Detailed distribution records are not available for Washington, but the species probably occurs in major coastal drainages (Wydoski and Whitney 2003).

In British Columbia, in the center of their range, river lampreys have been reported from the Strait of Georgia and Fraser River (Beamish and Neville 1995). A landlocked population exists in Morrison Creek, Vancouver Island, British Columbia (Renaud 1997).

In southeastern Alaska, the species has been recorded north of Juneau at Tee Harbor-Lynn canal area, Douglas Island, Taku River, and in Portland Canal (Mecklenburg et al. 2002). Probably it occurs coastally in areas south of Juneau.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Range Description

The river lamprey occurs as widely scattered, isolated populations (Moyle et al. 1995, Moyle 2002) along the Pacific Slope, from the Sacramento-San Joaquin drainage, California, to Tee Harbor near Juneau, Alaska (Lee et al. 1980, Page and Burr 2011).

In California, this species has been recorded from the lower Sacramento and San Joaquin rivers (especially the Stanislaus and Tuolumne rivers); the Napa River, Sonoma Creek, and Alameda Creek (tributaries to San Francisco Bay); in Salmon Creek and in tributaries to the lower Russian River (Sonoma County, where the species appears to be a regular spawner); a single adult female was captured at Cape Horn Dam in the Eel River; this species has not been adequately surveyed in most California streams (Moyle 2002).

In Oregon, river lampreys have been found in sites 182 km apart in the Columbia and Yaquina rivers (Moyle 2002). According to the Center for Biodiversity, the species has not been documented in the Columbia River or anywhere in Oregon since 1980.

Detailed distribution records are not available for Washington, but the species probably occurs in major coastal drainages (Wydoski and Whitney 2003).

In British Columbia, in the center of their range, river lampreys have been reported from the Strait of Georgia and Fraser River (Beamish and Neville 1995). A landlocked population exists in Morrison Creek, Vancouver Island, British Columbia (Renaud 1997).

In southeastern Alaska, the species has been recorded north of Juneau at Tee Harbor-Lynn canal area, Douglas Island, Taku River, and in Portland Canal (Mecklenburg et al. 2002). Probably it occurs coastally in areas south of Juneau.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Eastern Pacific: Tee Harbor, Alaska to Sacramento-San Joaquin drainage in California, USA. Freshwater resident population in Morrison Creek, Vancouver Island, British Columbia (Ref. 12269).
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Eastern Pacific.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Physical Description

Size

Length: 31 cm

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Maximum size: 281 mm TL
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Max. size

28.1 cm TL (male/unsexed; (Ref. 1998)); 31.1 cm TL (female)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Diagnostic Description

Distinguished by 2 large teeth on the supraoral bar, a large middle tooth on the tongue, 3 points (rarely 2) on each central lateral tooth plate, and the absence of posterial teeth (Ref. 27547). Anterior dorsal fin being lower than posterior, the fins separate in nonbreeding individuals but coming into contact at spawning; caudal fin lobes about equal, lower lobe joined to anal fin; anal fin virtually absent in males (Ref. 27547). Dark brown or brownish gray on sides and back; belly yellowish, silvery around head, gill openings and lower sides; caudal fin has a band of dark pigment inside its margins, symmetrical on each lobe (Ref. 27547).
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Type Information

Type for Lampetra ayresii
Catalog Number: USNM 6176
Collection: Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Fishes
Locality: Ft. Steilacoom W. I., Washington, United States, Pacific
  • Type:
Creative Commons Attribution 3.0 (CC BY 3.0)

© Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Fishes

Source: National Museum of Natural History Collections

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Type for Lampetra ayresii
Catalog Number: USNM 981
Collection: Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Fishes
Collector(s): D. Suckley
Year Collected: 1855
Locality: Pug. Sound. Fort Steilacoom, Washington, United States, Pacific
  • Type:
Creative Commons Attribution 3.0 (CC BY 3.0)

© Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Fishes

Source: National Museum of Natural History Collections

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Ecology

Habitat

Habitat Type: Freshwater

Comments: Habitat includes fresh and salt water. Ammocoetes burrow in sandy-muddy backwaters of streams. Adults are anadromous, feeding in estuaries and at sea and spawning over gravel riffles in clear freshwater streams (Lee et al. 1980). In British Columbia, just prior to metamorphosis, congregates immediately upriver of salt water, enters ocean from May to July (Beamish and Youson 1987). Adults probably spend much of their life in estuaries (Moyle et al. 1989). Spawning occurs in small, clean tributary streams, over gravel riffles, probably in saucer-shaped nests, dug in sand and gravel (Wydoski and Whitney 1979).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Habitat and Ecology

Habitat and Ecology
Habitat includes fresh and salt water. Ammocoetes burrow in sandy-muddy backwaters of streams. Adults are anadromous, feeding in estuaries and at sea and spawning over gravel riffles in clear freshwater streams (Lee et al. 1980). In British Columbia, just prior to metamorphosis, congregates immediately upriver of salt water, enters ocean from May to July (Beamish and Youson 1987). Adults probably spend much of their life in estuaries (Moyle et al. 1989). Spawning occurs in small, clean tributary streams, over gravel riffles, probably in saucer-shaped nests, dug in sand and gravel (Wydoski and Whitney 1979).

Systems
  • Freshwater
  • Marine
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Environment

demersal; anadromous (Ref. 51243); freshwater; brackish; marine
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Depth range based on 7 specimens in 1 taxon.

Environmental ranges
  Depth range (m): 2.5 - 151

Graphical representation

Depth range (m): 2.5 - 151
 
Note: this information has not been validated. Check this *note*. Your feedback is most welcome.

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Migration

Non-Migrant: No. All populations of this species make significant seasonal migrations.

Locally Migrant: No. No populations of this species make local extended movements (generally less than 200 km) at particular times of the year (e.g., to breeding or wintering grounds, to hibernation sites).

Locally Migrant: Yes. At least some populations of this species make annual migrations of over 200 km.

Transformed individuals migrate to sea and return to fresh water to spawn. In British Columbia, adults migrate back into freshwater by September (Beamish and Youson 1987).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Anadromous. Fish that ascend rivers to spawn, as salmon and hilsa do. Sub-division of diadromous. Migrations should be cyclical and predictable and cover more than 100 km.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Trophic Strategy

Comments: Larval lampreys feed on algae and microscopic organisms. Adults are parasitic on various fish species (e.g., Pacific herring, Pacific salmon; mainly mid-sized salmonids); will attack fish in salt or fresh water; feeds mainly on muscle tissue and usually kills host in process of feeding.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Parasitic adults are found in estuaries and the ocean, migrating to clear gravel riffles of streams to spawn (Ref. 5723). Ammocoetes burrow into the mud where they live for an unknown period and migrate to the sea only after transformation (Ref. 1998). Adults feed by ripping flesh from other fishes (Ref. 2850), ammocoetes feed on microscopic plants and animals just like other members of this family (Ref. 1998). Parasitism can take place at a length of 16.2 cm TL (Ref. 1998). Preyed upon by a number of fishes, e.g. lingcod, and birds (Ref. 1998).
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Population Biology

Number of Occurrences

Note: For many non-migratory species, occurrences are roughly equivalent to populations.

Estimated Number of Occurrences: 21 - 300

Comments: This species is represented by a fairly large number of occurrences (subpopulations). Lee et al. (1980) mapped approximately 27 collection sites, but the species likely occupies more streams than presently known (Moyle 2002).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Global Abundance

>1,000,000 individuals

Comments: Total adult population size is unknown but very large. This species may be very common locally, especially at the ammocoete stage, making up a large part of the stream biomass where present; as adults, abundance is difficult to monitor because the species is anadromous (Beamish pers. comm.). Little specific abundance information is available, and general comments regarding abundance are contradictory. According to Scott and Crossman (1973), this species is probably uncommon in British Columbia although more abundant to the south. However, Moyle et al. (1995) and Moyle (2002) reported that it was abundant in British Columbia, the center of the range, but has relatively few records from California, the southernmost portion of the range. In California, it is probably most abundant (but not observed in large numbers) in the Sacramento-San Joaquin river system (Moyle et al. 1989). The species is possibly sparse in Washington rivers, where few have been documented (Wydoski and Whitney 2003), and uncommon in Alaska (Mecklenburg et al. 2002).

In the Strait of Georgia, British Columbia, Beamish and Williams (1976) estimated 667,000-6,206,000 adult individuals in 1976, and 6,500,000 adults in 1979, with a corresponding average density of 27 ammocoetes/m² for the area in that year (Beamish and Youson 1987).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

General Ecology

Adults may be eaten by game fishes during spawning migrations.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Life History and Behavior

Life Cycle

Probably spawns in gravel, with an activity similar to Lethenteron japonicum (Ref. 1998).
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Reproduction

In California, spawns late April-May. In British Columbia, spawns in winter (Beamish and Youson 1987). Adults die after spawning. Ammocoete stage lasts several years; transformation into adult stage occurs when ammocoetes reach about 12 cm TL. In British Columbia, metamorphosis begins in July and is completed in April of the following year (Beamish and Youson 1987).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Lampetra ayresii

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There is 1 barcode sequence available from BOLD and GenBank.   Below is the sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen.  Other sequences that do not yet meet barcode criteria may also be available.

TTGGCACCCTATATCTAATCTTCGGGGCCTGAGCAGGAATAGTGGGAACCGCTTTAAGTATTCTTATTCGAGCAGAACTAAGTCAACCAGGCACTTTACTAGGAGATGACCAAATTTTTAACGTTATCGTAACCGCCCATGCTTTCGTTATAATTTTCTTTATAGTTATGCCAATTATAATTGGAGGCTTCGGAAACTGACTTGTACCACTCATACTTAGTGCCCCTGATATAGCCTTCCCTCGTATAAACAACATAAGCTTTTGATTACTTCCACCCTCACTACTCCTACTTTTAGCCTCCGCAGGAGTTGAAGCAGGGGCTGGCACAGGATGAACCGTATACCCACCTCTAGCAGGAAACTTAGCCCACACAGGGGCCTCCGTTGACTTAACAATTTTCTCCCTACATTTAGCCGGAATTTCATCAATTCTAGGAGCAGTCAACTTTATTACAACAATCTTCAATATAAAACCCCCAACTATAACACAATATCAAACTCCTTTATTTGTTTGATCTGTTTTAATTACCGCAGTACTTCTTCTTCTATCACTTCCTGTACTTGCAGCCGCCATCACTATACTTTTAACAGATCGCAATTTAAATACATCCTTTTTTGACCCAGCAGGAGGAGGAGACCCAATTTTATACCAACACCTATTTTGATTCTTCGG
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Lampetra ayresii

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 2
Specimens with Barcodes: 2
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Conservation

Conservation Status

National NatureServe Conservation Status

Canada

Rounded National Status Rank: N4 - Apparently Secure

United States

Rounded National Status Rank: N4 - Apparently Secure

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

NatureServe Conservation Status

Rounded Global Status Rank: G4 - Apparently Secure

Reasons: Spotty, moderately widespread distribution in west-coastal North America; possibly declining in some areas; possibly threatened by habitat alteration and degradation; apparently secure, but better information on current status is needed.

Intrinsic Vulnerability: Moderately vulnerable

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

IUCN Red List Assessment


Red List Category
LC
Least Concern

Red List Criteria

Version
3.1

Year Assessed
2013

Assessor/s
NatureServe

Reviewer/s
Smith, K. & Darwall, W.R.T.

Contributor/s

Justification
Listed as Least Concern because extent of occurrence, number of subpopulations, and population size are relatively large, and because the species probably is not declining fast enough to qualify for any of the threatened categories.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Global Short Term Trend: Relatively stable to decline of 30%

Comments: Trend over the past 10 years or three generations is uncertain but probably relatively stable or slowly declining. According to Moyle et al. (1995) and Moyle (2002), population numbers are unknown in California but are likely declining, coincident with the degradation of suitable spawning and rearing habitat in the lower reaches of larger rivers. Because these lampreys are easy to overlook, they may be more abundant than available information indicates (Moyle 2002). This species apparently is doing well in the Fraser River, British Columbia, possibly because sturgeon predators are heavily fished there (Beamish pers. comm.).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Population

Population
This species is represented by a fairly large number of occurrences (subpopulations). Lee et al. (1980) mapped approximately 27 collection sites, but the species likely occupies more streams than presently known (Moyle 2002).

Total adult population size is unknown but very large. This species may be very common locally, especially at the ammocoete stage, making up a large part of the stream biomass where present; as adults, abundance is difficult to monitor because the species is anadromous (Beamish pers. comm.). Little specific abundance information is available, and general comments regarding abundance are contradictory. According to Scott and Crossman (1973), this species is probably uncommon in British Columbia although more abundant to the south. However, Moyle et al. (1995) and Moyle (2002) reported that it was abundant in British Columbia, the center of the range, but has relatively few records from California, the southernmost portion of the range. In California, it is probably most abundant (but not observed in large numbers) in the Sacramento-San Joaquin river system (Moyle et al. 1989). The species is possibly sparse in Washington rivers, where few have been documented (Wydoski and Whitney 2003), and uncommon in Alaska (Mecklenburg et al. 2002).

In the Strait of Georgia, British Columbia, Beamish and Williams (1976) estimated 667,000-6,206,000 adult individuals in 1976, and 6,500,000 adults in 1979, with a corresponding average density of 27 ammocoetes/m² for the area in that year (Beamish and Youson 1987).

Trend over the past 10 years or three generations is uncertain but probably relatively stable or slowly declining. According to Moyle et al. (1995) and Moyle (2002), population numbers are unknown in California but are likely declining, coincident with the degradation of suitable spawning and rearing habitat in the lower reaches of larger rivers. Because these lampreys are easy to overlook, they may be more abundant than available information indicates (Moyle 2002). This species apparently is doing well in the Fraser River, British Columbia, possibly because sturgeon predators are heavily fished there (Beamish pers. comm.).

Population Trend
Unknown
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Threats

Comments: Specific threats and their effects are undefined. Potential threats include habitat alteration and degradation due to dams, diversions, pollution, channelization/dredging, urbanization, and other factors (Moyle et al. 1995). Renaud (1997) stated that the major cause of lamprey species declines in the Northern Hemisphere is habitat degradation through pollution and stream regulation (dams). Stream regulation has altered some habitats and prevented access to spawning grounds (Renaud 1997).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Major Threats
Specific threats and their effects are undefined. Potential threats include habitat alteration and degradation due to dams, diversions, pollution, channelization/dredging, urbanization, and other factors (Moyle et al. 1995). Renaud (1997) stated that the major cause of lamprey species declines in the Northern Hemisphere is habitat degradation through pollution and stream regulation (dams). Stream regulation has altered some habitats and prevented access to spawning grounds (Renaud 1997).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Not Evaluated
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Management

Global Protection: Unknown whether any occurrences are appropriately protected and managed

Comments: Unknown.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Conservation Actions

Conservation Actions
Conservation needs include: Determine the number of populations and abundance rangewide. Monitor selected populations throughout the range to determine trends. Investigate threats and their effects.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Relevance to Humans and Ecosystems

Benefits

Economic Uses

Comments: In the Fraser river plume, British Columbia, river lampreys kill an estimated 2-8 million salmon and 18-20 million herring annually (Beamish and Youson 1987).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Importance

fisheries: minor commercial; price category: unknown; price reliability:
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Names and Taxonomy

Taxonomy

Comments: Lampetra ayresii is now considered distinct from L. fluviatilis, its European analog (Vladykov and Follett 1958). It is genetically and morphologically similar to its satellite species, western brook lamprey (L. richardsoni), which overlaps in range and is an exclusively freshwater nonparasitic form (Mecklenburg et al. 2002). Specific name was formerly spelled "ayresi," but the original spelling ends with -ii, so ayresii is the correct spelling (Nelson et al. 2004); L. ayresi is still common in the literature.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!