Articles on this page are available in 1 other language: Arabic (16) (learn more)

Overview

Comprehensive Description

Biology

Inhabits brushy and vegetated, gravel-bottomed, sand-bottomed and mud-bottomed pools of creeks and small to medium rivers (Ref. 5723, 10294). Feeds on small fish (darters, madtoms, minnows), crayfish, and larger insects including dragonfly, mayfly, and stonefly nymphs (Ref. 10294).
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Distribution

North America: Gulf Slope from Apalachicola River drainage in Georgia to lower Mississippi River basin in Louisiana in the USA; St, Francis, Black, Arkansas, Red and upper Ouachita River drainage in Missouri and Arkansas in the USA.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

endemic to a single nation

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

National Distribution

United States

Origin: Native

Regularity: Regularly occurring

Currently: Present

Confidence: Confident

Type of Residency: Year-round

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Global Range: This species is widely distributed and common in Gulf slope drainages, above and below the Fall Line, from the Apalachicola River drainage, Georgia, west to the lower Mississippi River basin, Louisiana; and in the St. Francis, Black, Arkansas, Red, and upper Ouachita river drainages, Missouri and Arkansas (Page and Burr 1991). However, the populations west of the Mississippi River may actually represent A. rupestris or perhaps A. ariommus that has been introgressed by A. rupestris (Roe et al. 2008; see taxonomy comments).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Southeastern U.S.A.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Physical Description

Size

Maximum size: 220 mm TL
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Max. size

30.5 cm TL (male/unsexed; (Ref. 40637)); max. published weight: 820 g (Ref. 40637)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Length: 18 cm

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Type Information

Holotype for Ambloplites ariommus
Catalog Number: USNM 101305
Collection: Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Fishes
Collector(s): P. Viooca Jr.
Year Collected: 1935
Locality: Little Bogue Falia Creek 3 Miles No. of Covington, Louisiana, Louisiana, United States, North America
  • Holotype:
Creative Commons Attribution 3.0 (CC BY 3.0)

© Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Fishes

Source: National Museum of Natural History Image Collection

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Ecology

Habitat

Environment

demersal; freshwater
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Habitat Type: Freshwater

Comments: Streams with permanent flow, low turbidity, silt-free mud, or sand and gravel substrates throughout Gulf slope. In upland areas substrates are primarily gravel and rubble. Brushy and vegetated pools of creeks and small to medium rivers with substrate of mud, sand, or gravel (Page and Burr 1991).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Migration

Non-Migrant: No. All populations of this species make significant seasonal migrations.

Locally Migrant: No. No populations of this species make local extended movements (generally less than 200 km) at particular times of the year (e.g., to breeding or wintering grounds, to hibernation sites).

Locally Migrant: No. No populations of this species make annual migrations of over 200 km.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Ambloplites ariommus

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 4 barcode sequences available from BOLD and GenBank.  Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

CCTCTATTTAGTATTTGGTGCTTGGGCCGGAATAGTGGGCACAGCCCTAAGCCTACTAATTCGAGCAGAACTTAGCCAACCGGGTGCCCTCCTAGGAGACGACCAGATTTATAATGTAATTGTAACAGCACACGCCTTCGTAATAATTTTCTTTATAGTAATACCAATTATGATTGGGGGCTTTGGCAACTGACTAGTGCCACTAATGATCGGCGCCCCCGACATAGCTTTCCCCCGAATAAATAATATGAGCTTTTGACTCCTCCCCCCCTCTTTCCTTCTTCTACTTGCCTCTTCCGGAGTTGAAGCTGGGGCAGGGACCGGATGGACCGTTTACCCGCCTTTAGCCGGCAACCTAGCCCACGCAGGCGCATCTGTTGACCTAACCATCTTCTCCCTTCATCTTGCCGGGGTCTCTTCAATTCTAGGGGCCATTAACTTTATTACCACCATTATTAACATAAAACCTCCCGCCATCTCTCAGTACCAAACCCCCCTCTTTGTATGATCAGTTTTAATCACTGCCGTACTACTTTTACTTTCCCTACCAGTCCTCGCTGCGGGCATTACAATGCTCCTAACAGACCGAAATCTAAATACCACATTTTTTGACCCGGCAGGGGGAGGGGACCCCATTCTCTACCAACANNNN
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Statistics of barcoding coverage: Ambloplites ariommus

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 4
Specimens with Barcodes: 6
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Conservation

Conservation Status

National NatureServe Conservation Status

United States

Rounded National Status Rank: N5 - Secure

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

NatureServe Conservation Status

Rounded Global Status Rank: G5 - Secure

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Threats

Not Evaluated
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Wikipedia

Shadow bass

Shadow Bass From Comite River, near Olive Branch, Louisiana

The shadow bass (Ambloplites ariommus) is a species of freshwater fish in the sunfish family (Centrarchidae) of order Perciformes. It is native to Mississippi, Missouri, Arkansas, Louisiana, and Georgia.

A. ariommus reaches a maximum recorded overall length of 30 cm (12 in) and a maximum recorded weight of 820 g (1.8 lb).

Shadow bass Ambloplites ariommus (from here on shadow bass), is a member of the Centrarchids family or sunfish family and is closely related to the rock bass Ambloplites rupestris along with one more related species occurring naturally (Johnson et al. 2003). The shadow bass is native to the southeastern United States and is most common in Florida, Georgia, Louisiana, Mississippi, Alabama and two isolated populations in Arkansas and Missouri. The shadow bass inhabits small to medium size rivers and streams with permanent water flow and prefers cool water temperatures similar to smallmouth bass Microtperus dolomieu habitat. Management of the shadow bass was not conducted till the 1980s and still much management being done on shadow bass since most individuals value them below smallmouth bass, but with protection of pools and riffles with vegetated or bushy cover with substrates of gravel, mud, and sand (Roell et al. 2010).

Contents

Geographic distribution

The shadow bass' native range includes the southeastern United States from the Apalchicola River drainage in Georgia to the lower Mississippi basin in Louisiana. The two isolated populations in the St. Francis, Black Arkansas Red and upper Ouachita River Drainages in Missouri and Arkansas in the Ozark regions (Roe et al. 2008). In Tennessee the Shadow bass can be found in most drainages south of the Tennessee River. Other river drainages that shadow bass inhabit are Blackwater and Chattahoochee rivers in southern Georgia and northern Florida. The apparent absence of shadow bass in Black Belt streams is probably the result of low stream flow and poor water-quality conditions during the late summer when temperatures are high. Channelization is a possible factor in the distribution of the shadow bass in Mississippi river systems but results from Mareska et al. 2000. research proved no difference in the distribution of shadow bass.

Ecology

The shadow bass is a freshwater fish that inhabits a climate range of 38 degrees North and 29 degrees north in the United States. The shadow bass prefers slow-flowing water over substrates of silt-free mud, sand, gravel, and pebbles. Brushy and vegetated pools are preferred micro-habitat in most streams (Walsh and Harris 2004). Under cut banks and woody debris in small to medium sized rivers and streams are also preferred habitat. The quantitative diet of shadow bass consist mostly on small invertebrates mainly crayfish Order Decapoda when small less than three inches after three inches can begin feeding on small fish species such as darters, madtoms, and minnows (Roell et al. 2008). The main predator and competitor of the shadow bass is the smallmouth bass which inhabits the same micro-habitat and research was conducted by Walsh and Harris in 2004 on the introduction of rainbow trout Oncorhynchus mykiss in shadow bass habitat to measure competition between the species, the data showed no effect on shadow bass populations. Factors by humans that might attribute to population decline of the shadow bass channelization, sedimentation from logging, and habitat encroachment.

Life history

Not much research has been done on the life history of the shadow bass so reproductive age, clutch size, life span information is lacking and needs more research. The Shadow bass being a sunfish builds circular nest in the spring during the breeding season. The male shadow bass does the nest constructing, the females only obligation is to pick a suitable males nest and lay her eggs after that she departs. The male bass watches over the eggs till they hatch 3–5 days later.[1] The nests are often colonial, meaning several nest in one area. The preferred nesting sites are sandy pools with bushy vegetation. The world record was a hefty 1lb 13oz,caught in Arkansas. One trait of the shadow bass is its ability to change color to match its substrate background.

Current management

Through its range even for the two isolated population the shadow bass populations are not listed in any danger and the shadow bass is federally listed as G5 secure. Current management for the shadow bass in the case of the scenic rivers in Mississippi was to protects pools and prevent sediment pollution in areas of shadow bass populations (Mareska et al. 2000). Though in most places shadow bass are not consider a game fish and receive little management attention. In Missouri however, where shadow bass has a demand in the game fish market, biologists are conducing population studies and conducting estimates using mark and recapture methods and information for anglers to provide data to determine what if any angling restrictions need to apply to shadow bass fishing.

Management recommendations

Recommended management options for shadow bass would be first to estimate the population size in a given area. Best option since the bass prefer deep pools in moving water would be to conduct angler surveys and ask questions on size weight and location of individuals caught. Seining and mark and recapture estimates are advised in areas where this is feasible; in deeper areas where boat access is accomplishable electroshocking would be a good way to gather data on population numbers. Recommended sampling time should be in early to mid spring before the breeding season to limit stress on the fish. Use sampling equipment best suited for the area. Research main option there could be a lot more data on life history and population sizes based on long term research to see fluctuation within a population and what factors attributed to the fluctuations and how to manage those factors.

References

  1. ^ Walsh and Harris 2004

Bibliography

Roell, J.R., R.J. DisStefano. 2010. Effects of a Conservative Rock Bass Length Limit on Angler Participation, Sport Fish Populations, and Crayfish Prey in a Missouri Ozark Stream. NORTH AMERICAN JOURNAL OF FISHERIES MANAGEMENT. 30:552-564.

Roe, K.J., R.L. Mayden, P.M. Harris. 2008. Systematics and Zoogeography of the Rock Basses (Centrarchidae: Ambloplites). American Society Ichthyologist herpetologist. 4:858-867.

Walsh, M.G., D.l. Harris. 2004. Characteristics of Smallmouth Bass (Micropterus dolomieu) and Shadow Bass (Ambloplites ariommus) Populations in an Ozark Stream Before and After Rainbow Trout Introduction. Journal of Freshwater Ecology.4:587-596.

Johnson, R.L. C.F. Cavenaugh. 2003. Genetic similarity of shadow and Ozark basses (Ambloplites) as determined by mitochondrial DNA analysis. Journal of the Arkansas Academy of Science. 57:206-208.

Mareska, J.F., D.C. Jackson. 2000. Use of shadow bass stock characteristics to evaluate natural and scenic waterways in Mississippi. Proceedings of the Annual Conference Southeastern Association of Fish and Wildlife Agencies. 54:167-178.

Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

 

Source: Wikipedia

Unreviewed

Article rating from 0 people

Average rating: 2.5 of 5

Names and Taxonomy

Taxonomy

Comments: Ambloplites ariommus formerly was regarded as a subspecies of A. rupestris. The ariommus-rupestris intermediates reported from Missouri and Arkansas lowlands and northern Alabama could be referred to A. ariommus, based on morphological characters. The identity of Ambloplites in the Neosho River system and southeastern Missouri is "difficult to resolve, perhaps due to extensive introduction of mixed stocks of A. rupestris." See Lee et al. (1980) for primary literature citations.

Roe et al. (2008) noted that morphological, mitochondrial, and allozyme characters do not allow discrimination between A. rupestris and A. ariommus within the Interior Highlands; this may indicate that A. ariommus never occurred west of the Mississippi River, or it could indicate that if A. ariommus occurred in these drainages, it has now become introgressed with A. rupestris (Roe et al. 2008).

Roe et al. (2008) stated that the distinctiveness of Mobile Basin A. ariommus warrants further study using genetic evidence (that population might turn out to be a distinct species).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!