Overview

Comprehensive Description

Biology

Spends most of its time in the sea, usually close to shore (Ref. 27547). Enters estuaries of large rivers and moves far inland to spawn (Ref. 5723). Individuals larger than 48.3 cm feed mainly on fishes; smaller ones feed mainly on chironomids, but also takes small crustaceans, other insects and mollusks (Ref. 1998). Feeding ceases just before spawning (Ref. 1998). Excellent food fish that is sold fresh, smoked or frozen (Ref. 9988). Eggs marketed as caviar (Ref. 1998). In the past, the airbladder was made into isinglass (Ref. 27547).
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© WorldFish Center - FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Distribution

Range Description

At least two groups of white sturgeon occur in the lower Fraser between Mission and Hell's Gate and another in the middle Fraser between Hell’s Gate and the mouth of the Nechako River.

Fraser River subpopulations do not mix with the U.S. Regional population. Although it is known that some sub-adults spend time in the estuary (Veinott et al. 1999), Fraser River white sturgeon are not known to migrate further into the marine environment. There are no reports of white sturgeon in the Strait of Georgia off the Fraser River (Lane 1991).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Range Description

The Kootenai River subpopulation is a land-locked subpopulation restricted to approximately 270 km of the Kootenai River in Idaho and Montana (United States), and Kootenay Lake in British Columbia (Canada), primarily upstream from Cora Linn Dam at the outflow from Kootenay Lake.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Range Description

Restricted to the Nechako River and it?s tributary the Stuart River (these two have a combined stream length of about 400 km). However, sturgeon are not evenly dispersed throughout this length of river, but are clustered in suitable habitat.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Range Description

In the Fraser River drainage of Canada at least five distinct subpopulations of white sturgeon have been identified using two independent genetic techniques - mtDNA and microsatellite DNA (Nelson et al. 1999 and Pollard 2000). The Upper Fraser subpopulation is found in the Fraser River upstream of the Nechako River. Fraser River subpopulations do not mix with the U.S. Regional population.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Range Description

The largest component of the white sturgeon population occurs along the west coast of the United States and comprises subpopulations occurring in several river systems and rearing primarily within the Sacramento-San Joaquin and Columbia-Snake River basins. The species is also found in the Kootenai River (United States and Canada), the Fraser River drainage (Canada), and the Columbia River between Hugh Keenleyside Dam and the Canada-U.S. border.

There is evidence of emigration from the Sacramento and Columbia river systems based on out-of-system tag studies (PSMFC 1992). These included Chadwick (1959) who cited the recovery of a fish tagged in San Pablo Bay in 1954 and recovered in the Columbia River, and Kohlhorst et al. (1991) who noted that 11 white sturgeon tagged in San Pablo Bay (Sacramento River system) were caught in six river systems north of California, primarily the Umpqua River, Oregon (five tags recovered) and the Chehalis River, Washington (three tags). Also in this study, one tag return each was received from the Columbia River, Yaquina River and Tillamook Bay, Oregon and the Willapa River, Washington. More recently a fish originally tagged in the lower Columbia River was re-captured in the Sacramento River in 1997 (DeVore et al. 1999a). Population estimates of legal-sized and adult white sturgeon can vary dramatically (DeVore et al. 1999a, Schaffter and Kohlhorst 1999) but for the most part, this stock is generally believed to be healthy and stable.

The upper Columbia River white sturgeon subpopulation inhabits the Columbia River mainstem upstream from Grand Coulee Dam. In this area, the largest documented group of the species resides in the area between Hugh Keenleyside Dam and the Canada-U.S. border. Other remnant subpopulations occur, or are suspected, throughout the remainder of the drainage.

White sturgeon are found in the Fraser River mainstem from the estuary upstream at least as far as the Torpy River, a distance of over 1,000 km (R.L.&L. Environmental Services Ltd. 2000). They are also found in a major tributary of the Fraser, the Nechako River and it’s tributary the Stuart River (these two have a combined stream length of about 400 km). However, sturgeon are not evenly dispersed throughout this length of river, but are clustered in suitable habitat.The Kootenai River subpopulation inhabits and migrates freely in the Kootenai River from Kootenai Falls in Montana (United States) downstream into Kootenay Lake, British Columbia (Canada). It is restricted to approximately 270 km of the Kootenai River and Kootenay Lake.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Range Description

Upper Columbia River white sturgeon subpopulation inhabits the Columbia River mainstem upstream from Grand Coulee Dam. In this area, the largest documented group of the species resides in the area between Hugh Keenleyside Dam and the Canada–U.S. border. Other remnant subpopulations occur, or are suspected, throughout the remainder of the drainage.

Radio telemetry has shown that white sturgeon occurring downstream from Keenleyside Dam in Canada are typically either sedentary or localized in their patterns of movement. However, some fish have moved downstream into Lake Roosevelt in Washington State, at least as far downstream as Kettle Falls (RL&L 1995). Similarly, fish tagged in Lake Roosevelt have been recaptured upstream during sampling operations in Canada (BC Ministry of Water, Land and Air Protection, data on file). This evidence of trans-boundary migration suggests that white sturgeon from Keenleyside Dam in Canada to Lake Roosevelt in the U.S. form the same subpopulation.

Given the exchange of upper Columbia River white sturgeon across the Canada–U.S. border, evidence supporting the concept of a distinct white sturgeon subpopulation in the upper Columbia River can be derived from Anders et al. (2000, in prep). White sturgeon mtDNA haplotypes were compared among 13 localities, and six large river systems over the range of the species (Columbia, Snake, Kootenai, Fraser, Nechako, Sacramento rivers) using pairwise frequency-distribution comparisons (Monte-Carlo simulations using 10,000 iterations of exact, weighted, Pearson chi-square tests). Haplotype frequency distributions were significantly different, or nearly so (P=0.09, 0.06, 0.06 and
Countries
  • Native
    • Canada
    • United States
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Geographic Range

The White Sturgeon is found on the Pacific slope of North America from the Aleutian Islands, AK to Baja, CA. It is anadromous fish, spending most of its life in sea near the shore and can be found in estuaries of large rivers. It migrates far inland in large rivers to spawn. (Kee, et. al. 1981; Boschung, 1985).

Biogeographic Regions: nearctic (Native )

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Distribution

British Columbia, Canadian Exclusive Economic Zone [Pacific part], Coastal Waters of Southeast Alaska and British Columbia, FAO fishing area 67, North East Pacific, North Pacific
Creative Commons Attribution 3.0 (CC BY 3.0)

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

occurs (regularly, as a native taxon) in multiple nations

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

National Distribution

Canada

Origin: Native

Regularity: Regularly occurring

Currently: Present

Confidence: Confident

Type of Residency: Year-round

United States

Origin: Native

Regularity: Regularly occurring

Currently: Present

Confidence: Confident

Type of Residency: Year-round

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Global Range: (>2,500,000 square km (greater than 1,000,000 square miles)) Pacific slope of North America from Aleutian Islands, Alaska, to Monterey, California (Lee et al. 1980). A land-locked population occurs in upper Columbia River system. Significant populations occur in the Sacramento, Columbia, and Fraser rivers. Introduced in lower Colorado River, Arizona (Page and Burr 1991).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Historic Range:
U.S.A. (ID, MT), Canada (B.C.)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Eastern Pacific: Alaska Bay to Monterey, California, USA. Landlocked in Columbia River drainage, Montana, and perhaps Lake Shasta in California, USA. Translocated to lower Colorado River, Arizona in USA. Reported from northern Baja California, Mexico (Ref. 2850, 27436). Considered vulnerable in Canada (Ref. 6866). International trade restricted (CITES II, since 1.4.98).
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© WorldFish Center - FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Physical Description

Morphology

Physical Description

There are several distinguishing characteristics of the white sturgeon. Its body is elongate and cylindrical and can be large, with sizes as large as 3.8 to 6 meters and weights as high as 630 kg.

It has no scales but five rows of "scutes" along the body. There are 11-14 plates in front of the single dorsal fin, 38-48 plates from the head along the central caudal axis, and 9-12 from the head to the pelvic fins. Dorsal color is light gray while the ventral surface is white.

The mouth is ventral, moderate in size and directed downward. The white sturgeon has no teeth, instead using its 'vacuum cleaner' like mouth that is capable of siphoning up food. This fish is recognized by its short broad snout with four barbels closer to the tip of the snout than the mouth. (Hart, 1973; Pacific States Marine Fisheries Commission 1996).

Range mass: 630 (high) kg.

Other Physical Features: ectothermic ; heterothermic ; bilateral symmetry

Sexual Dimorphism: sexes alike

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Dorsal spines (total): 0; Dorsal soft rays (total): 44 - 48; Analsoft rays: 28 - 31
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© WorldFish Center - FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Size

Length: 340 cm

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Max. size

610 cm TL (male/unsexed; (Ref. 1998)); max. published weight: 816.0 kg (Ref. 27436); max. reported age: 104 years (Ref. 39377)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© WorldFish Center - FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Diagnostic Description

Distinguished by the 2 rows of 4 to 8 bony plates on a midventral line between the anus and anal fin, and about 45 rays in the dorsal fin (Ref. 27547). Gray or brownish above, paler below; fins gray (Ref. 27547).
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© WorldFish Center - FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Ecology

Habitat

Columbia River Demersal Habitat

This taxon is one of a number of demersal species in the Columbia River system. Demersal river fish are found at the river bottom, feeding on benthos and zooplankton. The Columbia River is the largest North American watercourse by volume that discharges to the Pacific Ocean. With headwaters at Columbia Lake, in Canadian British Columbia, the course of the river has a length of approximately 2000 kilometers and a drainage basin that includes most of the land area of Washington, Oregon and Idaho as well as parts of four other U.S. states and two Canadian provinces.

The Columbia River Basin of northwestern North America is an important habitat for Acipenser transmontanus. The Columbia River is the largest North American watercourse by volume that discharges to the Pacific Ocean. With headwaters at Columbia Lake, in Canadian British Columbia, the course of the river has a length of approximately 2000 kilometers and a drainage basin that includes most of the land area of Washington, Oregon and Idaho as well as parts of four other U.S. states and two Canadian provinces.

The hydrology and aquatic habitat of the Columbia River basin has been adversely altered by numerous large dams. There are over 250 reservoirs and around 150 hydroelectric projects in the basin, including 18 mainstem dams on the Columbia and its main tributary, the Snake River.

Water quality in the Columbia River has deteriorated over the last century, due to agricultural runoff and logging practices, as well as water diversions that tend to concentrate pollutants in the reduced water volume. For example nitrate levels in the Columbia generally tripled in the period from the mid 1960s to the mid 1980s, increasing from a typical level of one to three milligrams per liter. Considerable loading of herbicides and pesticides also has occurred over the last 70 years, chiefly due to agricultural land conversion and emphasis upon maximizing crop yields.

Heavy metal concentrations in sediment and in fish tissue had become an issue in the latter half of the twentieth century; however, considerable progress has been made beginning in the 1980s with implementation of provisions of the U.S.Clean Water Act, involving attention to smelter and paper mill discharges along the Columbia.

Some large demersal fish species occurring in the Columbia Basin are the 610 centimeter (cm) white sturgeon (Acipenser transmontanus), the 76 cm Pacific lamprey (Lampetra tridentata); the 55 cm Brown bullhead (Ameiurus nebolosus); the 61 cm largescale sucker (Catostomus macrocheilus); the 64 cm longnose sucker (Catostomus catostomus catostomus); and the 65 cm Utah sucker (Catostomus ardens).
Creative Commons Attribution 3.0 (CC BY 3.0)

© C.Michael Hogan

Supplier: C. Michael Hogan

Trusted

Article rating from 1 person

Average rating: 5.0 of 5

Columbia River habitat

The Columbia River Basin of northwestern North America is an important habitat for Acipenser transmontanus. The Columbia River is the largest North American watercourse by volume that discharges to the Pacific Ocean. With headwaters at Columbia Lake, in Canadian British Columbia, the course of the river has a length of approximately 2000 kilometers and a drainage basin that includes most of the land area of Washington, Oregon and Idaho as well as parts of four other U.S. states and two Canadian provinces.

The hydrology and aquatic habitat of the Columbia River basin has been adversely altered by numerous large dams. There are over 250 reservoirs and around 150 hydroelectric projects in the basin, including 18 mainstem dams on the Columbia and its main tributary, the Snake River.

Water quality has deteriorated over the last century, due to agricultural runoff and logging practices, as well as water diversions that tend to concentrate pollutants in the reduced water volume. For example nitrate levels in the Columbia generally tripled in the period from the mid 1960s to the mid 1980s, increasing from a typical level of one to three milligrams per liter. Considerable loading of herbicides and pesticides also has occurred over the last 70 years, chiefly due to agricultural land conversion and emphasis upon maximizing crop yields.

Heavy metal concentrations in sediment and in fish tissue had become an issue in the latter half of the twentieth century; however, considerable progress has been made beginning in the 1980s with implementation of provisions of the U.S.Clean Water Act, involving attention to smelter and paper mill discharges along the Columbia.

Other large demersal fish species occurring in the Columbia Basin are the 76 cm Pacific lamprey (Lampetra tridentata); the 55 cm Brown bullhead (Ameiurus nebolosus); the 61 cm largescale sucker (Catostomus macrocheilus); the 64 cm longnose sucker (Catostomus catostomus catostomus); and the 65 cm Utah sucker (Catostomus ardens). Other large benthopelagic fish in the Columbia are the 63 cm northern pikeminnow (Ptychocheilus oregonensis) and the 45 cm Tui chub (Gila bicolor).
  • C.Michael Hogan. 2012. Columbia River. Eds. P.Saundry & C.Cleveland. Encyclopedia of Earth. National Council for Science and the Environment. Washington DC www.eoearth.org/article/Columbia_River?topic=78166
  • Fishbase. 2010. Fish species in the Columbia River Basin
Creative Commons Attribution 3.0 (CC BY 3.0)

© C.Michael Hogan

Supplier: C. Michael Hogan

Trusted

Article rating from 1 person

Average rating: 5.0 of 5

Habitat and Ecology

Habitat and Ecology
Although it is known that some sub-adults spend time in the estuary (Veinott et al. 1999), Fraser River white sturgeon are not known to migrate further into the marine environment. There are no reports of white sturgeon in the Strait of Georgia off the Fraser River (Lane 1991).

In the river below Hell’s Gate some females may spawn as young as 18 and males at 14 years of age. Generation length in the regional subpopulation downstream of the Nechako appears to be in the range of 35–40 years of age.

Systems
  • Freshwater
  • Marine
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Habitat and Ecology

Habitat and Ecology
This subpopulation is land-locked and is restricted to freshwater habitats.

Systems
  • Freshwater
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Habitat and Ecology

Habitat and Ecology
Restricted to freshwater habitat in the Nechako River and its tributary the Stuart River.

Systems
  • Freshwater
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Habitat and Ecology

Habitat and Ecology
Restricted to freshwater in the upper Fraser River only.

Systems
  • Freshwater
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Habitat and Ecology

Habitat and Ecology
Generally anadromous, but some subpopulations are landlocked and spend their entire life cycle in freshwater. Acipenser transmontanus is the largest freshwater fish species in North America. The largest white sturgeon on record weighed approximately 682 kg and was taken from the Snake River, Idaho in 1898. Individuals from landlocked subpopulations tend to be smaller.

Systems
  • Freshwater
  • Marine
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Habitat and Ecology

Habitat and Ecology
Restricted to freshwater habitat in the upper Columbia River.

Systems
  • Freshwater
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Habitat

Historically, white sturgeon spent their life in several habitats; streams, rivers, estuaries, and marine waters. They are anadromous fish but may spend much or all of their lives in fresh water if they cannot reach the sea (Hart 1973). White sturgeon historically occurred on the Pacific Coast, reproducing in at least three large river systems, including Sacramento-San Joaquin River in California, the Columbia River basin in the Pacific Northwest, and the Fraser River system in British Columbia (Fish and Wildlife Service, Interior, 1994). The building of dams along the rivers has impacted the populations of white sturgeons by creating landlocked populations and destroying spawning grounds.

White sturgeon are still distributed throughout the river systems of the Pacific northwest, but these populations are isolated and their migration is limited within the series of pools and lakes that make up these new dammed rivers (Pacific States Marine Fisheries Commission, 2000)

Aquatic Biomes: rivers and streams; coastal

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Habitat Type: Freshwater

Comments: Found at sea, usually near shore, and in large cool rivers or streams. Spawns probably either over deep gravel riffles or in deep holes with swift currents and rock bottoms (Wydoski and Whitney 1979). In the Fraser River (river km 98-181), British Columbia, six spawning sites were identified; five were in side channels within the meandering reach (km 98-143); one spawning site was in the main channel in the confined reach (km 145-181) (Perrin et al. 2003). Migrates upstream to spawn, moves back downstream when spawning is completed.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Environment

demersal; anadromous (Ref. 51243); freshwater; brackish; marine; depth range 1 - 122 m (Ref. 27547)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© WorldFish Center - FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Migration

Non-Migrant: No. All populations of this species make significant seasonal migrations.

Locally Migrant: Yes. At least some populations of this species make local extended movements (generally less than 200 km) at particular times of the year (e.g., to breeding or wintering grounds, to hibernation sites).

Locally Migrant: Yes. At least some populations of this species make annual migrations of over 200 km.

Some are anadromous and make extensive saltwater migrations. Many move more locally from estuaries to fresh water, or farther inland within fresh water, to spawn.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Anadromous. Fish that ascend rivers to spawn, as salmon and hilsa do. Sub-division of diadromous. Migrations should be cyclical and predictable and cover more than 100 km.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© WorldFish Center - FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Trophic Strategy

Food Habits

White Sturgeon have been described as opportunistic feeders, feeding on the bottom with their long snouts and using their barbels to detect food. When small they feed on clams, mussels, crayfish, worms, and fish eggs. At a larger size, they prey on fish such as smelt, anchovies, lamprey, shad and salmon.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Spends most of its time in the sea, usually close to shore (Ref. 27547). Enters estuaries of large rivers and moves far inland to spawn (Ref. 5723). Individuals larger than 48.3 cm feed mainly on fishes; smaller ones feed mainly on chironomids, but also takes small crustaceans, other insects and mollusks (Ref. 1998). Feeding ceases just before spawning (Ref. 1998).
  • Radtke, L.D. 1966 Distribution of smelt, juvenile sturgeon, and starry flounder in the Sacramento-San Joaquin Delta with observations on food of sturgeon. p. 115-129. In J. L. Turner and D. W. Kelly (comp.) Ecological studies of the Sacramento-San Joaquin Delta. Part II Fishes of the Delta. (Ref. 9668)   http://www.fishbase.org/references/FBRefSummary.php?id=9668&speccode=2592 External link.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© WorldFish Center - FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Comments: A bottom feeder. Young feed mostly on the larvae of aquatic insects, crustaceans, and molluscs. A significant portion of the diet of larger sturgeon consists of fish.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Diseases and Parasites

Epitheliocystis. Bacterial diseases
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© WorldFish Center - FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Population Biology

Number of Occurrences

Note: For many non-migratory species, occurrences are roughly equivalent to populations.

Estimated Number of Occurrences: 6 - 20

Comments: Lee et al. (1980) mapped approximately 24 collection sites in 17 waterways.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Global Abundance

10,000 to >1,000,000 individuals

Comments: Abundant within portions of the range. Commercial catch has ranged from 10,000 to 50,000 lbs/yr recently.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Life History and Behavior

Life Cycle

Adults return to the sea after spawning (Ref. 27547). Spawning frequency interval every 4 years for younger females and every 10-11 years in older females (Ref. 1998).
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© WorldFish Center - FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Life Expectancy

Lifespan/Longevity

Average lifespan

Status: wild:
100.0 years.

Average lifespan

Status: wild:
80.0 years.

Average lifespan

Status: wild:
82.0 years.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Lifespan, longevity, and ageing

Maximum longevity: 104 years (wild)
Creative Commons Attribution 3.0 (CC BY 3.0)

© Joao Pedro de Magalhaes

Source: AnAge

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Reproduction

Reproduction

The exact reproductive window for white sturgeon is not known, however for sturgeons in general the males reproduce for 10 to 20 years and females for 15 to 25 years. The size or age of maturity is variable, and spawning occurs when the physical environment permits vitellogenesis (egg development) and cues ovulation. Landlocked sturgeons have been observed to spawn during periods of peak river flow with high water velocities that disperse and prevent clumping of the eggs. White sturgeon are broadcast spawners because they release their eggs and sperm in fast water. Information from Fish and Wildlife Service (1994)

Average age at sexual or reproductive maturity (male)

Sex: male:
6022 days.

Average age at sexual or reproductive maturity (female)

Sex: female:
8212 days.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

In the Columbia River, spawns May-July (Wydoski and Whitney 1979). In California, spawning apparently occurs between mid-March and early June (Moyle 1976). Spawning occurs at intervals of 4 to 11 years. Larvae hatch from eggs in 1-2 weeks. Males may reach sexual maturity in about 9 years, females in 13-16 years (Wydoski and Whitney 1979). May live over 100 years.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Acipenser transmontanus

The following is a representative barcode sequence, the centroid of all available sequences for this species. 

 
There are 7 barcode sequences available from BOLD and GenBank.  Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen and other sequences.
 
GBGC0011-06|AB042837|Acipenser transmontanus| ACCCGTTGATTCTTTTCTACTAACCACAAAGATATTGGCACCCTGTATTTAGTATTTGGTGCCTGAGCAGGCATAGTCGGCACAGCCCTC---AGCCTTCTGATCCGTGCCGAACTGAGCCAACCCGGTGCCTTGCTTGGCGAT---GACCAGATCTACAATGTTATCGTTACAGCCCACGCCTTTGTCATGATCTTCTTTATAGTAATACCCATCATAATTGGCGGATTCGGAAACTGACTGGTCCCCCTAATA---ATTGGAGCCCCAGACATGGCATTCCCTCGCATGAACAATATGAGCTTCTGGCTCCTACCCCCATCCTTCCTACTCCTTTTGGCCTCCTCTGGGGTAGAGGCCGGGGCCGGCACAGGGTGAACTGTTTACCCCCCACTGGCGGGAAACCTGGCCCATGCAGGAGCCTCTGTAGACCTA---ACCATTTTCTCCCTCCACCTGGCCGGGGTGTCGTCCATTTTAGGAGCTATTAATTTTATTACCACAATTATCAACATGAAACCCCCCGCAGTATCCCAGTATCAGACACCTCTATTTGTGTGATCTGTATTAATCACGGCCGTACTTCTCCTACTGTCACTGCCAGTGCTAGCTGCG---GGAATCACAATACTCCTAACAGACCGGAATTTAAACACCACCTTCTTTGACCCAGCCGGAGGAGGAGACCCCATCCTCTACCAACACCTATTTTGATTCTTTGGCCACCCAGAAGTGTACATTCTAATTCTACCAGGATTCGGCATGATCTCCCACATTGTAGCATACTATGCCGGCAAAAAA---GAACCTTTTGGTTACATAGGAATAGTATGGGCTATAATGGCTATTGGACTACTAGGCTTTATCGTGTGAGCTCATCACATATTCACAGTTGGGATGG 
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Statistics of barcoding coverage: Acipenser transmontanus

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 7
Species: 10
Species With Barcodes: 1

Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Conservation

Conservation Status

IUCN Red List Assessment


Red List Category
VU
Vulnerable

Red List Criteria
A2abc

Version
3.1

Year Assessed
2004

Assessor/s
Down, T. & Ptolemy, J. (Ministry of Water, Land & Air Protection, Canada)

Reviewer/s
St. Pierre, R. & Pourkazemi, M. (Sturgeon Red List Authority)

Justification
The three white sturgeon groups in the mainstem of the lower Fraser River up to the Nechako River are considered together as the Fraser River regional subpopulation.

In the lower Fraser recreational angler catch-per-unit effort of sub-legal size fish (50–100 cm) fell from 0.34 to 0.17 fish per trip between 1985 and 1990 (Inglis and Rosenau 1994). In another study standardized multi-panel gill nets set at the same site at the same time of year showed a similar reduction from 1985–87 to 1992–93 (Lane et al. 1994). A comparison of the fish community in the lower Fraser between 1972–73 and 1993–94 also showed an apparent decrease in white sturgeon abundance (Richardson et al. 2000). The catch-per-effort, for assessment sampling in the Nechako River, declined significantly between 1982 and 1999 (Korman and Walters 2000).

During the summer/fall period of 1993 and 1994 there was an unexplained die-off of adult white sturgeon in the lower Fraser River (McAdam 1995). These episodes are worrisome, as all fish observed were large adults. The recovered carcasses (38) ranged in size from 2.16 to 3.86 m total length (mean = 3.18) and were primarily female. The age of the smallest fish was estimated at 27–30 years.

Area of occupancy has no doubt been reduced in the lower mainstem due to the alienation of side channels from dyking activity, the infolding of sloughs and wetlands, development and industrial activity. The loss of sloughs, side channels and other low velocity backwater areas has decreased available juvenile rearing habitat. Loss of side channels may reduce spawning habitat availability as well.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

IUCN Red List Assessment


Red List Category
EN
Endangered

Red List Criteria
B1ab(i,v); C1

Version
3.1

Year Assessed
2004

Assessor/s
Duke, S. (U.S. Fish & Wildlife Service)

Reviewer/s
St. Pierre, R. & Pourkazemi, M. (Sturgeon Red List Authority)

Justification
A natural barrier at Bonnington Falls downstream of Kootenay Lake has isolated this subpopulation from other white sturgeon subpopulations in the Columbia River basin since the last glacial age approximately 10,000 years ago. The subpopulation is restricted to approximately 270 km of the Kootenai River and Kootenay Lake.

The Kootenai River subpopulation of white sturgeon has been in general decline since the mid-1960's (Apperson and Anders 1991, Duke et al. 1999). The remaining wild population is comprised primarily of adult sturgeon older than 25 years, with very little recruitment observed in the wild population since the mid-1970's (Duke et al. 1999, Ireland et al. 2000). In 1997, there were an estimated 1,468 adults (95% CI: 740 to 2,197) and 17 juvenile white sturgeon (Paragamian et al. 1997).

The Kootenai River white sturgeon recovery plan describes a series of 46 specific conservation measures in the United States and Canada that are believed necessary to recover the endangered white sturgeon. Recovery objectives are to re-establish successful reproduction in the wild by increasing Kootenai River flows and producing hatchery-reared juveniles over the next 10 years to prevent extinction. Based on ongoing implementation of the recovery actions, it is currently unknown whether flow augmentation will be effective in restoring successful natural reproduction in the near future, consequently it is projected that the wild adult Kootenai River white sturgeon subpopulation will decline well into the future.

History
  • 1996
    Endangered
    (Baillie and Groombridge 1996)
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

IUCN Red List Assessment


Red List Category
CR
Critically Endangered

Red List Criteria
E

Version
3.1

Year Assessed
2004

Assessor/s
Down, T. & Ptolemy, J. (Ministry of Water, Land & Air Protection, Canada)

Reviewer/s
St. Pierre, R. & Pourkazemi, M. (Sturgeon Red List Authority)

Justification
A recent analysis (Korman and Walters 2000), using a population dynamics model for the Nechako River subpopulation of white sturgeon, indicates this subpopulation will be effectively extinct within 20 to 30 years (at current rates of decline). "Effectively extinct" was defined as
Mark recapture estimates for the subpopulation (R.L. and L Environmental Services Ltd. 2000) estimate the current population as 571 (95% CI = 421?890). In the Nechako, flow reduction has reduced depth and the amount of habitat available in side channels and backwaters.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

IUCN Red List Assessment


Red List Category
EN
Endangered

Red List Criteria
B1ab(ii,iii); D

Version
3.1

Year Assessed
2004

Assessor/s
Down, T. & Ptolemy, J. (Ministry of Water, Land & Air Protection, Canada)

Reviewer/s
St. Pierre, R. & Pourkazemi, M. (Sturgeon Red List Authority)

Justification
This distinct subpopulation of white sturgeon occurs only in the upper Fraser River, upstream of the Nechako River. A preliminary estimate from work being done by the Lheidli T’enneh First Nation (Yarmish and Toth 2001) for shows a subpopulation size of 255 (95% CI = 158–352). This preliminary population estimate may be skewed by the high recapture rate of individuals found in known areas of congregation. However, after extensive sampling, investigators do not believe the population can be larger than a few hundred individuals > 50 cm in length (Yarmish pers. comm.).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

IUCN Red List Assessment


Red List Category
LC
Least Concern

Red List Criteria

Version
3.1

Year Assessed
2004

Assessor/s
Duke, S. (USF&WS), Down, T., Ptolemy, J., Hammond, J. & Spence, C. (Ministry of Water, Land & Air Protection, Canada)

Reviewer/s
St. Pierre, R. & Pourkazemi, M. (Sturgeon Red List Authority)

Contributor/s

Justification
In 1996, the IUCN SSC Sturgeon Specialist Group assessed the white sturgeon as Lower Risk, near threatened (LR/nt). A re-examination of all the data available for this species has resulted in it being downgraded to Least Concern.

Some subpopulations of white sturgeon are of conservation concern:

1. A recent analysis using a population dynamics model for the Nechako River subpopulation has indicated more than 50% probability of extinction in the wild within the next 20–30 years if the current decline rates continue. The subpopulation is Critically Endangered.

2. The subpopulation from the upper Columbia River is showing major signs of recruitment failure. It is assessed as Critically Endangered.

3. The Kootenai River subpopulation has been in general decline since the mid-1960's and the remaining wild subpopulation is comprised primarily of adult sturgeon older than 25 years, with very little recruitment observed in the wild since the mid-1970's. It is currently assessed as Endangered.

4. The Upper Fraser River subpopulation has a restricted range and is estimated to have no more than 250 mature adults remaining. The subpopulation is Endangered.

5. The Fraser regional subpopulation has declined substantially since the 1980s and is assessed as Vulnerable.

However, the majority of the global population occurs along the west coast of the United States, occurring in several river systems and rearing primarily within the Sacramento-San Joaquin and Columbia-Snake River basins. Within this range, white sturgeon subpopulations enjoy relatively large, albeit fluctuating, adult populations and in some areas, substantial and sustainable recreational and commercial fisheries. Although some impounded reaches show relatively low recruitment and productivity (along with limited unidirectional gene flow), in general this regional population of white sturgeon is still widespread and abundant. The species is considered Least Concern (LC) at this time.

History
  • 1996
    Lower Risk/near threatened
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

IUCN Red List Assessment


Red List Category
CR
Critically Endangered

Red List Criteria
A3b; E

Version
3.1

Year Assessed
2004

Assessor/s
Hammond, J. & Spence, C. (Ministry of Water, Land & Air Protection, Canada)

Reviewer/s
St. Pierre, R. & Pourkazemi, M. (Sturgeon Red List Authority)

Justification
Upper Columbia white sturgeon were isolated from lower Columbia River stocks in the United States in 1941 following the construction of Grand Coulee Dam and related formation of Lake Roosevelt. Kettle Falls in Washington State is thought to have formed a seasonal barrier to white sturgeon migration prior to its inundation by Lake Roosevelt. Construction of Keenleyside, Mica, and Revelstoke dams on the mainstem Columbia River, Brilliant Dam on the lower Kootenay River, and Waneta Dam on the lower Pend d'Oreille River further fragmented the population and altered the natural river regime. In addition, the impoundments created by these dams flooded the riverine system, altering or eliminating critical sturgeon habitats, changing water quality and generally reducing system productivity. Dam construction effects were exacerbated by additional impacts such as pollution and waterfront developments.

Despite the regularity of spawning events, age structure analyses show that recruitment began to decline in 1969, and has failed entirely since 1985 (RL&L 1995).

Without intervention, white sturgeon in the upper Columbia River will follow a continuing decline and be driven to extinction within three generations. This is based on a generation time of 40–45 years, fish under the age of 20 are virtually absent from subpopulation, and the maximum age of individuals is in the order of 70 years. Based on these parameters, and continuing decline assuming that recruitment failure continues indefinitely, the last individuals in the subpopulation can be expected to reach extinction in about 50 years. Functional extinction will be reached much sooner.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Conservation Status

In 1994, the population of White Sturgeon located in the Kootenai river was granted endangered status. The population has been declining since the 1960's and there has been a complete lack of recruitment of breeding juveniles in the population since 1974. The decline corresponds to the opening of the Libby Dam in Montana and possibly from poor water quality and the effects of contaminants (Fish and Wildlife Service 1994).

Joint efforts between Canada and the United States are underway to address the needs of the Kootenai population by developing a regional recovery strategy (Duke, 2000).

US Federal List: endangered

IUCN Red List of Threatened Species: critically endangered

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

National NatureServe Conservation Status

Canada

Rounded National Status Rank: N2 - Imperiled

United States

Rounded National Status Rank: N4 - Apparently Secure

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

NatureServe Conservation Status

Rounded Global Status Rank: G4 - Apparently Secure

Reasons: Large range along the eastern Pacific Ocean; depleted to very low population levels in the early 1900s; has since rebounded, but spawns in relatively few river systems; some populations exhibit very low natural recruitment due to anthropogenic changes in river conditions.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Current Listing Status Summary

Status: Endangered
Date Listed: 09/06/1994
Lead Region:   Pacific Region (Region 1) 
Where Listed: U.S.A. (ID, MT), Canada (B.C.), (Kootenai R. system)


Population detail:

Population location: U.S.A. (ID, MT), Canada (B.C.), (Kootenai R. system)
Listing status: E

For most current information and documents related to the conservation status and management of Acipenser transmontanus , see its USFWS Species Profile

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Population

Population
Good information documenting historic population or subpopulation size decline does not exist. Records prior to 1900 (Semakula and Larkin 1968, Echols 1995) indicate annual sturgeon catches in the commercial fishery on the lower Fraser peaked at about 454,000 kg in 1897. The fishery collapsed in 1900, revived slightly in 1907, and collapsed again in 1917. Since then the commercial harvest has rarely exceeded 22,000 kg and during the 1965–75 period was about 12,000 kg per annum. Much of the commercial sturgeon catch was incidental to the salmon fishery although there may have been a directed fishery at the turn of the 20th century. This makes it difficult to compare the historical catch to more recent catches due to the changes in fishing patterns that have occurred.

Mark recapture estimates for the subpopulation (R.L. & L Environmental Services Ltd. 2000) show a population size of 22,000 (95% CI = 9,800–70,700). Length frequency and age distribution in the mainstem subpopulation appears relatively normal with most fish younger than age 20 (R.L. & L. Environmental Services Ltd. 2000). Fish
RL&L used a size of > 150 cm (called oversize) to separate adult individuals from sub-adults and juveniles. On this basis, 45% of the fish sampled in the lower Fraser were estimated to be adult fish; 37% in the canyon section were adults; and 20% of the subpopulation between Hell’s Gate and the Nechako. Overall, total number of adult white sturgeon in the lower Fraser River is estimated to be 8,876 fish or about 40% of the subpopulation.

RL&L found the sex ratio was skewed to males and varied from 4–4.5:1 below Hell’s Gate, to 7.6:1 in the middle Fraser. Fewer than 10% of the females and 12% of the males examined in the adult size class were in the late reproductive stages, indicating that the proportion of reproductively mature individuals in a given year is quite low. Limited data from an earlier study based on analysis of pectoral fin rays indicated intervals between spawning in the lower Fraser vary from 4–9 years (Semakula and Larkin 1968).

Population Trend
Decreasing
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Population

Population
The Kootenai River subpopulation of white sturgeon has been in general decline since the mid-1960's (Apperson and Anders 1991, Duke et al. 1999). The remaining wild population is comprised primarily of adult sturgeon older than 25 years, with very little recruitment observed in the wild population since the mid-1970's (Duke et al. 1999, Ireland et al. 2000). In 1997, there were an estimated 1,468 adults (95% CI: 740 to 2,197) and 17 juvenile white sturgeon (Paragamian et al. 1997).

Beginning in 1991 prior to official action under the Endangered Species Act, the U.S. Army Corps of Engineers and Bonneville Power Administration provided Kootenai River flows from Libby Dam to aid Kootenai River white sturgeon recruitment. These flows, considered experimental from 1991 through 1995, were intended to identify various factors limiting successful reproduction of Kootenai River white sturgeon and help achieve recovery. Beginning in 1995, there was acknowledgment that an adaptive approach was needed since the precise relationship between annual timing, magnitude, temperature, and duration of flows downstream of Libby Dam necessary for successful sturgeon reproduction had not been demonstrated. Since that time, the operation of Libby Dam has included a spring refill period depending upon runoff forecasts, for conservation storage following drafting during the winter flood control season in an attempt to better mimic natural flow regime more closely (Duke et al. 1999). To date, the increased Kootenai River flows provided through the flow augmentation program has resulted in documented spawning each year but not survival beyond the egg stage. Consequently natural recruitment has not been significantly restored. Only a total of 18 wild juvenile white sturgeon have been collected since 1993, with the largest year class appearing to be 1991 with ten wild recruits. It is currently unknown whether flow augmentation will be effective in restoring successful natural reproduction in the near future, consequently it is projected that the wild adult Kootenai River white sturgeon subpopulation will decline well into the future.

Population Trend
Decreasing
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Population

Population
The preliminary estimate for first spawning in females of the mid-river population is late 20's with males possibly reaching maturity before 20 years. In the Nechako River preliminary information indicates females may not reach maturity until their late 30?s, or older, and males may not spawn until their early 40?s (this estimate may be skewed by the lack of younger fish in the population). The oldest fish sampled was 88 years of age. Generation length in the Nechako subpopulation could be 50 to 55 years.

Mark recapture estimates for the Nechako subpopulation (R.L. & L Environmental Services Ltd. 2000) estimate the subpopulation at 571 (95% CI = 421?890). Very few fish less than 30 years of age were sampled, indicating a near total recruitment failure. Only 4% of the individuals sampled were in the juvenile size class (less than 100 cm total length), in spite of a directed sampling effort on this life stage.

RL&L used a size of > 150 cm (called oversize) to separate adult individuals from sub-adults and juveniles. On this basis, 80% of the fish sampled in the Nechako subpopulation were in the adult size class. RL&L found the sex ratio was skewed 2:1 to males in this subpopulation. Fewer than 10% of the females and 12% of the males examined in the adult size class were in the late reproductive stages, indicating that the proportion of reproductively mature individuals in a given year is quite low.

Population Trend
Decreasing
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Population

Population
A preliminary estimate from work being done by the Lheidli T’enneh First Nation (Yarmish and Toth 2001) for shows a subpopulation size of 255 (95% CI = 158–352). This preliminary population estimate may be skewed by the high recapture rate of individuals found in known areas of congregation. However, after extensive sampling, investigators do not believe the population can be larger than a few hundred individuals > 50 cm in length (Yarmish, pers. comm.).

Only 19% of the fish captured in the Lheidli T’enneh study were in the > 150 cm size class (Yarmish and Toth 2001). Investigators believe the use of this size class in the latter study may underestimate the number of adult fish as maturity in this slower growing population may occur at a smaller size (Yarmish, pers. comm.).

Population Trend
Unknown
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Population

Population
Sacramento-San Joaquin River subpopulations
The California Department of Fish and Game periodically monitors the status of white sturgeon in the Sacramento-San Joaquin River system to estimate abundance and mortality rates. The most recent survey completed in 1997 estimated nearly 140,000 white sturgeon (> 40 inches) in the Sacramento River (Shaffter and Kohlhorst 1999). The number of adult white sturgeon fluctuates annually and is largely the result highly variable year classes affecting adult recruitment. For example, strong year classes from the early 1980s recruited large numbers of adult white sturgeon to the fishery beginning around 1994; conversely subsequent severe drought conditions across California from 1987 to 1992 are expected to affect the size of the adult white sturgeon population since reproduction was generally poor during those years (Schaffter and Kohlhorst 1999). As recruitment basically ceases and growth and general mortality reduce the number of legal-sized fish, the adult population should decline the next few years. However, the subsequent series of wet years beginning in 1993 should contribute to another cycle of strong recruitment producing fish that will enter the fishery late in the next decade. The California Department of Fish and Game believes the current low exploitation rates, the ability for white sturgeon to successfully reproduce and recover rapidly from reduced adult populations during wet cycles, and fishing size limits that protect the most productive (i.e., fecund) female white sturgeon suggest that current fishing regulations are adequate to conserve white sturgeon in the Sacramento-San Joaquin River basin.

Columbia-Snake River subpopulations
Today, the white sturgeon population residing in the lower, free-flowing reach of the Columbia River is considered the most productive in the species’ range (Devore et al. 1999a). The recreational and commercial harvest in the lower Columbia river has recently averaged over 42,000 annually through 1997. Estimated abundance for legal-sized (42-60 inches) white sturgeon in the lower Columbia River in 1997 was nearly 157,000 fish, a decline from the estimated 227,700 fish in 1995. It appears that the decline was primarily a result of a decrease in the recruitment to the legal-sized population and emigration from the Columbia River system, and not over-harvest.

Upstream in the first three impounded reaches of the Columbia River the estimated abundance of white sturgeon in 1997 increased from a general population crash in the mid 1980's (North et al. 1999). Generally, white sturgeon increased in all size classes sampled. Researchers suspect that more restrictive harvest guidelines along with some relatively strong year classes in recent years are contributing to increasing populations in recent years. These landlocked populations continue to sustain limited harvest and consumption fisheries.

Historically within the Snake River, white sturgeon could range from its confluence with the Columbia River upstream nearly 615 river miles to Shoshone Falls, a natural barrier for sturgeon. Twelve dams were constructed along the Snake River between 1901 and 1975 that fragmented white sturgeon populations from the confluence to Shoshone Falls. The abundance of land-locked white sturgeon in the Snake River varies considerably from river reaches with reproducing populations to other reaches containing few individuals and no detectable recruitment. Reaches with reproducing populations currently provide catch and release sport fisheries only.

Upper Columbia River subpopulation
The abundance of white sturgeon from the Columbia River mainstem between Keenleyside Dam and the Canada-U.S. border was most recently assessed in 1995, when a population of 1,120 individuals (95% CI = 980 to 1,300) was estimated (RL&L 1996a). This figure does not include sampling in Lake Roosevelt in Washington State, and thus represents a minimum estimate of the total subpopulation. A smaller group of white sturgeon, considered part of the same subpopulation, has been identified at the upper end of Arrow Lakes Reservoir, located upstream from Keenleyside Dam. Estimates place the size of this group at 38 individuals (95% CI = 23 to 78) based on the results of 2000 studies (RL&L 2001).

Kootenai River subpopulation
The Kootenai River subpopulation has been in general decline since the mid-1960's (Apperson and Anders 1991, Duke et al. 1999). The remaining wild population is comprised primarily of adult sturgeon older than 25 years, with very little recruitment observed in the wild population since the mid-1970's (Duke et al. 1999, Ireland et al. 2000). In 1997, there were an estimated 1,468 adults (95% CI: 740 to 2,197) and 17 juvenile white sturgeon (Paragamian et al. 1997).

Fraser River and Nechako River subpopulations
Mark recapture estimates for subpopulations in the Nechako and lower Fraser Rivers (R.L. & L Environmental Services Ltd. 2000), plus the preliminary estimate from work being done by the Lheidli T’enneh First Nation (Yarmish and Toth 2001) for subpopulation in the Upper Fraser River show the following population sizes:

Fraser Regional subpopulation: 22,000 (95% CI = 9,800–70,700)
Upper Fraser subpopulation: 255 (95% CI = 158–352)
Nechako River subpopulation: 571 (95% CI = 421–890)

The preliminary population estimate for the Upper Fraser River may be skewed by the high recapture rate of individuals found in known areas of congregation. The fish tend to congregate in areas of preferred habitat but can also be found at very low densities in other areas of the mainstem. However, after extensive sampling, investigators do not believe the population can be larger than a few hundred individuals >50 cm in length (Yarmish, pers. comm).

Population Trend
Stable
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Population

Population
The abundance of white sturgeon from the Columbia River mainstem between Keenleyside Dam and the Canada-U.S. border was most recently assessed in 1995, when a population of 1,120 individuals (95% CI = 980 to 1,300) was estimated (RL&L 1996a). This figure does not include sampling in Lake Roosevelt in Washington State, and thus represents a minimum estimate of the total subpopulation. A smaller group of white sturgeon, considered part of the same subpopulation, has been identified at the upper end of Arrow Lakes Reservoir, located upstream from Keenleyside Dam. Estimates place the size of this group at 38 individuals (95% CI = 23 to 78) based on the results of 2000 studies (RL&L 2001).

Extensive study has confirmed spawning by upper Columbia white sturgeon at two locations. The vast majority of spawning occurs at the Pend d'Oreille–Columbia confluence (Waneta tailrace) area near the Canada–U.S. border (e.g., RL&L 1995). Spawning at this site has occurred annually since 1993 — the first year spawning studies were initiated. In 1999, a second spawning area was documented in the upper Columbia River just upstream from Arrow Lakes Reservoir (RL&L 2000). Spawning did not occur at this site in 2000.

Despite the regularity of spawning events, age structure analyses show that recruitment began to decline in 1969, and has failed entirely since 1985 (RL&L 1995). Changes in length-frequency distribution follow a similar pattern, with a dramatic reduction in representation by smaller fish in ongoing sampling programs (RL&L 1996a, BC Ministry of Water, Land and Air Protection, data on file). Sampling in Lake Roosevelt in Washington State, although less intensive, shows a similar recruitment failure (DeVore et al. 1999, Spokane Tribe, data on file). Thus, recruitment of upper Columbia white sturgeon has failed completely, to the point where continued existence of the subpopulation is at risk.

First maturity is reached as early as 27 years of age for females and 16 for males (RL&L 1995), although the mean age of maturation is likely higher. Assuming a mean age of maturity of 30 years for the subpopulation, and limited or complete failure of recruitment for more than 20 years, at least 80% of the subpopulation is estimated to be of reproductive age. Thus, in combination, the groups of white sturgeon composing this subpopulation would represent about 930 mature individuals. Based on sampling currently underway (B.C. Ministry of Water, Land and Air Protection, data on file) the sex ratio is 1.35 males per female (n=94), indicating 396 females and an effective population size of 910 (Falconer 1981). The oldest documented individual in the subpopulation is 69 years of age. Assuming a typical mortality curve and using age 30 as the point at which maturity is reached, the average age of parents (generation time) in the population is likely 40–45 years.

Population Trend
Decreasing
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Threats

Threats

Major Threats
Area of occupancy has no doubt been reduced in the lower mainstem due to the alienation of side channels from dyking activity, the infolding of sloughs and wetlands, development and industrial activity. The loss of sloughs, side channels and other low velocity backwater areas has decreased available juvenile rearing habitat. Loss of side channels may reduce spawning habitat availability as well.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Threats

Major Threats
For more than the last 100 years, human development has modified the natural hydrograph of the Kootenai River through such activities as Libby dam construction and operation, dyke construction and lowered Kootenai Lake levels. These activities have altered white sturgeon spawning, egg incubation, nursery and rearing habitats, and reduced overall biological productivity. Although these factors may have contributed to a general lack of recruitment of this unique population of white sturgeon during the last century, the operation of Libby Dam in 1974 is considered to be a primary reason for the population’s continued decline (Apperson and Anders 1991). When Libby Dam began regulating the Kootenai River, average spring peak flows were reduced by more than 50% and winter flows increased by more than 300%.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Threats

Major Threats
In the Nechako, flow reduction has reduced depth and the amount of habitat available in side channels and backwaters.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Threats

Major Threats
Sacramento-San Joaquin River subpopulations
In California, white sturgeon reside mainly within the Sacramento River and its combined estuary with the San Joaquin River. Historical spawning habitat has been lost primarily due to dam construction and water diversions. In the Sacramento River, white sturgeon previously spawned upstream of Shasta Dam prior to its construction in the 1940s. It is also believed the San Joaquin River may have supported white sturgeon spawning prior to the development and implementation of large water diversions for agriculture (Moyle 1976). Results from a recent white sturgeon spawning habitat study reveal that most spawning occurs in a 55 river mile reach of the Sacramento River from Knights Landing to upstream of Colusa (Schaffter 1997).

Columbia and Snake River subpopulations
Historically, white sturgeon were abundant in the unimpounded Columbia River (Oregon and Washington) and in the late 1800's supported an intense commercial fishery (DeVore et al. 1993). Intensive sturgeon fishing began in 1889 and peaked in 1892 with about 2,700,000 kg of sturgeon landed. The stock was depleted by 1899 after a ten year period of excessive harvest (Craig and Hacker 1940). Season, gear and minimum size restrictions failed to restore the population. Only after maximum size regulations designed to protect sexually mature sturgeon were enacted in 1950 did white sturgeon rebound in the Columbia River.

Hydroelectric development within the Columbia River basin beginning in 1933 began to isolate white sturgeon above dams. Today there are 17 landlocked subpopulations upstream of Bonneville Dam (the furthest downstream dam in the Columbia River) including the tributary Snake River (DeVore et al. 1993). Productivity appears to vary among the landlocked subpopulations as some support high populations and sustainable fisheries (DeVore et al. 1999b, North et al. 1999) while others sustain no exploitation due to low recruitment and productivity (PSMFC 1992).

Upper Columbia River subpopulation
Extensive study has confirmed spawning by upper Columbia white sturgeon at two locations. The vast majority of spawning occurs at the Pend d'Oreille-Columbia confluence (Waneta tailrace) area near the Canada-U.S. border (e.g., RL&L 1995). Spawning at this site has occurred annually since 1993 - the first year spawning studies were initiated. In 1999, a second spawning area was documented in the upper Columbia River just upstream from Arrow Lakes Reservoir (RL&L 2000). Spawning did not occur at this site in 2000.

Despite the regularity of spawning events, age structure analyses show that recruitment began to decline in 1969, and has failed entirely since 1985 (RL&L 1995). Changes in length-frequency distribution follow a similar pattern, with a dramatic reduction in representation by smaller fish in ongoing sampling programs (RL&L 1996a, BC Ministry of Water, Land and Air Protection, data on file). Sampling in Lake Roosevelt in Washington State, although less intensive, shows a similar recruitment failure (DeVore et al. 1999, Spokane Tribe, data on file). Thus, recruitment of upper Columbia white sturgeon has failed completely, to the point where continued existence of the subpopulation is at risk.

Kootenai River subpopulation
For more than the last 100 years, human development has modified the natural hydrograph of the Kootenai River through such activities as Libby dam construction and operation, dyke construction and lowered Kootenai Lake levels. These activities have altered white sturgeon spawning, egg incubation, nursery and rearing habitats, and reduced overall biological productivity. Although these factors may have contributed to a general lack of recruitment of this unique population of white sturgeon during the last century, the operation of Libby Dam in 1974 is considered to be a primary reason for the population’s continued decline (Apperson and Anders 1991). When Libby Dam began regulating the Kootenai River, average spring peak flows were reduced by more than 50% and winter flows increased by more than 300%.

Fraser River and Nechako River subpopulations
Area of occupancy has no doubt been reduced in the lower mainstem due to the alienation of side channels from dyking activity, the infolding of sloughs and wetlands, development and industrial activity. The loss of sloughs, side channels and other low velocity backwater areas has decreased available juvenile rearing habitat. Loss of side channels may reduce spawning habitat availability as well. In the Nechako, flow reduction has reduced depth and the amount of habitat available in side channels and backwaters.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Threats

Major Threats
Upper Columbia white sturgeon were isolated from lower Columbia River stocks in the United States in 1941 following the construction of Grand Coulee Dam and related formation of Lake Roosevelt. Kettle Falls in Washington State is thought to have formed a seasonal barrier to white sturgeon migration prior to its inundation by Lake Roosevelt. Construction of Keenleyside, Mica, and Revelstoke dams on the mainstem Columbia River, Brilliant Dam on the lower Kootenay River, and Waneta Dam on the lower Pend d'Oreille River further fragmented the population and altered the natural river regime. In addition, the impoundments created by these dams flooded the riverine system, altering or eliminating critical sturgeon habitats, changing water quality and generally reducing system productivity. Dam construction effects were exacerbated by additional impacts such as pollution and waterfront developments.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Degree of Threat: B : Moderately threatened throughout its range, communities provide natural resources that when exploited alter the composition and structure of the community over the long-term, but are apparently recoverable

Comments: Populations were severely reduced by commercial over-fishing in the late 1800s-early 1900s (Parsley et al. 2002). As of the early 1990s, populations in Canada were "healthy" but under increasing pressure from fisheries (Lane 1991).

White sturgeons have been detrimentally impacted by physical and ecological barriers and population fragmentation caused by dams and their impoundments. For example, dams on the Columbia River have restricted movements of white sturgeons, and impounded fishes are effectively prevented from accessing the river's estuary and the Pacific Ocean (Rien and North 2002). Dam operations during low flow produce erratic conditions for spawning and recruitment (Parsley and Beckman 1994, Beamesderfer et al. 1995).

Dams on the Snake River have reduced free-flowing habitat by 37 percent (Cochnauer 2002). Most hydroelectric dams on the Snake River were never fitted with fish ladders adequate to allow upstream passage of white sturgeons (Cochnauer 2002). A simulation study of factors controlling recruitment in the Middle Snake River suggested that poor water quality during summer may have a strong negative effect of recruitment in the river segments between Swan Falls Dam and Hell's Canyon Dam (Jager et al. 2002). In segments with better water quality, populations in short river segments may be limited by larval export whereas populations in longer segments may be less limited by any single factor. Factors in an upstream segment may significantly influence downstream neighbors (Jager et al. 2002).

In the Kootenai River ecosystem, drastic anthropogenic changes to the river have led to natural recruitment failure for 30 years, with several exceptions. Apparently, during some years, natural recruitment failure was due to female stock limitation whereas in other years recruitment failure was due to one or more postspawning early life history mortality factors (Anders et al. 2002). Contaminants in the river have been implicated as a possible cause of poor reproductive success, but further study is needed (see Kruse and Scarnecchia 2002).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Least Concern (LC)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© WorldFish Center - FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Management

Conservation Actions

Conservation Actions
On September 6, 1994, the U.S. Fish and Wildlife Service listed the Kootenai River population of white sturgeon as endangered under the Endangered Species Act (Act). Subsequently, a recovery team composed of two Canadians and eight Americans was formed in January 1995. The team completed a final recovery plan (Plan) for the Kootenai River white sturgeon in 1998, which was subsequently approved by the U.S. Fish and Wildlife Service in late 1999 (Duke et al. 1999).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Conservation Actions

Conservation Actions
Kootenai River subpopulation
The Kootenai River population of white sturgeon was listed as endangered under the Endangered Species Act on September 6, 1994 by the U.S. Fish and Wildlife Service. Subsequently, a recovery team composed of two Canadians and eight Americans was formed in January 1995. The team completed a final recovery plan for the Kootenai River white sturgeon in 1998 which was subsequently approved by the U.S. Fish and Wildlife Service in late 1999 (Duke et al. 1999). The recovery plan describes a series of 46 specific conservation measures in the United States and Canada that are believed necessary to recover the endangered white sturgeon. Recovery objectives are to re-establish successful reproduction in the wild by increasing Kootenai River flows and producing hatchery-reared juveniles over the next 10 years to prevent extinction.

The species is listed on CITES Appendix II.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Management Requirements: Increased river discharge during the spawning season is one of the management needs for the Kootenai River population (see recovery plan).

Catch-and-release regulations in the Hells Canyon reach of the Snake River in Idaho, Oregon, and Washington over 30 years have allowed that population to increase in size and have improved population structure, but it may take another 25-30 years for the older age-class segment of the population to show a response (Cochnauer 2002).

Sturgeons transplanted from a robust population in the free-flowing lower Columbia River downstream from Bonneville Dam to Dalles Reservoir showed good survival and growth, indicating that such transplants may be effective in supplementing populations that have low recruitment (Rien and North 2002). However, harvest needs in the lower Columbia may limit use of this population in mitigation for lost productivity in Columbia River impoundments (Rien and North 2002).

Management Research Needs: More needs to be learned about the influence of abiotic and biotic factors on spawning and subsequent recruitment (Anders et al. 2002). It is known that year-class strength is determined within 2-3 months after spawning, and that increased river discharge combined with suitable water temperatures from spawning through first exogenous feeding result in greater recruitment, but little is known about the importance of food availability or losses due to predation in determining year-class strength (Parsley et al. 2002).

Evolutionarily significant units should be determined so that potential donor and recipient populations for translocations can be identified (Rien and North 2002).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Global Protection: None. No occurrences appropriately protected and managed

Needs: Protect spawning streams from impassible obstructions.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Relevance to Humans and Ecosystems

Benefits

Economic Importance for Humans: Positive

The size combined with the "characteristic quality of its flesh" makes it a valuable game fish in areas were it is not protected. Its roe can be used for caviar, and Columbia river roe production is "second only to the former Soviet Union" (Hart 1973; Pacific States Marine Fisheries Commission 1996).

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Economic Uses

Comments: Subject to commercial, native, and increasingly popular sport fisheries in the Fraser and Columbia river in British Columbia (Lane 1991).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Importance

fisheries: commercial; aquaculture: commercial; gamefish: yes
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© WorldFish Center - FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Wikipedia

White sturgeon

The white sturgeon (Acipenser transmontanus, meaning "sturgeon beyond the mountains"), also known as the Pacific sturgeon, Oregon sturgeon, Columbia sturgeon, Sacramento sturgeon, and California white sturgeon, is a sturgeon (a fish of the family Acipenseridae) which lives along the west coast of North America from the Aleutian Islands to Central California.

It is the largest freshwater fish in North America and is the third largest species of sturgeon, after the Beluga and the Kaluga. The white sturgeon is known to reach a maximum size of 816 kg (1,799 lb) and 6.1 m (20 ft).[2]

Contents

Physical appearance

The white sturgeon has a slender, long body, head and mouth. This fish has no scales; instead it has large bony scutes that serve as a form of armor. There are 11–14 dorsal scutes, all anterior to the dorsal fin, and 38–48 lateral scutes and 9–12 ventral scutes on each side. The dorsal color of a White Sturgeon is gray, pale olive, or gray-brown. The fins are a dusky, opaque gray. The underside is a clean white. It has four barbels, used for sensing food, near its huge toothless mouth.

Sturgeons are classified as a bony fish, but actually are more cartilaginous than bony, their internal bone structure being more like a shark’s. Sturgeon have changed very little since they first appeared, over 175 million years ago and thus have the appearance of a very ancient fish.

Habitat

The white sturgeon lives on the bottom of slow-moving rivers, bays, and estuarine areas, including the brackish water at the mouths of large rivers. Other sturgeon will spend most of its time in a marine environment, only coming into rivers to spawn. They are well-adapted to finding food drifting by with their excellent sense of smell and taste. When there is an insufficient food supply, sturgeon have been known to move into shallow water to eat freshwater clams.

During the spawning season, the white sturgeon moves to clean, fast-moving areas of rivers, such as just below rapids, with gravel or larger rocks along the bottom.

Juvenile white sturgeon

White sturgeon spawn many times in their lives. As they age, the females spawn less often, but produce more eggs in each spawning. In the late spring or early summer, they congregate in areas of rivers with a heavy current, gravel bottom, and a water temperature of 58 °F to 66 °F (14 °C to 19 °C). The fish broadcast spawn in these areas, with males releasing sperm as the outnumbered females release anywhere from 100,000 to a million eggs. The fertilized eggs then sink and adhere to the gravel at the bottom. The eggs are brown in color and will hatch in about a week, depending on water temperature. Female white sturgeon do not spawn every year.

Upon hatching, the larvae are around 0.5 in. (1.3 cm) long, with a tadpole-like appearance. They drift downstream with the current until they reach a suitable habitat. When the rearing habitat is reached, the larvae typically take around 25 days for the yolk sac to be absorbed. About a month after hatching, the sturgeon will have a full set of fins, rays, and scutes. As small juveniles, they feed on insects, small fish, and small crustaceans. Maturity is reached between 5 and 11 years, depending on the gender of the fish and the temperature of the water.

White Sturgeon can live to be over 100 years old. The rate of growth is dependent on water temperature. Typically, they reach six feet long around 25 years of age, showing that these fish do not grow as quickly as many other fish. White Sturgeon are anadromous meaning they spawn in fresh water and migrate to salt water to mature. Sturgeon may migrate in and out of salt water many times in their lives. However, since the building of many dams along the Columbia and Snake rivers, the populations above the dams have become landlocked.

Unexpected social behavior has been observed in white sturgeon of the lower Columbia River. Up to 60,000 sturgeon massed in a dense "sturgeon ball" at the base of the Bonneville Dam in early 2008. Scientists do not know what the reason for the behavior was, but predator avoidance is one theory.[3]

Diet

A sturgeon's taste buds are located on the outside of its mouth. This, along with the barbels, allows it to see if a possible food source is edible before sucking it up into its mouth. As adults, the white sturgeon’s diet somewhat varies. This is dependent upon the river systems it lives in. In the Columbia River system, dead fish, crustaceans, and mollusks are all popular prey. Lampreys, primitive eel-like fish, come into rivers to spawn at the same time as the white sturgeon, and are a popular food source at that time. Smelt is another food that is abundant around spawning time. Shad come into the Columbia River system in throngs of several million each spring. The extremely large shad runs are often cited as an example of why the lower Columbia River has such a large population of Sturgeon. Like the smelt, these fish often die, and the remains are an easy meal for sturgeon.

Fishing

Commercial fishing

Historically, sturgeon have been a very important fish, both commercially and for sporting purposes. At one point, sturgeon populations in all of the Columbia River system were threatened due to overfishing. A commercial fishery began in the 1880s. In 1892, this fishery reached a peak, when over five and one half million pounds (2,500 metric tons) of sturgeon were harvested. By the dawn of the 20th century, the seemingly endless supply of sturgeon was severely depleted. In the 1940s a six-foot maximum size restriction was put in place. The commercial fishing of white sturgeon has remained to this day and was valued at US$10.1 million in 1992.

Non-Indian commercial fisheries for white sturgeon occur in the mainstem Columbia River downstream from Bonneville Dam. These fisheries use gillnets. Commercial sturgeon fishing may be done in conjunction with commercial salmon fishing or may be a targeted fishery. Release mortality on undersize and oversize sturgeon is estimated by state fish and wildlife managers to be low. Generally fisheries are managed with weekly landing limits per fisher. Green sturgeon are sometimes caught but must be released unharmed.

Tribal sturgeon fisheries occur in the mainstem Columbia River between Bonneville Dam and McNary Dam. Tribal fisheries primarily use gillnets and setline gear. Some sturgeon are caught with hook and line gear or hoopnets from platforms along the shore. The tribes have subsistence and commercial fisheries for sturgeon.

Worldwide, sturgeon commercial fisheries use sturgeon for meat and eggs, the eggs being most sought after. Caviar is considered a delicacy in many parts of Europe and North America. In the Columbia River, size restrictions make it very unlikely any fishers ever legally retain egg-bearing fish. The fish caught legally by sport and commercial fishers are too small and not yet sexually mature enough to make harvesting for eggs worthwhile.

Sport fishing

Fishing for sturgeon is still very popular in the Columbia River, Willamette River and Snake River. Current sport fishing regulations as imposed by The Oregon Department of Fish and Wildlife state that Sturgeon may only be kept if measuring between 38 and 54 inches (96.5–137 cm) from the nose to the tail fork. In most years anglers regulations change frequently to limit the number of fish caught. Once the annual quota is reached, retention of sturgeon is no longer allowed. Also, one may only use a single point barbless hook. Bait used for sturgeon is mostly its natural prey including shad, anchovies, shrimp, and smelt. However, more unusual baits are sometimes used. These baits include cheese, anchovies, pickled squid, dog food, and cat food. A strong, 10–12 foot (3.1–3.7 m)long rod and heavy salt water reel spooled with 40–100 pound (180–440 N) test fishing line is used for bank fishing. For boat fishing a smaller 6–7 foot (2 m) long rod is used. Anglers vary the amount of weight used depending on how heavy the current is, anywhere from 6 to 20 ounces (210–560 g). Often, an angler will use a 10–12 inch soft braided leader to connect the weight to the hook. Sport fishermen divide the sturgeon into three classes: shakers, keepers, and oversize. Shakers consist of any fish under the legal size. Keepers are any fish within the legal size requirement. Oversize, often called peelers, are any fish over the maximum size requirement of 66 inches (1.37 m). They are called peelers because of the way they “peel” line off of the reel. Many sturgeon fishermen target these exclusively. When sturgeon first encounter the bait, they “mouth” it, which is to say that they taste and feel it before inhaling it whole.

Toxicity

The threat of toxin bioaccumulation is especially high in Sturgeon meat. Because of its eating habits, sturgeon accumulate toxins in its flesh as it feeds. They feed on any sort of organic material found while scavenging; this includes raw sewage, dead fish, paper mill wastes, and plants sprayed by pesticides. Dioxin is an unintentional byproduct of paper bleaching and pesticides. It is also one of the most commonly found toxins in fish populations. PCB is also found in fish. It is used as a plasticizor in paint, rubber, and plastic products. Before the government ceased its production in 1977, more than 1,500,000,000 pounds (680,000 tonnes) were produced. Mercury is one of the more commonly known toxins found in fish’s flesh. Some have speculated that it is also the most dangerous. Sturgeon and other fish in the Columbia and Willamette rivers have registered 0.35 to 0.50 parts per million. Although most accumulation in Sturgeon happens in the liver, pancreas, and other organs; the toxins still accumulate in the edible flesh. The Oregon Department of fish and Wildlife has issued warnings on all fish caught in the Willamette River. For areas with high mercury levels: (Willamette and Lower Columbia Rivers) “Women of childbearing age, children under six, and people with liver and kidney damage should avoid eating fish from these waters. Healthy adults should eat no more than one eight ounce meal per month.” Also for areas with high concentrations of PCBs, dioxins, and pesticides: (Willamette and Lower Columbia Rivers)

“All persons should reduce or avoid eating fatty parts of fish. Exposure can be reduced by removing the skin and all fat, eggs, and internal organs.”

Conservation

In addition to overfishing, dams constructed along the Columbia and Snake Rivers have also become a threat to sturgeon. The dams block passage to and from the ocean leaving landlocked populations. The higher water levels have, as a result, destroyed areas that used to have rapid currents, eliminating spawning grounds. At this point in time, the only healthy population of White Sturgeon on the Columbia River and its tributaries is the lower Columbia River population. These fish are still able to move freely between marine, estuarine, and freshwater environments. All other populations have become landlocked because of the dams. These populations have suffered from the inaccessibility of many food sources, inability to migrate, and destruction of their habitat. As a result, none of the populations above Bonneville Dam are considered to be abundant. White sturgeon in the Kootenai River are at such a low level that they were listed as endangered under the Endangered Species Act in 1994. Some white sturgeon populations, however, do support fisheries. The Oregon Department of Fish and Wildlife has worked together with the Washington Department of Fish and Wildlife and the Columbia River Treaty Tribes to impose size restrictions as well as season and quota restrictions on all sturgeon caught in the Columbia River. The objective of size restrictions is to minimize fishing impacts on large sturgeon that comprise the spawning population. Poaching is also partly responsible for declining numbers.

Fishery management agencies have implemented more restrictive commercial and recreational fishing regulations such as closed areas to protect spawning fish in order to help protect this magnificent creature. These fishery regulations in conjunction with hydrosystem management actions taken by the Corps of Engineers and restoration funding provided by the Bonneville Power Administration will help alleviate the over harvest of Sturgeon and destruction of Sturgeon habitat.

State and tribal fishery managers have experimented with spawning sturgeon artificially and raising sturgeon in hatcheries with the goal of releasing juvenile sturgeon in the upstream areas of the Columbia and Snake Rivers to help rebuild sturgeon populations in these areas. Initial results are promising, but no full scale hatchery production has been funded.

References

  1. ^ Duke, S. (U.S. Fish & Wildlife Service), Down, T., Ptolemy, J., Hammond, J. & Spence, C. (Ministry of Water, Land & Air Protection, Canada) (2004). Acipenser transmontanus. In: IUCN 2008. IUCN Red List of Threatened Species. Downloaded on 23 February 2009.
  2. ^ http://filaman.uni-kiel.de/summary/SpeciesSummary.php?id=2594
  3. ^ Big ball of Columbia River sturgeon baffles experts, The Oregonian, May 16, 2008
  • Connor, Bud; Great White Sturgeon Angling
  • Herring, Hal; “Don’t Eat That Fish”, Field and Stream; April 2004
  • Miller, Allen I.; Columbia River Basin White Sturgeon
  • Oregon Sport Fishing Regulations 2005kmduynfuont
Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

 

Source: Wikipedia

Unreviewed

Article rating from 0 people

Average rating: 2.5 of 5

Names and Taxonomy

Taxonomy

Comments: Gene sequencing data of Birstein and DeSalle (1998) indicate that there are least three main clades within Acipenser: A. STURIO-A. OXYRINCHUS, A. SCHRENCKII-A. TRANSMONTANUS, and all Ponto-Caspian species plus A. DABRYSNUS and Brevirostrum.

Krieger et al. (2000) examined phylogenetic relationships of North American sturgeons based on mtDNA sequences and found that (1) nucleotide sequences for all four examined genes for the three Scaphirhynchus species were identical; (2) the two Acipenser oxyrinchus subspecies were very similar in sequence; (3) A. TRANSMONTANUS and A. MEDIROSTRIS were sister taxa, as were A. FULVESCENS and Brevirostrum (in constrast to Birstein and DeSalle 1998).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!