Overview

Comprehensive Description

Biology

Found in swampy, vegetated lakes and rivers (Ref. 10294, 46234). Air-breather that can withstand high temperatures, which enables it to survive in stagnant areas; even known to aestivate; lethal temperature is 35.2°C (Ref. 46234). A voracious and opportunist feeder, it subsists on fishes including other sport fishes, frogs, crayfish, insects, and shrimps. It uses scent as much as sight and captures food by means of gulping water. Males are always smaller than females which live longer. Apparently somewhat migratory during spawning season (Ref. 4639). Eggs are adhesive, attached to decaying vegetation and upright weeds (Ref. 4639). Larvae are found in nest, remaining attached to roots or lying on bottom until adhesive organ is absorbed, thereafter in tight "swarm" guarded by male parent outside nest (Ref. 4639). A 'living fossil' and lone survivor species of Family Amiidae.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© WorldFish Center - FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Distribution

Geographic Range

Bowfin are found as far north as the upper St. Lawrence River in Quebec and Ontario, and as far south as Southern Texas and Florida. They can be found from the east coast and west into South Dakota, Nebraska, Missouri, Kansas, and Central Oklahoma (Scott and Crossman, 1973).

Biogeographic Regions: nearctic (Native )

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

occurs (regularly, as a native taxon) in multiple nations

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

National Distribution

Canada

Origin: Native

Regularity: Regularly occurring

Currently: Present

Confidence: Confident

Type of Residency: Year-round

United States

Origin: Native

Regularity: Regularly occurring

Currently: Present

Confidence: Confident

Type of Residency: Year-round

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Global Range: Throughout most of the eastern U.S. and adjacent southern Canada; St. Lawrence River through Great Lakes region to Minnesota, south to the Gulf Coast in the Mississippi River basin (west to eastern Kansas), Atlantic Coastal Plain from Florida north to southeastern Pennsylvania, and Gulf Coast from Florida to the Colorado River, Texas.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

North America: St. Lawrence River, Lake Champlain drainage of Quebec and Vermont west across southern Ontario to the Mississippi drainage in Minnesota.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© WorldFish Center - FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Physical Description

Morphology

Physical Description

Amia calva are most easily recognized by two distingushing features. The first is a very large gular plate located on the ventral side of the head, between the mandibles. This plate is unique among fishes that live within the bowfin's geographic range (Trautman, 1957). The second distingushing feature is a very long dorsal fin. The fin has 46-50 soft rays and covers approximately 42.7-47.5% of total body length. Amia calva have paired pelvic fins located ventrally at mid-body. The anal fin is composed of 9-10 soft rays and is located ventrally at the midpoint of the dorsal fin. Bowfin have large, rounded pectoral fins composed of 16-19 soft rays and located relatively low on the body. The body itself is long and cylindrical in shape. Bowfin are laterally compressed, but have a body depth of 14.2-19.7% of total length. This gives the bowfin a long stout look. Bowfin are dark olive with lighter coloration on the sides and a cream colored belly. They typically have a vertical barred pattern on the sides, a horizontal barred pattern on the dorsal fin, and an irregular vertical barred pattern on the caudal fin. Adult males have a prominent black spot with a yellow to orange halo on the caudal fin. In females, the orange/yellow is absent (Scott and Crossman, 1973).

Range mass: 9750 (high) g.

Average mass: 900-1360 g.

Range length: 109 (high) cm.

Average length: 45-61 cm.

Other Physical Features: ectothermic ; heterothermic ; bilateral symmetry

Sexual Dimorphism: female larger; male more colorful

  • Trautman, M. 1957. The fishes of Ohio. Baltimore, Maryland: The Ohio State University Press.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Dorsal spines (total): 0; Dorsal soft rays (total): 42 - 53; Analspines: 0; Analsoft rays: 9 - 12; Vertebrae: 80 - 90
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© WorldFish Center - FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Size

Length: 87 cm

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Maximum size: 1090 mm TL
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Max. size

109 cm TL (male/unsexed; (Ref. 5723)); max. published weight: 9,750 g (Ref. 4699); max. reported age: 30 years (Ref. 72462)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© WorldFish Center - FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Diagnostic Description

Branchiostegal rays: 10-12. Body is long and robust. Head is conic, mouth large, with maxillary extending well past eye; jaws wit strong, conical teeth; anterior nostrils at base of short barbels. Dorsal fin origin at 1/3 of total length; anal fin origin at midpoint of dorsal base; pelvic fins inserted at midpoint of body.Pigmentation: Dark olive above combines with lighter color on sides to form reticulated pattern; venter cream or greenish; head yellow to brown with darker horizontal bars; lower fins vivid green; caudal light olive with irregular darker vertical bars. Adult males with prominent yellow to orange bordered black spot at upper caudal base, less intense or absent in females.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© WorldFish Center - FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Ecology

Habitat

Habitat

Bowfin live in backwater pools of rivers, lakes, and swamps. During times of high water, bowfin swim into river cutoffs and ther floodplain habitats. Often times they are trapped here when the water level decreases. Due to their ability to breath air they can survive in these drained ponds for relatively long periods of time. There have been reports of bowfin surviving for 21 days buried in the mud of a drained pond (Ross, 2001). Bowfin also inhabit ditches, pits and pools of slow streams. Theses streams are small projections of mainly the Mississippi (and subsidiaries), and the St. Lawrence River. Bowfin prefer generally clear water with large amounts of aquatic vegetation (Scott and Crossman, 1973).

Habitat Regions: temperate ; freshwater

Aquatic Biomes: lakes and ponds; rivers and streams

Wetlands: swamp

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Depth range based on 15 specimens in 1 taxon.

Environmental ranges
  Depth range (m): 0.06 - 2

Graphical representation

Depth range (m): 0.06 - 2
 
Note: this information has not been validated. Check this *note*. Your feedback is most welcome.
Public Domain

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Habitat Type: Freshwater

Comments: Swampy vegetated sloughs and backwaters of lowland streams and bays of warm clear lakes. One was found estivating in a moist chamber on land along a river floodplain (Scott and Crossman 1973). Eggs are laid in nests in areas cleared of vegetation or under logs, stumps, or bushes (Scott and Crossman 1973).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Environment

demersal; freshwater
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© WorldFish Center - FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Migration

Non-Migrant: No. All populations of this species make significant seasonal migrations.

Locally Migrant: No. No populations of this species make local extended movements (generally less than 200 km) at particular times of the year (e.g., to breeding or wintering grounds, to hibernation sites).

Locally Migrant: No. No populations of this species make annual migrations of over 200 km.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Trophic Strategy

Food Habits

Amia calva is a non-specific predator. This can be seen by the variety of foods they consume. Though they eat most anything, the largest percent of their food is made up of insects, fishes, crustaceans, and amphibians. Some common examples include frogs, bass, other bowfin, dragonflies, sunfish, crayfish, etc (“Bowfin”, 1995). Bowfin use their forward movement and suction to catch their prey. Bowfin take approximately .075 seconds to open and close their mouth, and it is this quick motion that creates the suction bowfin rely on for food (Ross, 2001).

Animal Foods: amphibians; reptiles; fish; carrion ; insects; mollusks; aquatic crustaceans

Primary Diet: carnivore (Piscivore , Insectivore , Eats non-insect arthropods)

  • Pennsylvania Game Commission. Bowfin. PA010009. NA: Species Information Library. 1995. Accessed October 20, 2004 at http://biblioline.nisc.com.proxy.lib.umich.edu/scripts/login.dll?BiblioLine&dbname=QSIL.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Feeds on fish and insects (Ref. 1998).
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© WorldFish Center - FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Comments: Feeds opportunistically on many kinds of small animals, mainly fishes, crayfish, frogs, and insects.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Associations

Ecosystem Roles

Amia calva are voracious predators. Bowfin are very near the top of the food chain in most of the ecosystems they inhabit, and as a result they eat most everything else. In areas in which bowfin are relatively abundant, they make a significant impact on the populations of their prey fish (Ross, 2001).

Ecosystem Impact: keystone species

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Predation

Adult bowfin are rarely eaten by other organisms. In studies of bowfin diet, other bowfin were found in the stomach contents (Scott and Crossman, 1973). Another study showed that in Florida, bowfin were a source of food for alligators (Delany, Linda, and Moore, 1999).

Known Predators:

  • Delany, M., S. Linda, C. Moore. 1999. Diet and Condition of American Alligators in 4 Florida Lakes. Conference of the Southeastern Association of Fish and Wildlife Agencies, 1: 375-389. Accessed October 25, 2004 at http://ca1.csa.com.proxy.lib.umich.edu/htbin/ids65/procskel.cgi.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Known predators

Amia calva (bowfin) is prey of:
Alligator mississippiensis

Based on studies in:
USA: Florida, South Florida (Swamp)

This list may not be complete but is based on published studies.
Creative Commons Attribution 3.0 (CC BY 3.0)

© SPIRE project

Source: SPIRE

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Known prey organisms

Amia calva (bowfin) preys on:
Cambarus bartonii
Coleoptera
Diptera
Centrarchidae

Based on studies in:
USA: Florida, South Florida (Swamp)

This list may not be complete but is based on published studies.
Creative Commons Attribution 3.0 (CC BY 3.0)

© SPIRE project

Source: SPIRE

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Life History and Behavior

Behavior

Communication and Perception

Bowfin have been described by Scott and Crossman (1973) as “…a slow, clumsy, stalking predator that uses scent as much as sight…”

Communication Channels: visual ; chemical

Perception Channels: visual

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Life Cycle

Development

Bowfin eggs hatch 8-10 days after fertilization, and are approximately 8 mm long at this time. The young are tadpole-like with a body deflected by a yolk sac (Ross, 2001). The hatchlings have an adhesive organ on the tip of their snout that attaches them to the nest. They remain in the nest for an additional 7-10 days. Over this period they grow from 8 mm to 10-13 mm and the yolk sac is absorbed into the body (Ross, 2001). The immature fish grow quickly. They reach 5-9 inches (12.5 to 22.5 cm) in length over a period of four to six months. Individuals reach sexual maturity after a period of 3-5 years, or when a certain length is reached (18 inches (45 cm) = male, 24 inches (60 cm) = female) (Scott and Crossman, 1973).

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Males build and guard nest and young, usually nesting in colonies, and clearing out vegetation for the nest (Refs. 205, 34296, 34297, 3672). Most active at twilight and dawn (Ref. 34297); spawn at night (Ref. 34296). Eggs hatch in 9 days; newly hatched young measuring 8 mm (Ref. 34297).
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© WorldFish Center - FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Life Expectancy

Lifespan/Longevity

Bowfin do not normally live longer than 12 years in the wild. Average age varies depending on specific area, but is normally 10-12 years. Ages up to 30 years have been reported for bowfin in captivity (Ross, 2001).

Range lifespan

Status: wild:
12 (high) years.

Range lifespan

Status: captivity:
30 (high) years.

Average lifespan

Status: wild:
30.0 years.

Average lifespan

Status: captivity:
20.0 years.

Average lifespan

Status: captivity:
30.0 years.

Average lifespan

Status: captivity:
24.0 years.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Reproduction

Reproduction

During mating (springtime) males and females alike move into spawning areas. These areas are shallow, vegetated waters in lakes or ponds. Females often lay eggs in several nests, and as a result, males often have eggs from more than one female in their nest (Scott and Crossman, 1973).

Mating System: polygynandrous (promiscuous)

Bowfin mate once a year during the springtime. In the south, spawning can occur in late April, but in most cases it occurs in late May and early June. The male bowfin prepares a nest in shallow, vegetated waters. The nest is simply a clearing in the vegetation made by biting off roots. A slight depression is made so the eggs won’t be swept away. A female lies on the bottom of the nest while the male circles her. They lie side by side and flap their fins. The female releases her eggs and the male releases his milt (sperm). More than one female can lay her eggs in a male’s nest, and females often lay eggs in several nests. It is common that there are eggs in different developmental stages in a single nest. The male guards his nest very aggressivly. There are often as many as three times more males than females in a spawning ground, which can lead to conflict (Scott Crossman, 1973).

Breeding interval: Bowfin breed once yearly

Breeding season: Late April-Early June

Average time to hatching: 8-10 days.

Average age at sexual or reproductive maturity (female): 3-5 years.

Average age at sexual or reproductive maturity (male): 3-5 years.

Key Reproductive Features: sexual ; fertilization (External ); oviparous

Average age at sexual or reproductive maturity (male)

Sex: male:
1460 days.

Average age at sexual or reproductive maturity (female)

Sex: female:
1551 days.

The male takes care of all the parental investment duties. After fertilization the male guards the nest and keeps the eggs supplied with fresh water by moving his pectoral fins. Males may be so aggressive they will attack inanimate objects such as sticks, and have been known to leap out of the water toward invaders on the waters edge near the nest (Ross, 2001). When the hatchlings begin to swim the male guards them as well. The juveniles swim in schools guarded by the male until they reach four inches in length. At this time the young bowfin begin the solitary behavior of adults (Richmond, 1997).

Parental Investment: pre-hatching/birth (Provisioning: Male, Protecting: Male); pre-weaning/fledging (Protecting: Male); pre-independence (Protecting: Male)

  • Richmond, A. 1997. "Bowfin or Dog Fish" (On-line). Accessed October 25, 2004 at http://www.bio.umass.edu/biology/conn.river/bowfin.html.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Spawns in spring. Eggs laid in nest made by male. Male guards eggs until hatching in 10 days. Male guards schooling larvae. Schools break up in about 2 months. Sexually mature in 3-5 years.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Amia calva

The following is a representative barcode sequence, the centroid of all available sequences for this species. 

 
There are 6 barcode sequences available from BOLD and GenBank.  Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen and other sequences.
 
GBGC1652-06|NC_004742|Amia calva| ACCCGTTGATTCTTCTCTACTAATCACAAAGACATTGGCACCCTCTACCTAGTATTCGGTGCCTGAGCTGGCATGGTCGGCACGGCCCTG---AGTCTCCTAATTCGAGCAGAACTAAGTCAACCAGGAGCCTTGCTAGGTGAC---GACCAGATCTATAATGTAATTGTTACAGCACATGCCTTTGTAATAATTTTCTTTATAGTAATGCCCGTTATAATTGGTGGGTTTGGCAACTGGCTAGTCCCCCTAATA---ATTGGAGCCCCGGACATAGCTTTCCCCCGAATAAACAACATGAGCTTCTGACTGCTGCCCCCATCCTTCCTACTTCTTCTTGCCTCCTCAGGCGTAGAAGCGGGAGCCGGGACCGGCTGAACTGTATACCCCCCTCTGGCAAGCAACCTTGCACACGCAGGCGCATCAGTAGATTTA---ACCATCTTCTCCCTACACTTAGCTGGAGTTTCATCCATTCTTGGGGCAATTAACTTTATCACAACCATTATCAACATAAAACCCCCAGCAGCCTCTCAATACCAAACACCTCTGTTCGTATGATCCGTCCTAATTACTGCTGTTCTACTCCTCCTATCCCTGCCCGTCTTGGCCGCA---GGCATCACAATGCTACTAACTGACCGAAATCTCAATACCACATTCTTTGACCCTGCCGGAGGGGGCGACCCCATCTTATACCAACACCTTTTCTGATTCTTCGGACACCCAGAAGTATACATTTTAATTCTCCCAGGGTTCGGAATAGTTTCCCATATTGTAGCATACTACGCAGGTAAAAAA---GAACCATTCGGCTATATGGGAATAGTATGAGCCATAATGGCCATCGGCCTATTAGGATTCATCGTATGAGCTCACCACATGTTTACAGTTGGAATAG 
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Statistics of barcoding coverage: Amia calva

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 6
Species: 6
Species With Barcodes: 1

Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Conservation

Conservation Status

Conservation Status

Though Amia calva is not listed as threatened or endangered it is considered a candidate species that could achieve the threatened or endangered level. The main methods to stop A. calva from reaching this level are to develop, maintain, and protect wetlands, as well as controlling sedimentation.

US Federal List: no special status

CITES: no special status

State of Michigan List: no special status

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

National NatureServe Conservation Status

Canada

Rounded National Status Rank: N4 - Apparently Secure

United States

Rounded National Status Rank: N5 - Secure

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

NatureServe Conservation Status

Rounded Global Status Rank: G5 - Secure

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Threats

Not Evaluated
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© WorldFish Center - FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Relevance to Humans and Ecosystems

Benefits

Economic Importance for Humans: Negative

Amia calva are voracious eaters and can have a negative impact on game fish in the area. Since the majority of a bowfin’s diet is composed of other fish such as bass and bluegill, they can have negative effects on the populations of these animals (Scott and Crossman, 1973).

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Economic Importance for Humans: Positive

Though bowfin are not a "game fish", many anglers enjoy catching this animal. They are not sought after for their meat due to its pasty consistency, but are exciting to catch do to their aggressive behavior and strong bodies (Scott and Crossman, 1973). Bowfin eggs have been marketed fairly successfully as a less expensive caviar under the name "Choupiquet Royal" (Ross, 2001).

Positive Impacts: food

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Importance

fisheries: of no interest; gamefish: yes; aquarium: public aquariums
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© WorldFish Center - FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Wikipedia

Bowfin

The Bowfin, Amia calva, is the last surviving member of the order Amiiformes (which includes 3 additional, now-extinct families dating from the Jurassic, to the Eocene), and of the family Amiidae (which contains numerous species in about four subfamilies, only one of which, Amiinae, is still extant). The Bowfin is a freshwater piscivore, preying on fish and larger aquatic invertebrates by ambush or stalking. Native to southeastern Canada and eastern United States, they prefer shallow, weedy waters of lakes or protected back waters of rivers. Bowfin are able to breathe air, using their swim bladder as a primitive lung and can be seen coming to the surface and gulping air even in well oxygenated water. This air-breathing ability allows them to utilize shoreline habitats that are not accessible to other predator fish.

Contents

Description and biology

Bowfin in aquarium

The most distinctive characteristic of the these is its very long dorsal fin consisting of 145 to 250 rays, and running from mid-back to the base of the tail. The caudal fin is a single lobe, though heterocercal.[1] They can grow up to 109 centimetres (43 in) in length, and weigh 9.75 kilograms (21.5 lb).[2] Other noticeable features are the black "eye spot" usually found high on the caudal peduncle, and the presence of a gular plate. The gular plate is a bony plate located on the exterior of the lower jaw, between the two sides of the lower jaw bone.

The bowfin is an indiscriminate predator that readily preys on a broad variety of arthropod and vertebrate prey, from insects and crawfish to other fish and frogs.

The male bowfin exhibits extensive parental care. The male clears an area in the mud for the female to lay eggs in, and then fertilizes them. He hovers nearby and aggressively protects the eggs and the fry after they emerge.[3]

Fishing

Bowfin caught in the Coosa River near Wetumpka, Alabama (released afterwards)

Bowfin are usually not considered a good food fish compared to more popular freshwater gamefish species, such as pike or trout. They are generally regarded as trash fish by sportsmen in the United States, because they eat more desirable species, including crayfish. However, because bowfin are a native species, they should not be killed unnecessarily. They will occasionally strike - and sometimes ruin with their powerful jaws - artificial lures, but they generally strike on live or cut fishes. When hooked, Bowfin fight powerfully. Bowfin should be handled carefully, as they have very sharp teeth. They will continue to struggle even when pulled out of the water, and will attempt to bite anyone who is handling them.

The list of local and alternate names the bowfin is known by is lengthy, but common ones include "dogfish", "mudfish", "grindle" (or "grinnel"),"swamp muskie", "black fish", "cottonfish" "swamp bass", "poisson-castor", "Speckled Cat" "beaverfish", "Cypress trout" and "lawyer". In parts of Louisiana they are called "tchoupique" or "choupique".[4]

While generally considered a poor-quality eating fish compared to more popular game fish, the bowfin can be palatable if properly prepared. Commercially, bowfin are harvested primarily for their eggs as caviar, though the meat also is sold. The EPA recommends minimizing consumption of bowfin because they accumulate higher amounts of mercury than most fish.

The bowfin will strike as hard as a bass or pike, are considered tough fighters, and grow as large as bass, up to 20 pounds. The Bowfin as a species is in the least concern category. Future management for the bowfin looks as though it has not been considered by many. The bowfin is a thriving species where it is found and considered a pest by most.

References

  1. ^ Nelson, Joseph S. (2006). Fishes of the World. John Wiley & Sons, Inc. ISBN 0-471-25031-7
  2. ^ Froese, Rainer, and Daniel Pauly, eds. (2009). "Amiidae" in FishBase. January 2009 version.
  3. ^ Berra, Tim M. (2001). Freshwater Fish Distribution. San Diego: Academic Press. ISBN 0-12-093156-7
  4. ^ Meyer, C.P. "Home." Bowfin Anglers Group. Bowfin Anglers Group. 21 Mar 2010.

Sepkoski, Jack (2002). "A compendium of fossil marine animal genera". Bulletins of American Paleontology 364: p.560. http://strata.ummp.lsa.umich.edu/jack/showgenera.php?taxon=611&rank=class. Retrieved 2011-05-17. 

Catherine A. McCormick.1981.Central Projects of the lateral line and eight nerves in the bowfin,Amia Calva. The journal of comparative neurology 197:1-15.

JM Conlon, JH Youson, J Whittaker.1991.structure and receptor-binding activity of insulin from a holostean fish, the bowfin:Amia Calva.Biochem j. 276:261-264

T M Nguyen, T P Mommsen, S M Mims, J M Conlon.1994.Characterization of insulins and proglucagon-derived peptides from a phylogenetically ancient fish, the paddlefish:Polyodon spathula.Biochem J.300(Pt 2): 339–345

J M Conlon, J H Youson, T P Mommsen.1993.Structure and biological activity of glucagon and glucagon-like peptide from a primitive bony fish, the bowfin: Amia calva.J.295(Pt 3): 857–861.


Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

 

Source: Wikipedia

Unreviewed

Article rating from 0 people

Average rating: 2.5 of 5

Names and Taxonomy

Taxonomy

Comments: Sole living representative of Order Amiiformes.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!