Overview

Comprehensive Description

Biology

Inhabits shallow protected coral reefs and nearby silty sand and rubble bottoms (Ref. 2334). Feeds mainly on hard-shelled prey, including mollusks, crustaceans and sea urchins (Ref. 9823).
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Distribution

Range Description

This species is found in the western Pacific, from the Indo-Malay Archipelago, Philippines, to PNG, Solomon Islands and NE Australia. It has also been recorded from the Cocos Keeling Islands (R. Myers pers. comm. 2009).

Range size 8,058,943 km2
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Western Central Pacific: Philippines to the Great Barrier Reef (Ref. 2334). Restricted to the Indo-Malayan region in the broad sense.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Western Pacific.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Physical Description

Morphology

Dorsal spines (total): 9; Dorsal soft rays (total): 10 - 11; Analspines: 3; Analsoft rays: 10 - 11; Vertebrae: 25
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Size

Maximum size: 190 mm SL
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Max. size

19.0 cm SL (male/unsexed; (Ref. 9823))
  • Westneat, M.W. 2001 Labridae. Wrasses, hogfishes, razorfishes, corises, tuskfishes. p. 3381-3467. In K.E. Carpenter and V. Niem (eds.) FAO species identification guide for fishery purposes. The living marine resources of the Western Central Pacific. Vol. 6. Bony fishes part 4 (Labridae to Latimeriidae), estuarine crocodiles. FAO, Rome. (Ref. 9823)   http://www.fishbase.org/references/FBRefSummary.php?id=9823&speccode=4844 External link.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Diagnostic Description

Usually bright green in algae habitat, but pale or with longitudinal dark bands on plain rubble (Ref. 48636). Head of male with intricate reticulate pattern of bands that varies from one individual to another; small blackish spot on anus. Juveniles and females with dark dots dorsally and posteriorly; these are lost in males. Anterior lateral line scales with 1-3 pores; 8-13 suborbital pores. Anterior dorsal and anal soft rays longer than posterior rays; male pelvic fins not reaching the anus.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Ecology

Habitat

Habitat and Ecology

Habitat and Ecology
This species is a moderately sized Halichoeres (18 cm). It is common on sheltered reefs and shallow rubble sites to 10 m (Westneat 2001).

Systems
  • Marine
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Environment

reef-associated; marine; depth range 0 - 10 m (Ref. 9710)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Depth range based on 9 specimens in 1 taxon.
Water temperature and chemistry ranges based on 7 samples.

Environmental ranges
  Depth range (m): 0.4575 - 9
  Temperature range (°C): 26.803 - 28.954
  Nitrate (umol/L): 0.068 - 0.099
  Salinity (PPS): 34.113 - 34.975
  Oxygen (ml/l): 4.525 - 4.666
  Phosphate (umol/l): 0.108 - 0.131
  Silicate (umol/l): 1.005 - 1.596

Graphical representation

Depth range (m): 0.4575 - 9

Temperature range (°C): 26.803 - 28.954

Nitrate (umol/L): 0.068 - 0.099

Salinity (PPS): 34.113 - 34.975

Oxygen (ml/l): 4.525 - 4.666

Phosphate (umol/l): 0.108 - 0.131

Silicate (umol/l): 1.005 - 1.596
 
Note: this information has not been validated. Check this *note*. Your feedback is most welcome.

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Depth: 0 - 10m.
Recorded at 10 meters.

Habitat: reef-associated.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Trophic Strategy

Inhabits shallow protected coral reefs and nearby silty sand and rubble bottoms. Feeds mainly on hard-shelled prey, including molluscs, crustaceans and sea urchins.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Statistics of barcoding coverage: Halichoeres chloropterus

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 5
Specimens with Barcodes: 17
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Barcode data: Halichoeres chloropterus

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 5 barcode sequences available from BOLD and GenBank.  Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

CCTTTATTTAGTATTCGGAGCNTGAGCCGGGATGGTAGGCACAGCCCTAAGCTTGCTCATCCGAGCTGAGCTGGCCCAGCCCGGCGCCCTCCTTGGAGACGACCAAATTTACAATGTAATCGTTACAGCCCACGCTTTCGTAATAATTTTCTTTATAGTTATGCCTATTATGATTGGTGGCTTCGGGAACTGACTTATCCCCCTAATGATTGGGGCACCAGATATGGCCTTCCCTCGAATAAACAACATGAGCTTCTGGCTCCTGCCCCCCTCTTTCCTCCTCCTCCTCGCCTCCTCAGGCGTAGAAGCAGGCGCAGGAACCGGTTGAACGGTTTACCCACCCCTGGCAGGCAACCTCGCCCACGCTGGAGCTTCCGTCGACCTAACCATTTTCTCACTTCACTTAGCTGGTATCTCATCAATTCTAGGGGCAATTAACTTCATTACAACTATTATTAATATGAAACCCCCAGCAATCTCCCAATACCAAACGCCCCTCTTCGTGTGAGCCGTTCTAATTACAGCAGTTCTGCTCCTTCTCTCTCTTCCTGTACTAGCCGCCGGCATTACCATGCTCCTAACAGACCGTAACCTTAATACCACCTTCTTCGACCCCGCAGGAGGAGGTGATCCCATCCTCTACCAACACCTA
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Conservation

Conservation Status

IUCN Red List Assessment


Red List Category
LC
Least Concern

Red List Criteria

Version
3.1

Year Assessed
2010

Assessor/s
Choat, J.H.

Reviewer/s
Craig, M.T. & Carpenter, K.E.

Contributor/s

Justification
This species is a moderately common wrasse with a broad distribution in the Western Pacific. Its habitat on shallow sheltered reef flats is widespread. There is little information on the biology and ecology and use of the species. It is listed as Least Concern.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Population

Population
This species is common in shallow water rubble sites.

In Langkawi Island, Malaysia, a mean density of 0.33 individuals from three 100 m X 2 m transects was recorded in underwater fish visual surveys (Lee et al. 2005).

On the east coast of Peninsular Malaysia, a mean density of 2.05 individuals from twenty 50 m X 5 m transects was recorded in underwater fish visual surveys (Yusuf et al. 2002).

Population Trend
Unknown
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Threats

Major Threats
There are no known threats to this species, although it is a minor component of the aquarium trade.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Least Concern (LC)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Management

Conservation Actions

Conservation Actions
There are no known species specific conservation measures in place.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Relevance to Humans and Ecosystems

Benefits

Importance

fisheries: minor commercial; aquarium: commercial; price category: very high; price reliability: very questionable: based on ex-vessel price for species in this family
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Wikipedia

Halichoeres chloropterus

The pastel-green wrasse, Halichoeres chloropterus, is a species of wrasse native to the central western Pacific Ocean. It can be found on coral reefs and the surrounding areas at depths from the surface to 10 m (33 ft). Its coloration varies depending upon the habitat in which it occurs, ranging from bright green in fish living in areas with heavy algal growth to pale or with dark bars for those inhabiting rubble areas. This species can reach 19 cm (7.5 in) in standard length. It is of minor importance to local commercial fisheries and can be found in the aquarium trade.[2]

References[edit]

  1. ^ Choat, J.H. 2010. Halichoeres chloropterus. In: IUCN 2013. IUCN Red List of Threatened Species. Version 2013.1. <www.iucnredlist.org>. Downloaded on 09 November 2013.
  2. ^ Froese, Rainer and Pauly, Daniel, eds. (2013). "Halichoeres chloropterus" in FishBase. August 2013 version.


Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

Source: Wikipedia

Unreviewed

Article rating from 0 people

Default rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!