Articles on this page are available in 1 other language: Chinese (Simplified) (4) (learn more)

Overview

Comprehensive Description

Biology

A coastal species, found inshore and offshore on the continental and insular shelves (Ref. 244). Feeds on sharks, rays and bony fishes (Ref. 244); also cephalopods (Ref. 13567). Viviparous (Ref. 50449). Thought to be potentially dangerous because of its large, fearsome teeth and shallow-water habitat, but has not been recorded in an attack on people (Ref. 244). Caught regularly by inshore gillnet, bottom trawl (occasionally) and longline fisheries (Ref.58048). Regularly taken in artisanal fisheries (Ref. 13567). Utilized fresh for human consumption, liver processed for vitamins, fins used in the oriental shark fin trade, and by-products processed into fishmeal (Ref. 244). Most adults below 200 cm (Ref. 30573).
  • Compagno, L.J.V. 1984 FAO Species Catalogue. Vol. 4. Sharks of the world. An annotated and illustrated catalogue of shark species known to date. Part 2 - Carcharhiniformes. FAO Fish. Synop. 125(4/2):251-655. Rome: FAO. (Ref. 244)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Distribution

Range Description

Hemipristis elongatus is found in the Indo-West Pacific: South Africa, Madagascar, Mozambique, Tanzania, Aden, the Red Sea, the Persian Gulf, Pakistan, India, Thailand, Viet Nam, China, Indonesia (Java), the Philippines and Australia (Bunbury in Western Australia to Lizard Island in Queensland) (Last and Stevens 1994, Compagno 1998, W. White unpubl. data).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Indo-West Pacific: Red Sea and southeast Africa to Philippines, north to China, south to Australia.
  • Compagno, L.J.V. 1984 FAO Species Catalogue. Vol. 4. Sharks of the world. An annotated and illustrated catalogue of shark species known to date. Part 2 - Carcharhiniformes. FAO Fish. Synop. 125(4/2):251-655. Rome: FAO. (Ref. 244)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Red Sea, Indo-West Pacific: East Africa east to Philippines, north to southern China, south to northern Australia.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Physical Description

Morphology

Dorsal spines (total): 0; Dorsal soft rays (total): 0; Analspines: 0; Analsoft rays: 0
  • Compagno, L.J.V., D.A. Ebert and M.J. Smale 1989 Guide to the sharks and rays of southern Africa. New Holland (Publ.) Ltd., London. 158 p. (Ref. 5578)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Size

Maximum size: 2300 mm TL
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Max. size

240 cm TL (male/unsexed; (Ref. 5578))
  • Compagno, L.J.V., D.A. Ebert and M.J. Smale 1989 Guide to the sharks and rays of southern Africa. New Holland (Publ.) Ltd., London. 158 p. (Ref. 5578)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Diagnostic Description

A slender weasel shark with a long, broadly rounded snout, large curved, saw-edged teeth in the upper jaw, and hooked lower teeth protruding from mouth; gill slits long; fins strongly curved (Ref. 5578). Light grey or bronzy with no prominent markings (Ref. 5578).
  • Compagno, L.J.V., D.A. Ebert and M.J. Smale 1989 Guide to the sharks and rays of southern Africa. New Holland (Publ.) Ltd., London. 158 p. (Ref. 5578)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Ecology

Habitat

Habitat and Ecology

Habitat and Ecology
Hemipristis elongatus is a rare to common tropical coastal species at depths down to 130 m (Compagno 1998).

This species attains 240 cm total length (TL), with females and males maturing at approximately 120 and 110 cm TL, respectively. They are viviparous and have a seasonal reproductive cycle with 2 to 11 (mean = 6) young per litter and born at 45 to 52 cm TL (Compagno 1984, Last and Stevens 1994). Mating appears to take place around June, ovulation in September and birth in about April, with a gestation period of about 7 to 8 months. The pregnancy rate among mature females off Australia is about 30%, which suggests that individual females may breed on every other year (Stevens and McLoughlin 1991).

Australian populations were found to feed on cephalopods and teleost fish (Stevens and McLoughlin 1991), whereas in India they are reported to feed on a variety of prey including many teleost species, grey sharks and butterfly rays, as well as prawns (Compagno 1984, Setna and Sarangdhar 1949).

A length-weight curve and fork length-total length conversion (sexes combined) for this species were provided by Stevens and McLoughlin (1991):

Weight (gm) = 1.62 x 10-3 TL 3.21
Fork length (cm) = 0.79TL + 1.43

There is no information on the age at maturity and growth of this species.

Systems
  • Marine
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Environment

demersal; marine; depth range 1 - 130 m (Ref. 6871)
  • Last, P.R. and J.D. Stevens 1994 Sharks and rays of Australia. CSIRO, Australia. 513 p. (Ref. 6871)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Depth range based on 30 specimens in 1 taxon.
Water temperature and chemistry ranges based on 23 samples.

Environmental ranges
  Depth range (m): 15 - 144
  Temperature range (°C): 20.374 - 28.199
  Nitrate (umol/L): 0.218 - 10.770
  Salinity (PPS): 34.334 - 35.354
  Oxygen (ml/l): 3.016 - 4.657
  Phosphate (umol/l): 0.135 - 0.979
  Silicate (umol/l): 1.140 - 15.661

Graphical representation

Depth range (m): 15 - 144

Temperature range (°C): 20.374 - 28.199

Nitrate (umol/L): 0.218 - 10.770

Salinity (PPS): 34.334 - 35.354

Oxygen (ml/l): 3.016 - 4.657

Phosphate (umol/l): 0.135 - 0.979

Silicate (umol/l): 1.140 - 15.661
 
Note: this information has not been validated. Check this *note*. Your feedback is most welcome.

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Depth: 1 - 130m.
From 1 to 130 meters.

Habitat: demersal.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Trophic Strategy

Occurs on the continental shelf (Ref. 75154).
  • Salini, J.P., S.J. Blaber and D.T. Brewer 1992 Diets of sharks from estuaries and adjacent waters of the north-eastern Gulf of Carpentaria, Australia. Aust. J. Mar. Freshwat. Res. 43(1):87-96. (Ref. 13356)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Partner Web Site: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Life History and Behavior

Life Cycle

Viviparous, with 2 to 11 young in a litter (Ref. 6871) after a gestation period of 7-8 months; possibly reproduces in alternate years (Ref.58048). Size at birth about 45-52 cm TL (Ref. 13567, Ref.58048). Distinct pairing with embrace (Ref. 205).
  • Breder, C.M. and D.E. Rosen 1966 Modes of reproduction in fishes. T.F.H. Publications, Neptune City, New Jersey. 941 p. (Ref. 205)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Hemipristis elongata

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 10 barcode sequences available from BOLD and GenBank.

Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.

See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

CCTTTATCTGATTTTTGGTGCATGAGCAGGAATAGTTGGAACAGCCCTGAGTCTTTTAATTCGAGCTGAATTAGGGCAACCAGGTTCTCTCTTAGGTGATGATCAGATCTATAATGTAATTGTAACCGCCCATGCTTTTGTAATAATCTTTTTTATGGTTATACCAATTATAATTGGTGGCTTCGGAAACTGACTAGTTCCTCTAATAATTGGAGCCCCAGATATAGCTTTTCCACGAATAAATAATATAAGTTTCTGACTTCTTCCTCCTTCCTTTCTTCTTCTCCTTGCTTCTGCTGGAGTAGAAGCTGGAGCAGGCACTGGTTGAACAGTTTACCCTCCCTTGGCAAGTAATTTAGCCCATGCTGGGCCGTCCGTTGACTTAGCTATTTTCTCTCTTCATTTAGCTGGAGTTTCATCAATCTTGGCCTCAATTAACTTTATCACAACTATTATTAATATAAAACCCCCGGCTATCTCTCAATATCAAACACCGCTATTCGTTTGATCAATTCTTGTAACTACTATCCTTCTTCTCCTCTCACTTCCAGTTCTTGCAGCAGGTATTACAATATTACTTACAGATCGTAACCTCAACACTACATTCTTCGACCCTGCAGGTGGAGGTGATCCAATCCTATATCAACACCTATTN
-- end --

Download FASTA File

Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Hemipristis elongata

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 6
Specimens with Barcodes: 19
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Conservation

Conservation Status

IUCN Red List Assessment


Red List Category
VU
Vulnerable

Red List Criteria
A2bd+3bd+4bd

Version
3.1

Year Assessed
2003
  • Needs updating

Assessor/s
White, W.T. (SSG Australia & Oceania Regional Workshop, March 2003)

Reviewer/s
Fowler, S. & Cavanagh, R.D. (Shark Red List Authority)

Contributor/s

Justification
Hemipristis elongatus is commonly landed in coastal fisheries throughout its shallow (to 130 m) tropical Indo-West Pacific range (to a lesser extent in Australia) since the flesh is considered of very high quality, as are the fins and liver. The intensive and largely unmanaged net and trawl fisheries that occur throughout its range (with the exception of Australia) fish heavily in its known habitat and are likely to catch this species if present. Many shark fisheries and stocks in the region are known to be over-exploited, with catches declining, and market surveys indicate that this species has declined in areas where it was once considered common. This trend is likely to continue in future in the absence of management and because of continued, if not increasing fishing effort.

Australia is the exception to this pattern; the species is only a minor component of northern Australian trawl fisheries and is of little commercial value so is considered Least Concern here.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Population

Population Trend
Decreasing
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Threats

Major Threats
Hemipristis elongatus forms a minor component of the northern Australian gillnet and trawl (prawn and fish) fisheries (Last and Stevens 1994, Stobutzki et al. 2002, R. McAuley pers. comm.) and is also landed in the gillnet and trawl fisheries in Indonesia (W. White unpubl. data) and presumably in other countries within its range.

The gill net and trawl fisheries in Indonesia (especially the Java Sea) are very extensive and as a result, many shark species are highly exploited. Catches of sharks in south-east Asia are very high but are declining and fishers are travelling much further from the ports in order to increase catches (Chen 1996). Trawl and gill net fisheries are also moving further away, e.g., in Jakarta the gill net fishery at Muara Baru travels to waters around Kalimantan due to the decline in local shark populations (W. White unpubl. data). In the Gulf of Thailand this species was once considered common, however, surveys in recent years have observed very few specimens (L.J.V. Compagno pers. comm.). The numbers observed in the market surveys in this region, e.g., Indonesia, are likely to provide a relatively good representation of the population of this species.

In India, the fins and oil are utilized and the flesh is considered of extremely high quality (Last and Stevens 1994).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Vulnerable (VU) (A2bd+3bd+4bd)
  • IUCN 2006 2006 IUCN red list of threatened species. www.iucnredlist.org. Downloaded July 2006.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Management

Conservation Actions

Conservation Actions
Recent species composition and catch data for fisheries within its range are required to assess the population trends, especially in areas where there is a very high level of fishing pressure.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Relevance to Humans and Ecosystems

Benefits

Importance

fisheries: commercial
  • Coppola, S.R., W. Fischer, L. Garibaldi, N. Scialabba and K.E. Carpenter 1994 SPECIESDAB: Global species database for fishery purposes. User's manual. FAO Computerized Information Series (Fisheries). No. 9. Rome, FAO. 103 p. (Ref. 171)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Wikipedia

Snaggletooth shark

The snaggletooth shark, or fossil shark (Hemipristis elongata), is a species of weasel shark, in the family Hemigaleidae, and the only extant member of the genus Hemipristis. It is found in the Indo-West Pacific, including the Red Sea, from southeast Africa to the Philippines, north to China, and south to Australia, at depths of from 1 to 130 m. This shark can be found near the bottom of the water column of coastal areas, but can be found at continental and insular shelves.[1] Its length is up to 240 cm (7.87 ft) .[2] Despite being only vulnerable to extinction, this shark is very rarely seen.

Anatomy[edit]

The snaggletooth's coloration is light grey or bronze with no prominent markings. As its name suggests, it has sharp, serrated teeth on the upper jaw and hooked teeth on the bottom jaw. The shape of its body is fusiform, allowing it greater speed in the water.[3]

Reproduction is a special kind of viviparity, called placental viviparity. This is when the shark carries its live young in a placental-like structure, complete with umbilical cord. The placenta structure is derived from the wall of the embryonic yolk sac that has fused with the uterine wall.[4]

Food[edit]

The Snaggletooth shark preys on a variety of different animals, including bony fish, other sharks, ray, crabs and cephalopods.[5][3][6]

Commercial uses[edit]

There is a fishery for this shark, where sharks are usually caught by fishing trawlers (a type of fishing boat), or by gill nets. Fins are used in the shark fin soup trade in China, and other Asian countries. The meat is sold for consumption, the liver used as a source for vitamins and the rest of the carcass is processed into fish meal.[2]

See also[edit]

References[edit]

Cech, J. J. JR. and P. B. Moyle. 2004. Fishes: An Introduction to Ichthyology. 5th ED. Prentice Hall, Upper Saddle River, NJ.

Chandrasekar, S. and P. Devadoss. 1991. A note on the rare snaggle tooth shark, Hemipristis elongata. Mar. Fish. Infor. Serv. 114:36.[6]

Katkar, B.N. and C. J. Josekutty. 2003. Snaggletooth shark, Hemipristis elongata landed at Sassoon Dock, Mumbai. Mar. Fish. Infor. Serv. 176:12.[2]

Manojkumar, P.P and P.P. Pavithran. 2004. First record of snaggletooth shark, Hemipristis elongata (Klumzinger, 1871) from Malabar Coast. Mar. Fish. Infor. Serv. 180:13-14.[3]

Hemipristis elongata (Klunzinger, 1871) Snaggletooth shark". Fishbase. Retrieved 2011-11-09.

  1. ^ "Hemipristis elongatus (Klunzinger, 1871) Snaggletooth shark". Fishbase. Retrieved 9 November 2011. 
  2. ^ a b c [1], Katkar & Josekutty 2003.
  3. ^ a b c [2], Manojkumar & Pavithran 2004.
  4. ^ Cech, Moyle, Joseph J. Jr., Peter B (2004). Fishes: An Introduction to Ichthyology. Upper Saddle River: Prentice Hall. p. 15. ISBN 0-13-100847-1. 
  5. ^ "Hemipristis elongatus (Klunzinger, 1871) Snaggletooth shark". Fishbase. Retrieved 9 November 2011. 
  6. ^ a b [3], Chandrasekar & Devadoss 1991.
Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

Source: Wikipedia

Unreviewed

Article rating from 0 people

Default rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!