Overview

Comprehensive Description

Biology

Found on current-prone (Ref. 48635) sand or mud bottoms (Ref. 11228), usually in depths of 20 m or more. Usually buries itself in the sand (Ref. 48635). Sold fresh and dried salted in markets.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Distribution

Djibouti, Eritrea, Mauritius, Mozambique, Seychelles, Somalia, South Africa (country), Ungama Bay
Creative Commons Attribution 3.0 (CC BY 3.0)

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Indo-West Pacific: southern Red Sea and East Africa (Ref. 4055) to southern India and Sri Lanka. One specimen is known from the Philippines. Also reported from Indonesia and northwestern Australia (Ref. 5978).
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Red Sea, Indo-West Pacific: East Africa east to Philippines, south to Western Australia.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Physical Description

Morphology

Dorsal spines (total): 0; Dorsal soft rays (total): 11 - 13; Analspines: 0; Analsoft rays: 9 - 11
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Size

Maximum size: 330 mm TL
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Max. size

33.0 cm TL (male/unsexed; (Ref. 11228))
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Diagnostic Description

Body dusky pink above, with pale blue-grey blotches and stripes; 2 black streaks at upper edge of operculum; caudal fin yellow in color; some with dark blotches along lateral line (Ref. 11228).
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Description

Found in shelf waters. Inhabits soft bottoms (Ref. 9710). Sold fresh and dried salted in markets.
Creative Commons Attribution 3.0 (CC BY 3.0)

© WoRMS for SMEBD

Source: World Register of Marine Species

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Ecology

Habitat

Environment

reef-associated; marine; depth range 20 - 100 m (Ref. 9710)
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Depth range based on 271 specimens in 1 taxon.
Water temperature and chemistry ranges based on 162 samples.

Environmental ranges
  Depth range (m): 11.5 - 141
  Temperature range (°C): 21.318 - 27.590
  Nitrate (umol/L): 0.164 - 19.318
  Salinity (PPS): 33.945 - 36.290
  Oxygen (ml/l): 1.907 - 4.701
  Phosphate (umol/l): 0.169 - 1.428
  Silicate (umol/l): 2.202 - 21.536

Graphical representation

Depth range (m): 11.5 - 141

Temperature range (°C): 21.318 - 27.590

Nitrate (umol/L): 0.164 - 19.318

Salinity (PPS): 33.945 - 36.290

Oxygen (ml/l): 1.907 - 4.701

Phosphate (umol/l): 0.169 - 1.428

Silicate (umol/l): 2.202 - 21.536
 
Note: this information has not been validated. Check this *note*. Your feedback is most welcome.
Public Domain

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Depth: 20 - 100m.
From 20 to 100 meters.

Habitat: reef-associated.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© FishWise Professional

Source: FishWise Professional

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Trophic Strategy

Occurs in inshore waters of the continental shelf (Ref. 75154).
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Synodus indicus

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 3 barcode sequences available from BOLD and GenBank.  Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

CCTCTACATAATCTTTGGTGCCTGGGCCGGAATGGTGGGGACAGCCCTCAGCCTTTTGATCCGCGCTGAGCTTAGCCAGCCCGGGGCCCTTCTAGGGGATGACCAAATCTACAATGTAATTGTTACCGCCCACGCATTCGTAATAATTTTCTTTATAGTGATACCAATCATAATTGGCGGTTTTGGAAATTGACTTATCCCTCTAATGATTGGCGCCCCTGATATAGCCTTTCCTCGAATAAATAATATGAGCTTCTGGCTTCTGCCTCCATCGTTCCTGCTCCTCCTAGCATCCTCTGGTGTCGAGGCCGGAGCCGGTACCGGATGAACGGTTTACCCCCCGTTAGCGGGCAACTTAGCCCACGCTGGGGCCTCAGTAGACTTAACAATTTTTTCCCTTCACTTGGCGGGGATTTCATCTATTTTGGGTGCAATCAACTTTATTACAACTATTATTAACATAAAGCCCCCCTCAATTTCCCAGTATCAGACCCCCCTTTTCGTCTGGGCCGTGCTAATTACGGCAGTACTACTTTTGCTTTCTCTTCCGGTCCTAGCGGCTGGTATTACAATGCTACTTACAGATCGAAACTTAAACACTACTTTCTTCGATCCTGCAGGAGGCGGGGACCCTATTTTGTACCAGCACCTG
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Statistics of barcoding coverage: Synodus indicus

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 4
Specimens with Barcodes: 4
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Conservation

Threats

Not Evaluated
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Relevance to Humans and Ecosystems

Benefits

Importance

fisheries: commercial
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© FishBase

Source: FishBase

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Wikipedia

Indian lizardfish

The Indian lizardfish (Synodus indicus) is a species of lizardfish that lives mainly in the Indo-West Pacific Ocean.

References


Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

 

Source: Wikipedia

Unreviewed

Article rating from 0 people

Average rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!